Scaffold:GCSC_124 Details

Name: GCSC_124
Class: Scaffold
Type: scaffold
Source: scaffold
Position: GCSC_124:1..270654 (+ strand)
Length: 270654
Note: GCSC_124
>GCSC_124 class=Scaffold position=GCSC_124:1..270654 (+ strand)
AACTATCTTGACACGTTGCACGGGACTAGCACAGCCACTTAGCTGCGCCACGCCCTACTAGGTTTGCGCTACACCGCATC
TTCCAGCCACGTATATATTAGCTGGCAGGCCTTCGCCTACCAATCTTCTATAGTTTGTTAAGTTAAAGTCTTAATACAAC
AGTACAAACCAGTTAAGCCTTTGTAACTATGCATTGCACACTAGCCCCTTATATAATTTTAGTAAGAACTAATGCAACTT
TAAAGGGTCTAGCTAATAATGTTAATAGCGTACTACTTATAAATAAATAGTAGCACTAAGATCTTTAACTAGACCTTAAA
GCGCTTCCTACAAACGTTCTATAGTTGTTTGCAACACTAGTAAACATAGGTGTTAAGTACGGCAGAGTTTGCGTATAACA
ACGCCTACTATACTATAATAAAGACCTTTTTGTTCTATACGTTATACGTATACTACCTTTGTTTTATAAACAACTTTCCT
TTTACTAAGGCTGCGGTAAAGGGCGTGTAAGAGCGTGTTAGTCGGCTATAGGCTATCTAGTAAAAGCTAGAAGTATTGTA
GGGAAAAGCAATTTGCTAATAAGAGAAAGGCTATAATAAGCGACGCCTATATAAAGACTTTGTTAACGGTAAATTTATAG
GTTTGTTAATAAAGCACTTAAACCTAGCTAACTTAAAAAAGCTAAACTTAACCTTCTTATACGTTTGCATTATAAAAAAG
CTAGGCCTAGTTATATATTAGGTCGCCTTACTATTATAGTATACACGCTAATATAATGTGTTTTACATCTCTTGCCTTAA
GCTATAAACTACTATAGTAAAAGAGAAGAAAGAGCTTTTATTTTTAAAAATAGTAGAAGACTAAGAGGAGTATAAGTATT
AAAGGTATACTTAGGTAAGCTAAGTAAGTTAGGCAGGCAAGAAGGTATCTTCTTAATAAGAGAAAGCAGCTATATATTTA
ATAGCTAATTCTTACCTTCTACACTCTAAGAGAGTGCAAGAGGCGCTCTTTATCGTAGGCGCACCTCTAGCGCACCAAGT
GCGCAGAACAAGCGCAACCTCGTTTGTACTTAGCCCGTACGCTAGCACGTACTATAGCCTATGCGCAAACTACGCTACAC
AGCCTACGCCACTAGCACCGCTTCTAGTTTACAATGTACATCTAATACGCTATGCGCATACTACGTATAGCTTGCGCATA
GCCTACGTCGGTCCCCTTCTTAGGGCGGCGTTATAATTGCTCCCCTCTTATACCTAACTCCTTTAAGGCAGGTCTTAACG
AAAGGCTTGCAACCTTTGTTCCTAGTAGTAGTAGTGCTTGTCCGTTTGCGGCGGCCCCTTTATGCTTGCTAAGATTGCTA
TTAAAGGCGACTTAAGGCGCCTTTAGTTCCCTTTATTTAAGAGGTTAGTTCTATAGTTAAATTAAATTATCGTAAGGTCT
AGCATCTAGTCACTTCTTCTAAAAACAACAAATTCGTCTTCTAGCAGCAACATAGCTACTCTTAATTCTAACGTTCCTAT
GCCCGCGGTAAGCGCCTCTAGCGCTCTAGTACCCGCTACAGCCCTAGCCCTTACTCCCTAATACCCTTGCCCTCTAGCTA
AGGTGCTAGTTCTGGCCGCGCGCAACGTGCGCGCAAGGCTTACGCTAGCATAGTTTGTTGTTTAGCGCGGACTACAGCGC
GCGCCGTGCCCCTAGTTAGGCCTTTAGTAGCCTGTAAAGGTGCGGGAGCTGCCCCTGCTAGTCCGGCGCTCCTAAGGTTA
GTGGCGGCTACGCTACTAGCTTACCCCTAGGTCGCCTTAGACGGCTTGTTGTGCGTGCGGTGCCTACACCGCTTTCTAAC
AACTCTCTCTGCGGAGTTGCCTAGGTTTACAGCCGTGCTATGTATTTATAGCGTCGCTAGCGCTAGGCGCTACGACGGCT
GCCGTGCTAGCAAGCATAAGTATTGCGGGGTAAGTCCTCTTTAGTGGCTATAAGCTGCTTTAGTAGCTAAGAGGATGCAG
GTTTTCCCGCTAATAGTTAGCAACTAGGCCAACTTTAAGATAGTGCTGCGCAGCCTTAATAAGAAGCTCTACAGCTAAGG
TTTGCCTGTAGTGCGCGCGGCACTCGCGTATACTATAGGTGCTTTCGTCGCTACTTTGTTATAGGTAAATAAGTAGTAGC
GGCCTACGTTGCTAAGGGTGTTATTAGCTGCTAATGTTACGCAGGCAAAGCTTAATCTTTGCTAGGGCATTAAGGCCTAA
AAGAAGGCTTAAGAGGTAGCCTGCTAGGTAGAGGCCTAGCAGGCTTTATTAGCCTAAATGCACCTACTATTACTATATAC
GCTCCTTTTGTCTTTGCCGCCTAGGCCCGCTACTTTAACCCTTTAGCAGCTCTCTTAGCTGCCGCGCCTAATGCTTAGTA
ATACTAGTTATGCCACCTTTACCGTAGCCTTTAATGCCTTTCTTAAGGCGGTAGCAAGGGCGTATATTATAAACAAGGCT
TATGCTAGGGTAGCAGCTAGCGTAGCGTCGCTTTAAAAGCTCTTTAAATAGTTTTACATAGTCTTTTATAGGGCCTTTTA
GCCGGTTAAATTAATTTGGGCTCTTGCCTATATATTTTCGTCTTTACGCGCTTACTACGCGCATACGGCTTAATTACTAC
GTGCGCATTTTCTATATCTTCTTCCGGTACTTACTAGTTGTATTTGGTTGGCTAGCCTATCTAACGTACTAGGTATTTAG
TCTAGCCAGCCTTACGTCTTTTATTTAAGACTGCTTTTACTTTTTATTTGTTGTCTAGGTCTTTTAACGCTAGCATTGTT
AAAGGCGCTTGTTTTACGCTTGCTTTGCTTTTTTAGTGCTTTAATAGTAAGACTAAGAAAACGTTGTATAGTTAGCTATA
TTGTTTTAGCAGTGCTAGTTAATATGCCTATCTACCTATAGTCCTAAGGATTCTAAAAGGCCTAATACATTTTAGTACTA
ACTTCTTATTTTTTAAGCAAAGGTTTTTTATAAAAAGGCTTACTAGCTCTTCTATTATAAAGCTTATAGGCTAGTAACGC
GTATTATAGTAACGCTTTTAACGCTTTATTACATGCTCTTAGTTTGCTGCCAACTTTTTCTATATAGCTTCTAGTTTTTC
TAAGCAGTTATGCACCGCTAGGACTATATTGCGCGTGTCTTGCTTCTTTTCTATAGTTGCGCCGCCCTTAGGGCAAGTTT
GCAAGTTTAGTTTCTAACTATATAGCGCTTTAAATAAGCTAATTTTAGTTGTTGCGTTAATAGCGTTATTATAGGCCTAC
TACGCTAAAGATAACAAAGAGGGCTAATTTAATTGCTCCTTTGTTATAAAGCAGCGTAAGTACTACTTTAATATTTAGTT
AGATCTCTTTGTCTACCTATTTGTCTAAGGGTAAAATGCAGTTAACAGCCGCCTATAGATTCTAGTCTAATAATAATATT
TACTCTAGAATTCGCTAGTAAATATACTTCTTTAGTTAAAGACTATACCTTCTAGTATTACGCCTTATACTAGTTCTATA
TGTTAGTATATAAAGTATATAAGGCCTTTAGCCGTTAGGGTAGTCTATATAGCAAAGAAGAGGTTTATTTTTATAAAGCA
ATTAACGATTACTAGAATTGCATCTACTTTACTACCTATACTTGCTTTAGCTACTAGTAGCCTTATAATTAAGTCTATAG
AGATTTCTTACTAAGGACCTTATAGTAGTAGTAGCAAGTTTAGCTTACTATATTATACGTACCGTTTAATCGTCTATCTC
TAGCAAACTAGGCATAAAGCAATGTCAGCCTTTATATCCTTCTTTATTTCTTCCTAGTAGAAGTAACAACAAAGTAGTTT
TAAGGTCCTAGTAACTACAAAGTACCTAAAGATTTAGTTGTTGTAATAAAGCTATAGTAGCTCATAATAAAAAACGTACG
CGCCGCCTATATATAGGCGGTTTTCCTATAGTAATATACTGTCTAGTGCAAGGCTCTATAGCTTTGTTACACCTTCTACG
CTTATAGTGCGCTTTACGCGCGCCTTAACAACTTGCACCTTTAAGTTTACGTCTTAGATTTCTACTATTGCTCTACAAAT
AGCTTTAAAGACTCCGTTTTCTTAAAGGTATAGATGTAAGGTAGCAACGACAGCTAGTTGCTATAGTAGACTAGAGTACA
CTAGGTTTCTATTTATGCCTATTAAGGGCGTTAGACCCTTAATTAGTGCTGCAGCGGTAATATTCCTAAGGTCTCCTTAA
GGTCTCTTATAGTTGTCTAGCCTTCTTAGTTTACCACGCTTTGCCTGCTTAGGCGGTGCGCTGTTTTGCGCTATAGTAGC
TTGCTACGTAAGATTTAAGGCTACTAAGATCCTAGAGGTAGCGCTTAGCTCCTCTTCTCCGCTAGGTCCTTTTGTAAGTG
CGCGCATCTTACGCGTCTTATTCGCATAAGCTGCGTCGGTAACTAGCTTAGCGTTATTGTCTTCTATAATAGGTGCGCGC
ATCTTGCGCGTCTCTTGCGCTACAGCTGCGGTGCCCGCTAACTATGCGTCTTTCTTTTATACCCTAGTGATAGTTATTCT
AACTTATCTAGGTTTATTAAAGTAATCTAGCCGTCTTAACGGCGCATTAGCTAGGTTTGTTACGCCTAGTCTATACTTAA
TTATAAAGTTAAAGAGGGATAGGTATATAGCCTAGCAAGCCTTGCGTTTGTTATACCTTAGCTAGGTTATAAAGGTATAT
AAGTTGTTGTAGTTTAATAAGACTTTAATTGTCTCTTTGCTGCTATTAAGGCAGTGTCGCCATTGCTTAAAAGAGTCTAT
AATTACTAGTAGCTCTTAATCTAGGGTGCTGTAATTTAGCTCTAGTCTTTATAGTTTTTTTAACTAAAAGGCGATTAAGT
GCTAGGCTTTCTCTTTGTCTTATTAAGAGATAATCCTACTAATAGCTACCTTTAAGGTATTAGTCTTTACGCGTATTGCT
TATTCTAGGTTAAAATGGCGTAGTAGAGGTGCTTTTATAAATGCCTCCCTTAGTATTATAAAGGCTGCGCGCTCCTTACT
CCCTAGCTGCACCGGTCCTAGCTTTTTACCATTTTTGCTGCCTTATAGCAGCCTTAACAAAGAAGATAAGATATTTAAGT
AAGCTTTAATAAAGCAACGATAGAAGTTGTATAATCTAAGGAAGACCTATACCTTCTTAAATGTTTATAGCGTTAGCTAT
TTTATAATTGCGTGTACTCTACGCAGGTCTATTACAAACCCTTCGCTTTTAATAATAAACCCTAGGAATTCAACTTCTTA
TTAGTAAAACAAGCATTTATTGCTATTAACAAATAACTAGGCTTGCTAAAAACGCTTAAAGACTTAGTCTAGGTGCTTTA
TATACTCCTCCTTATTTTATAAGAACATAAGGATATTATTTAAGTAGATAATATAGATTGTATTTACTAGACTATATAGC
GCTTAGCTAATATAGTACTAGAAGGTTGCTAGGGCGTTAATTAACCTAAAAAGTAAGACTAGGTATTTAAAGAGACTATA
TTTAGTCTAAAAAGCCGTCTTCTATTTGTCTTCTTCTTTAATCCTTAGACAGTAATACGCCTCTTTAATGTTAATTTTTA
ACATTACCTTTATTCCTACTACGTAGTCTATAATCTTAGAGATTAAAGGTAGCAGGTATTAGTTCTTTACTATAACCTTA
TTTAACCCTCTATAGTTAACGTATAAGCGTAAGCTTCCGTCCTTCTTAGGCATAAAAAGGATAAGTGCGCCTATAAAGCT
TTTTAATAAGTAAATTCGTTCTATTGCTAGGTTATTGTCTAAGTACTAGCGTAGCTCTCTTAATTCTCTTTGCAATAAAG
GATATATTGTCTTATATAGTAGTTAACTGCTAGGTAGAAGATTAATTGTATAGTCGGTAGCCTTGTATAGCGGTAAGACC
TTAGCGTTAGATAAATTTAACACGTCGCTATACTTACGCGCTAAATGCGTAGGCAGTGCGCCTGTGCCTCTTAAATAACC
TTTTACTTCTAGGTCGCCTAGTAAGATTATATATACCTGTGCGCACTCTCTACGCGCTATAGCAAGGAAGATTTCTTATA
GTATAAGTCGTATAGTCTTTATGCGTGCTTCGAACTACTAACAGCGGTCTACTAGCTTTAGGTAAACTTTCTTACTTTAG
AGGGTTGTTATTAATAGTAATATTATTAAGCCTTCATACCTAGCAAGTTTAGTAACTCTTATATAAACTTATATAATCTT
ATAAGTATACCTATAAGAGTCTCTTATACGTAAGGGCACCTTCTACGCTCTTGCTACGCTTATAATGATCCTATTATACG
CTTTAAGGGTTAGTATTAACATCTTTATAGATTCTAGTCCTTATAGTCTTACGAATTTATAGTTAATAGTATTAAGACTT
GCGCAAGTATCTTACGCAGCGGATACTTCTATAGTTATTAGTCTAAAGAGAGAAGCTTAAATAAGAAAAGGATTACTAAT
CTTAATCGTCTCTAGTAACGCCTAGAGGTCTTAGTTTGTCTTAAGCGTTTCTAGTCTTTTTGCCTTTTTAGCATTCTTTT
TAATTAGTTAAACTAAATTTACTAATGTAGTCTCCTACCTTTTTAGGCAGTTTTAAGCAAAGTAGCCTTTGCTTTTATAG
ATAAAGCACTTTATACGCTTACTATTTGTATAGGTAAGGTTCTTTTAGTAGCCTTTAGTAGCTATAGCGGCTAGTTTGCC
TCTCTTTTTGCCTTAGCCTTTGCCTTTAGCACTACTACTACTAGCTGCCGCGACCGCCTTACTACCGCTAGCTATAGCAC
TAGGAATAGTCTTAGCGCCTTACTAACACTTAGCTAAGGTTAGCAACTAGCTGTAAGCTTATTGCTTACTAGGCGCCGCT
AAGGGTAATAGCTAAAGAAAAACTATAGCCTAGTTAGCCTAGGCTAGTTTAACTAGGGCTGCTATAGTCTACGCGATCCG
CTTAGGCAGATCCTTTGCTCTTGCTATATAGTGTAACGTGCTGTTACGTCTAGCCTAAATAGCCGCTATGCGCTAAGCTA
AGGTAAGCATAATAGAATAAGAATTAGCCTAGGCGATAGGTTAGTACTAACTTGCTAATAGGGACAAGAAGACGTGCTAT
TACTTTAAGGGCAGTGGCAACTTAGGTCTACACCTACGATAGCGTGCCTATGTTTAAGGACGTTAGCGGCAAGAGCTAGG
CAACCTTTGCCGCCCGCTAGGCAAGCGTTAAGGTTAGCTCTAGCTCCTACTAGTACTAGTAAAGAACGCTAAGGCGTAAG
GCAGCCTACTACGCCGTCTTAAACTGCTTGCGCTAAGAGCGTTAGTTAGTTGCTAAGGGCTTTAGCTTGTCTTCTTTTAG
GGCACGGCTAAGCTTTTTAGCTACTGCTGTTAACGCTATCACCCGCTAGGCGATTGCTATGCAATCGCCCGACGCTATAA
CAACGTTGTTAGCCGTTATTCGCTAGAGCAGCAACTTGTTTATGCCGGCTAGAAATTTCTAAAGGTAGCGGGCAAGGCCT
TTAATCTTCTTAGGAAGCTATTAGTTAGCGTCTAGCTACTAGCATATATAAAGAGAGCACTTATAAGCAAGTAGGACGCG
TTATTAGCTATATAGCTAGCGTAGCGCCTTAGGTTTTTAAGCGTTGCTACGTATAGGAATTTATAGTAGACGTCTAGGTA
AGCTTTAAGAACGTAATTTAAGCATAAGGCCTACTATAGGGTTAGCTATTATATAGTAGACGCTATGCTAGTAAAGACTT
ATACTTTTAAGTAATAGTATATATGCTTAAGAAGGGCGTTTTGCAGGATCCGCCTTTATAAGAAAGTCTATAAGGACTTA
AGAATAGCTTTAGTTTAACATTGCCTATAAGTAATCGTTAGCTAGCTATTATGCAAAGATGTAGACTATTATACTAACCT
ACTACGCTAAAGGGTTAAAAAAAGAACTAAAAAAGCAAGAGTAGTCTTATAAAGTATAAACAAAATTATCTAAAAAATAT
AGGATGCACTCGCTTTTTAGTACCCTTAAGCAATAAAGAAGCCGCGTTATTAGACGCCTAAATGCGTCTTAAAAACTTGC
TTAACCTTACTTTAATAGCAAGGTAAGAAACGTTTAAAATTAAACAAAGGAACGTCTTAGCAGCAAACCGCCTTTACTAT
CTAGTAAGTAACAGTTCTACAATTGGCGGGCAACAAACGGCCGTTATTACCTTTATCCTACCCTGCTAGTAGTTAGAAGT
TGTAAGCCCTACGCCGCCGTTTTTAGTTAGCGCGCACTACACCCTAGTGCCCTTAGTGTCTAAGGCTAGCCCTCTCTTAA
CACCTATCGGCGGCAACCTAAGCGTTCCCCAACTAGGATCTAAGCCGCACGCCTCCTAGGGAGCTTCTACAAACCAAACG
ACCCTTGCATTAGGCAGGATCTAGCGTCTACTACCGCTATAGACTAAGCAGTACGTGTGCGCTTCTACGTCACCCGAATG
CAGTTGCACTAGCGAGCGGTCCGCGACCGCTCGGCAACAGCCAATAACCCGGGGCACTTGACTCTTTTTCCCACCTTATA
CAAGAGGGTTTTTAACGAGCAAGTAGCTACTACGTGTGCACCTCTAAGCTGACGAGGGCGTTACCTAGGGAGGGGGGGGA
TAGTGTAAGGGTATTCCATACACGTAACCCCACGCACTAGTTCAGCAACTAGTCGCTTACTAAGCGTCAAACTTAACGAA
CTATCTTAACGTGTTGTACAAGACTAGCATAGCTACTAAGCTGCGCTACGCCCTACTAAGGTTGCGCTACACTGTATCTT
TTAGCTATATATAAATTAACTAGCAGGCCTTTGCCTACTAGTCTTTTATAGTTTATTAAGTTATAGTCTTTATATAATAG
TATAAACTAGTTAAGCTTTTATAACTATGCATTGCACACTAGCCCTTTATAAAAAGGTAAGAAGAAGGGTTTAGCTACTT
AAATAAAGGCCTTTAAAAACAAACCTTAAAGAGTAACCCTTAGTTATAAAGGTAGCTAAAAAGGCGTTACTAGTAAATAA
AGTATTATAAACGTAGATATAAAGCTAAAAAAGGGCATTTAAAAAGACTAACTTAAATAATAGTACTAACTAAGAAGCTA
ATATACTAGCAGCATAAATATTTGCTAGCGTAATTAGTATAAAGCTACTATACGCAGCTATACGCTTAATACTTAATTTA
GTGTTATATAAGAGAGGCTTTATAGTAAACCTTAGCTAGTATACTATAGCTGCTAGCTTTGCTTAATAGTCTAGCTAACT
ATGCTACTACTCTTTAGTTATATAAGTATTACTTAAGGTAAGCGCCTTACTATTAAGTAGCAAAGACTTTATAAGCTAAA
GAATACACTCTAAACGTAGCATTAGCTTAGAATAGGTAAAAGCTATAGTTAAGAAACTTATTAACGTATGTACTATAGTA
AGCAGCTAGGTAATGTTTAGTAAAGGTATTATTATAAAGGCTATATATACTATAAGCTTATCTAGTATAGTGTTTAAAAG
GTTTATAAGTAAAAGCGTTTACTTTAACTAATAAAACGTTAGTAGTAGATAAAAACTATAAGATAAGTACTTAACTTATA
GCCGTTAAACGTTATAAGGCTAGTAAGGCTATAAATAAGTAAGTTTAAACTTATAACTTATTAACTAAGGCTATTAATAT
ATAGTCTTAAAAGTATATACTCTTTAAAAGGCTACTAGTATAAGTATAGCTAAATACAATTAATAATAGTGCTAAATAAT
AGTGCCTAGCCTTAGCAAAAAATAGTAATTAAATATAAGTTAAAGCTATAGTAGTATTAAAGGCTTTAGATAGCTTATTT
TGCTAACTATACTTATATAAAGTAAGAGTATACTTTTAAATAGTAATAGCTATGCCTAATAATAAGGTAGAAATTTAAAA
ATTGTCTAAAATTATTAGTATAGAATAGTACTTATAAAATAAAAAAATAACAAACCTAATAGTAAGCAGTATTACTAGTA
ACGTAAGTAGTATACTACTAACCTTAAGTTATAAGTATAGCTATATAGTTAAAAACCTTAATATTAAGGTAAAGTTATAC
TATATATATAGCGTATAGTAAAAAGCTATTATAAGTATAAAAGACTATAGCTACTAAAAGGAACTTTCTTTTTAATACTT
ACAAATAACGTAAAAAGACGTTGCTAGCAACATTTAAAGCACTAGTAGTAGGTAATAAAGTACTAAATACTTTAATAGTA
GTCTTATCAGCCTTAAAGGCCTTAGTAGTAAGCGCTTTACGTTTTTAAAAAGGTGCTATAGTTTTTTTTATACAGCTATA
TATCTTAACTATTAATAATATAAAAAGAAATAAAAACGTAAATATATAAAAAAAAGTTATAAGTAAATAAAAACTACTAA
GAGTAACTATATTATTATATTATATAATTACCTTACTAATAGTTACTAAAGTAACTAGTATAAAAAAAGAACAAATAAGA
CTAAAATAGTATACGTATAAGTATGCACTAAGGTAAACTATAAAAAAGTTATTACTAAACACTAGCTATAAACGTTTACG
TTAAAATGTTATTATATATAATTAAAAAAAAGTAAAAGAGGTTAATAAAAAGGCATAGCCTTACTAATAAAGCGTTAGCT
ACTTTATACTTAATAGCTAAGCTAGCAAGTCTTATAAGACTACTAAGTAAAAGCTCTTCTTAAGTAAAAGTACTTAAAGT
ATATACTAAACTAAAAGCGCTTAAAATAAGCGCTTTAAAAGAAGGAATAGTTATAAAGAAATTAACTAAAGTATAAGATG
CTAGTATAAATTAGTAATAATTTAAGCAAGCTTATAAAATAAAGTATATACAAACTATATAAGGCTTAGCAAAGCTAAAG
TAAAGCGTTTAGTAAGTCTTACCTAGTAGTAAGAAAAAGTATTGCTAAGCCTTGCTAAGAGCGCTAAGCTAGAATTAGCA
ACTAACGGCAAATAAGTAAAATAACGCTTAGCAAGCTTTGCTAAGTGCCTTTAGCGTTTTGCTATACTAGACTGCTATTA
TAGTATATATATAGTTTGTAAACGCTTGCTAGTAATAAATTTAAAAAAGAGTAAGATAAAGTTTTACTTTTACTCCTCTT
ATACTTTTTATCTTATATCTTATCTTGCTATAAATTGTATGCCTTAGGCAATACTTATTATATCTAGCTACTTAACTTTA
GCAACCTTTATTACTAAACTTTATATTTACTAGCTAGATATTTTACTTATATAGCATCTTAATACTTATTAACTTTGCTT
CTTAAACAACTTAAAAATTTAAACTAGATTAACTACCTACCTTATATATATTTGTTTTACTACCCCTCTTATTCTTTTAG
ATAAAAATAAACTCTAGCATTACTATGTCTTTCTACTCTTTAGCCTAAAGACTAGCCTATAAATATAAATGTTAAAAACT
AGTCCTTTAAACGCTATACACTTTCAACTTAGTTTCTTACGCTATAGTATACTAACTTCTTAATTGCTTAACGCTTAGCT
TAATTTAAGATATTAAAGTAGTAGCCTAAAGACCTTACCTAGGTTAACTATCTTTTTACCAAACTTTTTAACTACCGCTT
TTACTAAACTAGCCTTTTTAGTATAAGAAAAGCTAACTACCTTTATATACTATATAACCTTAAAGAGTACTTATTATAAA
AATAATAAATAATAAACAACTACCTTTAAGTAAAAATAATTATAATACTATAAGACTTAATAGAAATTGTTATAATTGCC
TTTATTATTTAAAAGCCTAAAGATATTATTTATTAAAGCTTTAATAATAAGCATAATAAGCAGTTTTATATCTTTTTAAT
TATTAAAAACAACTACTTTTACATTGCTATTATTAACTAGCTAGCTAGTTTTGTCTACTAGTATAATAGTATAAATAAAC
ACGTTTATAAAAAAAACAAGCTAGCTAGCTACTTTATTTAGTAGTATAAAGCTAATAGTATTATAGAATATAACTAGTAA
ATAGTATAAGCGTATTATAAATAAACTTTTAGTAATATTATAAGGGTATTCTATACACACGTCCTTACGCACTAAATTAG
CAACTAGTTGCATACTAAGCGACAGACTTGACAAACTATCTTAACACGTTACACAAGACTAGCATAGCTACTTAGCTATG
CTACGCCTTACTAGGGTTACACTACACTACATCTTCTAGCTACGTATATATTAGCTAGCAGGCCTTTGCCTACTAGTCTT
CTATAGTTTGTTAAGTTAAAGTCTTAATACAATAGTATAAACTAGTTAAGCCTTTATAACTACGCATTATACACTACTCC
TTATATTCTTTAACTTTTATTTTACAAGAAGCAATGTCCGATTATAGGGCGGCTACTCCGCGATTAGCACGCGAACCATT
AGAAGCTAAGGACGTGCTAATGCTACCCCTTACGCTAATGCACGGCAGCCACACCTTGCGCGCAGCATTTGCAGGCACCC
TAACCCTATCCGTCGAGTCGGAAACAAGACCGGTATACGTGCTGCTTAACGACACCTTGCCGGCTAAAAAGCAGCTGTAA
AGCAATAAATATACTTGCATTATATAGACGCTAGAGGCATTAACTAATATTATAGCTGTAAAGGTTATAGGGCTACTGCC
TAGCAGTTGCTACCGTAATAATAAGCTACTATAATATAGCATTAAAAGGCTAGAAATTAGTGCTTTTGCTATAGAGATAG
AAGAGTGGTTAGCGACAATAAAGGACGCTTATAATACTAATATACGTAGCAACGTGTTAAAAAATATAAAGATTATTTAG
GTAGGTAGTTAACTAACTACTATACTAGCGGCTAATTAGTAAAAGCACTACGACTAACTTTGCGCTAGTAAACCCTTAGT
TACACGACTTATATAGACGCACTTTGTTACGTTTATTCGTTAAGAATACTTAAACCTTAAATTTTAGATGCACTATATTT
ATAAGGAAAGCTAGACGCTTTAGCAAGGCGGCGAGTTGCTAATAGCGTACTAGTAGAAATAAAACTACTTATAATAAAAG
ATTAGCAACACCTTTAACTAGGTAAGCCAGATTGCTTAAAGGTATTAGTAAGGGTTTAACAACTACTTAGCAAAGTAGTA
TTAGAATAAGACTATTAGCAAGTTTTTTAGTTAAGCAATAAAGATTGCTAATACTTATAAGGAGTATTAGTCTTAGGGCT
AAGAATAAAAGAAGAGATAGGATAACTAGAAGTAAGCGGTTATAGTTAACAGCGTGCTAGCTAGTAGGCTAATAAAGAAA
TAGCGCTGCAATAATAATAAGATAAGGAACTATAGTTTTATAAAAAGCAACCTAAGCCTATAACCGGTTGCTAGCTAAGG
CTAGTTTACTTTTTAACCTGCTAACCTTAGTAGTTTAAATAACATTAACGTTGCGTTAAAGTGCTAGAATTATAGTAAGA
GTAGGCATACCTTTTAAGAGTGCTTTAAGCCTAAAACTTATGTATAGGTTAAAGAGCTTTAAGCAGAACTAGAAGATAGT
CTTTAAGAGCTTAATAACTAAAACGCGACCTACTTTAACTAGGAAAACTAGTAGGGTTAATAAAGAAGCCTTATTCTATA
TTAACCTTACTAGTATAGTTAACTAAGGATATAATTCATTGCTACTATACCTTAGCTAAGGTACGAATGCTTAGTAATAG
CTAGGTTTCTATTATTATAAACCTAAATTTTTATGCTAACTTAAACGTAGTTAACCTAAAGGTTAATTAATAGCTTAGTT
TAAAGCCGCTTTAGTAGCACTTAAACCTAAACCTAGTCTTTATTAATAGGAAAGTACTATAGGCCTATAGCCTATATAAG
CTAACTATTATACTAATAAAAAATAAGGTCTTTCGCGCGTTAATATAGGTCTTTATAGCTGTTTGCTAAGTAAGCGCTAA
CTATAAAGATATTATCTTAAGTTATAAGGGACTAAGGTTTCTAGGCGTTATTATTAACACTATCTAATAGGCTTAGTTAT
TTGCTATTATAGTTTTTAAGACCTTTAAGTAAATAAGCTAACGCTTATATAATAGTAAGGAGTTGTTTACTATTTACTTA
ACGTAGTTAAATTTAAGTTCTTATAAACTAGACATTCTTATTATAGACAATAATTTAGCTTTACTAAACCCTAGCTAGCA
ACTGCTATTTTGCATATAATTATTTACTAAAGTGTTTAACTAAGGCGAAGGAACTGCCCTTATTAGCAAACGTAGAGCAC
TTAATTAAGCTAGAAGACGGCGTAAAGGTGCTATATAGCCCTTTATACTTGCTATCTTCTGCCTAGTAAGAGGAGCTTTG
CTACTTTATTAATAAGTTGTTAGCAAATAGGCGGATTGTCTATAGCAATAGTCTAGCTAGAGCCTTAGTAATTTTTGTTT
TAAAGAAAGATAGTACTTTGTGCATATACATTAACTACTAGGGTTTAAATTAAGTAACTAAGAAGGACTGCTACTCTCTC
TTGTTAATTAGTAAGCTATTAGATTGCTTAGACGGTGTAAAGGTATTCTTTAAGGTAAATATAAAGGAAGCGTACTATAG
GATTTAGGTTAAAGCCTTTAATTAGTAGAAGACTGCTTTTTAAACAAAATATAAGCTTTTTAAGTTTTATGTTATACCCT
TTAGACTAACTAACGCGCCGGCTATATTTTAAGCATATATCTACCGCGCACTAGCAGGGCTAGTAGGTATAGTCTGCAAG
GTGTACTTAGATAACATCTTAATCTACTATTAAACTAAGAAGGAGTATAAGAAGCACCTTTAATTAGTTTTCAAGCGGCT
AAAGGCTACGCAGCTGTATACAAATCCTAAGAAGTGCAAATTCTTTAAAGAGGAAATTAATTTCTTAAGGTTTATTATTA
CTATAAAAGGGCTGGCTATAGACCTTAAGTAAGTTAAAGCTATTGCTAAATAAAAGGCCCTTAAGTGCGTATAAGACGTA
TAATCCTTCTTAAGGTTTACAAACTTTTATAAACGCTTTATTTCCTACTACTCTTATATTATATAGGCCTTAATAGAATT
AATAAAGATAGGCCTTAGCTTGCTACGCAAGCGCAAAGCCGTTGCTACGCAACTATTTATATTAACTAAAGAGGTAAAGG
TTGTTTTTAAATTGCTAAAGATAGCATTTATAATAGTAATAATTCTTTGTTACTATAATAACACAAAGCTTAAGCAGGTA
GAAACAAATGCGTTAGGCTACGCTATCTTTAGCATTATCTCTTAGCTTATAGACAGCAAGTAGCAACTAGTCGCTTACTA
CTTGCGTAAGCTAATAGCCTGTAAGATGTAGTAAGGAGTAGGATAGTAGGAGCTTCTAGCTATTATTAAGAGCTTAAAGC
ACTAGCGTTACTATTTAAAAGGTTTAAAGGATTTATTTATAGTCTTAACTAACTACTAGGCGCTAAAAAATGTTGTTAAG
GCATTAGCAAAGAATCTTTAAAACTAAATTGCCTAATAGGTATTCTGCTTCTTAGCGTTTAACTTTAAGATTAAGCATTG
CCTAAAGTCTATTAACCTAGCAGATAGTCTATCCTGCTAACTAAACTATATAAAAGGTAACATTATATATAATAACGTGC
TCCCCTTGCTTCTTAGCAAGCTATAGATTGCAAACTAGTCGTTAAGGCTTCTTATGCTAAGAGCTTTATTATTATTAGTA
TAAAAGGCATATATTACTATTAGCTAAGAACAACCGTTGCAACCCTAGTACTCCCTTAAACTATATAATACTATTTGCAA
CGCTTAAGGCTAAGACTAATTACTAGATAACTTGTTTATAAAGGCTAGATTAAGCTAGGGGAACAACACCTATTATTTAT
AAGAAGGGAATACCTTATTCTATAAGGATTGCATTGTTGTCTTATTAATAAACAAGCTATAGGTAAGGCTAATTAGTCTA
TACTATAACTCTTTTATAGTAGGCTATATAAAAGTTTATAAGACTATAAAACTCTTTACTAGGAAGTACTACTAGCTAAA
TATAGCTATTAACGCTTACACGTTTATTACTAACTATTTGTTATATATAAGCAATAAGGTCTTATAGTATAAGCTATACA
AATACCTCTAGTCTTTACCTATGCCTACTTAGCTATTCTAGCACATTAGTATAGATTTTATAACTAGTCTTAACTTAAGC
CTAGGCTTAGATAGCTGTCTATATAACGCTATCTTAGTAGTAGTTAATTGCTATATAAAGCATAGTATGTTTATCCTTAC
TTAAAAGATAGTTATAGCTACTAAGGTTGCCTAACTTATTTACAACTATATAAAGACTAAGTTTAGTATCTAAGAAGTAA
TTGTTAGTAATAGGGATAGCTTATTTACTAGCTAATTTTAGTAGGAACTAATGCAACTTTAAGGGGTTTAGCTAATAATA
TTAACAGCGTACTACCTATAGATAGATAGTAGCACTAAGATCTTAAACTAGACTTTAGAGCGCTTTCTATAAACGTTTTA
TAGTTGTTTGTAACACTAGTAGACGCAAGTATTAAGTATAGTAGAGTTCGCGTATAACAACGCTTGCTATACTATAATAA
AGACCTTTTTATTCTATACGTTGTATATATACTACCCTTGTTTTATAGACGACTTCCTCTTTACTAAGGCTATAGTAAAA
AGCGTACAAGAGCGTATTAGTCGGCTATAGGCTGTTTAGCAAAAGCTAGAAGTGTTATAGGAAAAAGCGATTTGCTAATA
AAAGAAGAGCTATAATAAGCAACGCTTATATAAGGACTTTATTAAAGGCGAATTTATAGGTTTATTAATAAAGCACCTAA
ACCTAGCTAGCTTAAAGAAGCTAAACTTAACCTTCTTACACGTTTATATTATAAAAAAGCTAGGCTTAGTTACGTATTAG
GTTGCCTTACTATTATAGTATACACGCTAACACAATATATTTTACGTCTTTTGCCTTAAGCTATCGACTACTATAGTAAA
AGATAGGAAAGAGCTTTTATTTTTAAAAATAGTAAAAGAATAAAAAAAGTATAAGGTTAAAGATATTATTACTTACCTTA
GCAAAGGTTTATAGACCTAGTTCCTAGTAAAATAAAAAGGCTAGCCGGCTAAGTATAATACCTAAGAACTAGAAAAGTAC
TTAGCATATACTAGCTATAAGTTATAGTCTTACTAAAAGACTATAAAACACACTTATAAGAAATAAGAAAACTATAAAGT
AATAGCTAGCTATATATAAGCTAATTGTTAGTTAACTACTCTTACTATTTTTGCATAATTGCGTACTATAAACTACTTAT
TCTAGCTTTAAAGGCGCCCCTTCAAGCTATAAACCTAAAACATACTATTAGCGGGCTATTGCTTAGCTATTAGCTACTTA
TTACTATCCTTCTTTATAAACGTCCTCTCTACTCTTTTATTTTTCTCTTTAATACTATTCTTTTTATCTCTCTCTTTATT
ATTAAGCAAGCCTTTACTAGCTAGTATATAGCTATTACTAGCTACTAACTAGCTGCCTACTAGCGCACTCTTACTAGATG
CTACTATACTACTACTCCTAGCTACTATAACCGCTTTACTACTACTAGCTATAGTACTAAGAATAGTCTTAGCGCTACGC
TAGCGCTTAGCTAAAGTTAGTAACTTAGCATAAGACTATTACTTGCTAGGCGCCGCTAAAGGTAGCAGCTAAGGAAAAAC
TACTACCTAGTTAATTTAAGCTAGCTTAACTAAGGCTACTATAGTTTATAAGATCTACTTAGGCAGCCTTTTTACTCTTA
TAGTATAGTAAAGCATGCTGCTATAGCTAGCTTAGATAGCTATAGCGCGCTAAGCTAGGCTAAGTATAATAAAATAAAGA
TTAGCCTAAGTAATAAGTTAGCAATAACTTAATAATAAGAATTAAAGAACTTGCTATTACTTTAAGAGTAGTAGTAACTT
AGGTTTACGCTTATAATAGTATGCTTATATCTAGGAACGTTAGCGGTAAGAGCTAGGCTACCTTTACTAACTACTACGCA
AGCGTTAAGGTAAGCTTTAGCTTTTACTAGTACTAGTAAAGAATACTAAGGCGTAATATAGCCTATTATGCTATCTTAAA
ACGTTCGCGCTAAGAGCGCTAGTTGGTAGCTAAAGGCTTTAACTTATCTTCTTATAAAGCGTGGCTAAGTTCTTTAGTTA
CTACTATTAAGGCTATTAACCTTTAAGCAATTGCCGCGTAATTGCTTAGCACTATAATAATATTATTAACCGTTATCTAC
TAAAGTAGCAACTTATTTATGCTAGCTAGAAATTCTTAAATATATTAGGCTAAGCCTTTAATCTCTTTAAGAAGCTATTA
GTTAGTAATTAACTACTAGCGTATATAAGTTAACGTACTTACTAGGAAGTATAATGTATTATTAGCTATATAACTAACGT
AGCGCGCTAGGTTCTTTAGCATAGCTATATATAAGAATTTATAGTAAACGTTTAGATAAGCCTTAAAGATATAGTTTAAA
TATAAAGCTTACTATAAGGTTAGCTATTACTTAGTAGACGCTATACTAGCAAAGACCTATACTCTTAAAAGATAGTGCGT
ATGCCTAGAAAAAGCGTTTTATAAGGTTTATATTTATAAAAAAAGTCTATTAAGACTTAAAAGCAGCTTTAGTTAAATAT
TATCTATAAGCGGTTATTATCTAGCTACTATATAAAGTTGTAAACTATTATATTAACTTACTATATAAGTAATATTAAAG
AAAAAAGGGCTAAAGAGGTAAGAGTAGTCTTATAAGTATAGACAAATTTGTTTTAAATTATAGAATATACCTGCTTTTTT
ATACTTTAAGGTAATAAAGAAGCTACGTTATTAAACATTTAAATACATCTTAAGAACTTACTTAACCTTACTTTAATAGC
AAAGTAAGAAACGTTTAAAATTAAATAAAGAAACGTCTTAGTAGTAAACCGCCTTTACTATTTAGTAAGCAATAGTTTTA
TAATTAACAGGCAATAAACAGCCGCTATTACCTTTATCCTACCCTACTAGTAGTCGAAAGTCGCAAGTCTTACGCCGCCG
TTTTTAGTTAGCGTACACTACACCCCTATACACTTAGTGTCTAAGGCTAGCCCCTTTGCAACACTTATCGGCGGCAACCT
AAGCGTTCTCCAACTAGGATCCAAGCTACACGTCTCCTAGAAAGCTCTAACAAACAAGACAACCTATGCATTAGGCAGAA
TCTAGCGATTACTACCGCTATAGACTAAGCAGTACGTATGCGCTTCTACGTTACCTAAATATAGTCGCATAAGCAAGCAG
TCTGCGACCGCTCGGCGACAGCCAATAACCTAGAGCGCTTAACTCTTTTTCCTAACTCTATAAAGGAAGGTTTTTTAACA
AGCAAGTAGCTGCCGCGTGTGCACCTTTAGGCTAACAGGGGCGTTACCTAGGGAGGGGGGGGATAGTGTAAGGGTATTCT
ATACACGCGTCCCTACGCACCGGCTCGGCAACTAGTCGCTTACTAAGCGACAGACTTAACGAACTATCTTAATACGTTGC
ACGAGACTAGCATAGCTACTTAGCTATGCTATGCCCTACTAGGGTTGCGCTATACCGCATTTTCTAGCTACGTATATATT
AGCAAGCAGGCCTTTGCCTACTAGTCTCTTATAGTTTATTAAGTTGAAGTCTTAATATAATAGTACAAACTAGTTAAGCC
TTTGTAACTATGCATTATACACTACCCCTTATAAATATAGTCTTTACTATCTAGAATTTACGGGCGTCTTCTTTTAAAAG
CTAGAATGCAATGCTAAAGGAAACTTAAAGCTTAAGCCTGAAGAAAACTTATAAGATTATAAACACTCGTTCTTAATTAT
AAAGCTTTTAAAGTTTAATAAAGATAAAAGAAAGGCTATAATCTCTTTATAAATTACTAGCCTTTATTTAAACTAAGATA
CTTTAACGTAAAGCTTTTTTATATCTTAGAATACCTACTAATTAACTATTACCTTAAAGAATTAAAGAAACTCTTAACGC
CTAACTAGTTTTTAAATTAAGATTACTCTTAAGCTACTTTAAAAGATATTAAAGACGCTATAGCTAATATAGACTTAGCT
TATACTAGCTAGTAAAACGCTTACTTAAATAATACTATATATATTAACTTATAAAAACTAAATACTTAAATTAATATATT
TATTAACTAGTACTTTTACTATACTCTATATATAAAACAGCTTATATATTAAGATCTAGTCTTATACTAAACCTTAAGTA
AAGATAAGGCTACGCTAGCTAAGCTAGCTATTACGCTAATAGCTAAGCTAGTAGCTTAAGTGCTAACTAAAACGCTAGTT
AAGTAAGCCTTTACTAAGCAGATACTAACTAAACAACTACTAGTTAAGCCTATACTTACTAAATTAGTGCTAATTAAGCT
ATTACTAGCTAAGTTTATACTAGCCTAACCTATAGCTAAGCTAGCTACTAAAACCTTAGTTAAGACTCTACTTATTAAGC
TACTAGTTAAGCTAACTATAGCGTAAAAAAGACTAGCTAAGCTTCTTACGCTAATTCCTTAATAAGTGCTTTAATTAGTA
ACTAAAGAAAAGCAAGCCTAGGCAGCAAAGACTACCTTAGCGCCTACCTTAAAAACAGTCCTTTTTACTAAGATTACTTT
TACTATAAAGCTACCCTTAATAGTACTAATTAATACTATAAGTATAAACATTATTAAAACTACCTTTTATAACTAGTAAA
TAAAATATAGCTATATGTTAAACGTAAGAATAGTTAGTAATAAGGATTAAAATAATTACTATAGGTAAAAGATAGCCTAT
AAAAGTTAGAATATAAGGATAGCTATAGACTAAGCTTAGATAATACTACTACTACTACTATACTAAATAACTTATATAGT
AAAGCTAAGAAAACTATAATAAAGTAAGTTAAGAATATTATAGTTAAGATAAATTAAATAGAATAGCCTTTTCCTTTTTT
TTTTAAGCATAAGAATAATAATAGTAGTTACGCTAGTAGCGCTAGAAGAATAAACTAGCTAAATAATATTTACTAAACAT
TACTATGCTAAGGCTAATAAGTATCTAGCTAAATATAATATAAAAAAAGTTAAAAAGGATACTAAGATAGCTAATAATTA
AACTATATTTAAAATATATTTAAAAAGTATATTACAAATTTATTTTTAGATATACACTTATTAAGTATAATTTATTTCCT
TTTTTTAAATTAGTTAATTTCTTATCTCTCCTTACCTACTCTTTTTTTTATTAAAAGGTGTAAATTATTTTAAAAAAGAA
GTAAGTAATAAAAGCAAAGGTAGAGTAAGGCCTTAGCTTAAACTAATAATAATACATATACCTACTAATGTATAGATGTA
ATTATATATAAAGAGAGGTGCTATAAAGTACCTTTCTTTGTTAAAAGGTAGAGGCAATATATAGCTAGTCTAAAAGGAAA
GAAGGAAGAAAGCTATGCAAGCTTACTTTATAATTTTTAAAAAGATAATAAGATAAGCTTGCCTAGTAAAGTCTTAGGCG
TAGTCTATGCTTTATAAGTATAATATACATCTTTACAACTAATTATATATATATATATCTTTACTTATCCCTCTTTCTTT
AAGAAGAGGGAAGAAGAGAGGGTTTTTATACATATAGTGTATAAGTAGTAATAAAAGGAATAAATTATTCTATATCTAAT
TAGTTAAAAAAAGTAGGGTAAGTTATATAACAATATAGCATCTTATAAGGGTCTAGATTTATTATTCTATATAGCTAGAA
TAAGTATTCCTAAAGGTATACTTTTCCTTATTACTTACTTCATCCTTAAAATAATTTATACCTTTTATTATAAAGAAGAG
TAAGTAAAAAGGGATAAAAAGTAAACTAATTTAAAAAAAAAAATTGTACTTAATAAGTGTATATTTAAAAACAAATAGCA
AATGCACTTCTTAAATGCGTCTTAAATTTAGTCTAATTGTTAGCTATCTTAGTGTCAGCTGTATTTTGTTTGCTAGTTAT
AGAAAGTAGTTCTTACAATGTTTATGCCTATAGTATTAATCGGCGCTACTAAGAGTAGCTTTATAGCAGGAGTAATCTTA
GTAAAGAGGACTGTTTTTAGGGCAAGCGCTAGGGTAGTCTTAGCTACTTAGGCTTGCTTTTCTTTAGTTATCGATTAAAG
CACTTATTAAGGGATTAGCGTAGGAAGCTTAGCCGGTCCTTTTTGTGCTATAGTTAGCTTAACTAGCGGCTTAATAAGTG
TAGTCTTAACTAAGGTTTTAGTAGCTAGCTTAGCTATAGATTAGGCTAATATAAACTTAGCTAGTAACGGCTTAATTAGC
GCTAATTTAGTAGGCGTAAGCTTAACTAGTAGTTGTCTAGTTAGCGTCTACTTAGTAAGGGCTTGCTTAATTAGCGTTTT
AACTAGCACTTAGGCTGCTAGCTTAGCTATTAGCGTAACGGCTAGCTTAGTTAGTATAGTAGCTAGCTTAGCTAGCGTAG
CCTTGTCTTTGCCTAAGCTTTAGTATAAGACTAGATTTTAATATATAAGCTATCTTATGTATAAAGTATAGCAGAAGTAT
TAGTTAATAAATATATTAATTTAAGTATTTAGTTTTTGCAAGTTAATGTGTATAGTATTATTAAAGTAAGCGTTTTAAAA
AAAGACTATTAAAGGCGTTGTTTTGCTTTTACCTTTACCCTTCTAGTTGTTCTTTATAGCTAAATCTTCTTAAGTTTTGT
CTATGTTAATAAAGATAGTATCTTTTATATCTTTATCTTTATTAACAACTTTTCTAGTATTGTCTTTTTGTCTTTTACGT
CTAAGAAGGAATATAGCAAATTCTTTTATAACTCTCTTAGCTATTATATTAATCTTCTAGTTACATAATAATATAGTATC
TTATAAAGGTCTTGCGTATACGCCTTAATCTTATCTTAGTTCTTCTATCTTACTAGTAAAGACGTCTTAAAACCTACCTT
AGAGGTCTTTGCTATCTTTTTTAAGTTAGACTATATTAACTATAATTTATTCTATAAGTACAAACTTATTAGTAATCATA
AGTTTAGTAGTTTTAGTAACTAAAAGATACTTTATTTTTACTTTTATAGTAACCCTTATTTCTTAAAGCTTTCTTATAAT
AGTAGCGCTATTAATTTTAGTATACTAAGATAGGTAGGACTAAATAACATTCTTAATCCTCTCATATCTTCTATAGTAGA
TAACTAGGGTTTTTAGAATAGTAAACTTCTTACTTAATTTTCTTATATAAAAGCGCCTACTAGCTAGGTTAAAATGTATA
ATTCTTATAGTAGTATTAACTTGCATTCAAGAGTAGTCCTTAATTTAATGCTTTAAGTAGTTATAGTAAAAGTAGCAGTA
AACCTTTAGTAGTCCTTATAAACGCTATTTTATATACTATACTAAGGTCTTAAGCTAGTCTTCTTAAGGCTGCTTAAGTT
AACTAATATAGGTTGTATATATTTAGATTAGCTAGGTAAAGGCTTAGATTAGTAAAGGTAGTGCATTATTCTGCATAGTA
TATAGGTTATATATTAAAGAAGCTTAAGGCGTAACTTCTTTTATAACTAAGTAGGCGTTGATAAGTTATTACTAGTAAAT
GCTAAGGTTCTTTATCTTTTTAGTTAGTAGTGTAATAAGGTTTAAAGAGTTTAAACTTAGTAAAATAAGATTTATAATAA
GAGCCTATATAGGCTAAAAATTAAGACCCTAATAGCTATAAAAGGCTAGTGCTTAAGTATTGTTATAGATCTCTAAGGTT
TAGCTAATAGGGTTCTTTATTTAAAATTGCTTAGCATGTTCTACATCTTTAAGGATAGTTATAATGTAATTATAAAAGTC
TTTAAAAGATAGCTTCTATAGTGTATTATAGCTAAAATTAATATATGTCTAAACTATTTTAAAAACGCTTTTTAAAAGGG
CTTTATATAAGGATTTAAAGTATTTAAAGCTAGCTAATAATTCTTCTCTAGCTTAGACTATATAAGAGTAAAGCAGCATT
ATCTTCTTAATAAAGGTCTTAAGGTTTATTAAGTAAGTTAAATAGAACTAGGCTTAAGCTTATATAAGTAGTACTATAAC
GTAATCTTTATCCTTTCTTATAAAGGCTAGCATTATCTATTCCTTTAAGTGTTTAAATCTTTCCCTAGTAGGCTTTAACA
TAGCCTAGGTAACTAAGCCTTTTACGTAAAGGGCATTATTACTACTATAGTATATAAGAAGTTTATTAACTTTATTGCTT
TTCTTAAGCTTAGCAAAGCTAGTAAAGACCTTATAGTATCTTAAGAATCTAGTAACATTATTATTAGTAAAGAGCAAGCT
TAGAAGTATACTAAGTAGTAGGAAATTAAAAGCCTTACTATTACTAAAGTTATAAGAAGAGAGGGTATAAAGGTTAGATA
CTAGTATAGTTAATATTTGTTGTATTTTATAAAATTAACGCAATTTTTACTTATTTTTATATGACTTTTTATAATTTTTT
ATAAAAAGAAATAAGTAAAGAGAAAACTTAATGCTAATAGTATATTTGTAATAAAAAACAGTAAAGGTTTATTGCTTCTT
ATATATATTTCTTTCTAGTTTAACTAGAATTGTCTAGATAAGGCTTATAATAATAATGTTATTATCCTTCTTTATAGTAT
TCTATTATTATTTCCTTTTAGCCTTTTACTTTTATAGACCTTTTAATGTTAAACTCTTCTTTTCCTTTTAAATTAAAGGG
TTTTAGCTTTATTTTAACTTATAAGGTATATTATAAGATAATAGTTTTTAATACTTAGTCTTTATTAGCATTATAGCCTT
ATATAATAAAAACCCTTTTTAGATCTTAAACATACTATCTTAGTTATATAAACTCCTTTATAAAGTATAAAAAGGTAATA
ATTTTAACTATTACGCTCTTTATAATATTAAGATCTTACTTTCTACTTATTATATTCCTTATAATTTTATTATTTATAAT
AAGGTATAATAATTATAAAGTTGGCTTTATATAGCTTTAGTTTTTAAATACTTTATTTTTAGTAAAAGCAATCTTTATAT
TTAAGTCCTACTTACTTTTTCTTTATATAAGAACGTAAATAACTATTTTAATAATAGTCTTCTATTAAACACTTTTCTTA
GGCGCTTATTCTATTCTATATAATTATCTATATTATTATAGATCTTCTATAGGCTTTATTTTTATATAAGAAGTAGACAT
TTATATCTTTAAAGTTCTTTTAAAATCCTAAAAAGAAAGTTTCTTACTATAAAAGTACTACTTCTTTAGTTTATTATAGA
TTTATTTTATATAGGCTACTCTTAAGTCCTTTCCTTTATCTTCTTACTCATAATTAAGGTACGTAGTTAAAGACTACTAA
AATGCGCCTTTTGCTTAATTACTAAATAGAGTTATTTTTGTATACGTTTATACATAGCATTAAAGAGTTTAAGACTATTT
ACTTTAATAGCTTTTAGTTAGCTTTTGTTTATAGTTATAATATTATATTGTTATAATAAAGTAATAGAAGTATATATAGT
ATAGTAAAGAGATTTTAACGTAGCTAACGTTTTATATTTAAGAAAATGTATTGCTTACCTTTATATTATTATTTTAAACT
TAGTATTATCTTTGTTTATATTACTAAATTTAATAAATAAAAGCATATTATTATACTTACTACTTATTATTAAATCTAAA
TAAATCTACTAGTAAAAGCAAAGGTAGGGTAAGGCCTTAGCTTAAACTAATAACAACATATACACCTACTAACGTATAAA
TGTAATTATGCATAAAGAGAGGTACTATGAAGCACCTTTCTTTATTAAAAGGTAAGGGCAGTATATAGCTAGTCTAAAAG
GAAAGAAGGAAGAAAGCTATGCAGGCTTACCTTATAATCTTAAAAGAGATAACAAAATAAGCCTACCTAGCAAAGTCTTA
GGCGTAGTCTATACTTTACAAGTATACTATATGTCTTTATAACTAATTAATTCTATATATATATCTTTGCTTATCCTTCT
TTCTTTAAGAAGAGGGAAGAAGAGAGGGTTTTTATATATATAAAGTGTGTAAGTAGTAATAGAAGGCATAAATTGTTCTA
CATCTAACTGGTTAGGAAAAGTAGGGTAAGTTATATAATAATATAGTATCTTGCAAGGGTCCAGATTTGTTATTCTGTGC
GGCCGGAATAAGTGTTCCTAGGGGTGCACTTTTCTTTATTACTTAGTAATAAGGAAAAGTATACTCTTAAGAACACCTAT
TCTAGCTATATAAAATAACAAATCTAAACTCTTATAAGATACTATATTATTATATAACCTACCCTACTTTTCCTAACTAA
TTAAATATAAAAAATTTATACCTTCTATTACTACTTATATACTTTAAATATATAAAAACCCTCTTTTCTTCCTTCATCTT
AAAAGAAAGAGATAAGCAAACATATATATAAAGAATTAATTAGTTATAAATATATATAGTATACTTATAAAGTATAGACT
ACGCCTAAGACTTTGCTAGGTAGTCTTATTTTGTTATCTCTTTTAAGATTATAAGGTAAGCTTATATAGCTTTCCTCCTT
CTTCCCTTTTAGACTAGCTATATGCTGCCCCTACCTTCTAACGAAGGAAGGTACTTTATAGTACCTCTCTTTATGCATAA
TTACATTTATACGTTAGTAGGTATGTGTGTTGTTGTTAGTTTAAGCTAAGGCCTTACTCTACCTTTGCTTTTAGTAGCGG
TGCTAATCTTATATAATGTATTAAGATAGTTTGTTAAGTTTAACGCTTAGTAAGCAACTAGTTGCTAAACTAGTGCATAA
GGACGCGTGTATAAAATACCCTTATAGCCAAGCAATCGCTTTACTACTTATAAGGTAAAAAAGATTATATAATAGTTTAC
TACTATTAAAAGCCTTCTTTAAAAAGGCATATTTACGTTAAAAAATAAGTTAATATATCTTAAGCTAATAATCTAGTTAA
GTATTACTTTATATATAGCTTTATCTTTAAGATTTTAGAAAAGCTAGTCTTTTAGAAATCTTAAAAGCTTTTAACTATTA
GTACCTTTACTTATAAAGCTAGATATAGCGCCGCTTACTACGTAATAATATAAGCTTGCTAAATTAAGTAACATATACTT
AAAATAAGCCTTTAAGCTAACATTTAAATGTTTATAAAGAATACCTTTATAATTAGTATTATAAAAAATCTTAAATTTAA
AAAGTAGTTAAAGTACTTTAATATTAAGTAGTACTACTTTTATAAAAGCGTGCTAAGCAGCTTATTAATAGTATAGTATA
TAAAGTTTAAAGATTAAATTACTAATATTATAATAAAGGCGCTGCTTAAGGTAGTGTTTAAAAGGCTATTACCTTACTTA
ATAGGCTAGCAACTATAAAAGGGCTACTAAGAATAATTTTAATGCATTATAGTATACTTATATAGCGTATTTAAAAGAAG
TGTTAAGCATTAAAATCCGCTGCACTATAGCCCTTCTGCCCTACTTAGCTATATAGGCCTATAATTAGTTAGAAGGAACA
AAAGCGAGGCCTAGCACTAGTATTAATACGGATCCCTAGAAGGGTCGCGATGTATTTATTTCTTTCTTAGTATACAACAC
TTTTTGCCTACACTAGACCCTATTTAGCCCCTTGCTTCTTATAGTGTATTACGTTATATAACTGCTATGTATAACCTTCT
TTAACCTTTATATAAGCAGACTACGCTATAGGGCAGAATAATATGCTTTTGCGCTATATAATGTAAAGGTTAAAAACCTA
AAAATAAAAGCGGAGTGCGTAGATACAATAATGCTGTGTTAATAGTAGCTACGTTATAGATAAATTTATACTTTTATATA
TAAATAATAAAGTTTAGCTTTTAGTCTTTTCTTTATACTTCTTTTACATTACTTAACTACTTAGCGTATTATACTTTTTA
CTATAAAACGTATAATATTACTACTACATTTTAAATCTACCTACCTTTTTGAAGTAATATAAGCTATAAAAGGAAGTAAG
ACTTTCTTTTTTATTACTTTTAAAGTATAAAAAGACACTTTTAAGCTGGAAAATATTGAAAGTAGATAGAAAGTAACTAG
TCTTTAGCCTATATCTTTACGCTATGTGTTTTTAAATTAACTTATACTTTCTTTTAACTAAAAACACCTAAAACAATCTA
AAATATATATAAAAACGCTACTCAGAAAGATATCATTAAAAAAGCTATGTTTTCAACTTTATTATTAAGCAAAGATATAC
ACTAACACCCTATCTTAGCAAGCTAAACAATATAGCTAAATAATATAATTCGTTGCTTATTTATAAAGGCTAGTAATGCA
ATAAACAGCAAAAACAGTGCTTTAGCACTTCAGGGGCTTTAAATTAATAGCCTAAAGGCTAAACTAGCAGCAAATAAGCA
GAAAAAGCAAAAGAAAGTGCCGCTAGATGCTAATAACAATTTTATACATATTAAAGACGTTATACAGGTGCGCTAATAAC
TAGAAAGGCAGCTACAGCCTTAAAGAACATCTACTAAGGTAGCAGAAGTGCGCATGGATGATTTTTTATATGTGTATTTA
ACCTTATAACTGGCTAGGAAGCGCCGTCTTAGATTGAAAGTAATGGGAGTATATGAGTTTAAAGCCGAAAAAAATGCGCG
AAATGGGGCGGTGCGCAGAAAGGGGCTTAATCGACTTATTATAATAAGCGAATTGGATGTTTATTAATACGAATTATTTT
TTAGCAAAAGTTACTTAATTAAGCAAACACTTATATAATCCTTTAGCAACTAGTATTGCCTGCAAGATGTCTTATAGCGC
ATACAACATTTACCAATTTTTAGGACCAAATTTCTCGCCATCAGCCACGTTATTATACCAGGCTTCGTCGTTATAATCCA
TCGTGTTAAGGGCGCCAACGTTGCCCCACCACTTAGGTGCCGACGTGCTAGTCAAGCTAATAGTCAGCACAATAAGTATG
GTGCAAATAACAAGGCCTGTGTCGAGACCCGCAGACGTGATGTAGTTGAAACGCATCCACCAGCCGCGGAACTTGTTGCG
GATGCCGTAGTTGAAGAACAGTCCGATCGAGCCCCAGGCCAAATAGTTCAGCGGCGTCGCAGGAGGGATCTGGCCGTTGC
CGGAGAAGATGATAGGGGCGCTTAGATAGCGGACAAAGGATTTAGGGTAACGGCGCTGGAAAGCCCAGAAGATGATGGGC
AGCACAACACCGGCGATCCAGAAGTATTGCAGGTTTTTGTAGATGCCAGTGCCGCTGAAGATACGCTGTGGACCAATAAG
TCCCCAGATAACTGCGCAAAGTCCGTTAGCAAATGGAACTTCGGATAGTATTGTAATGAATATTAGCATAACCCGACTTA
CTAGAAGCTGTGAAGAAAACCTTGCCACCGGGGCAGGTAAAGCGGCTAACGGCTTCGCTGGTGCAGATGCCATCTAAGGC
TCCCATGGCCCCTGGGGCAAGTTAGCCGATGATACATATACCATTGACAGACAAAAATCCTTACAGTAAAAAACGGCGAT
CTGTACAAGGCAAGCCCAGACAGTGGCAATAAGCTGGCCAAAGAACATGGTGCGAGGCGGTAGCTTAAGGTAATGACCGA
GCTTCATGTCCTGCACGAACATAAGACCCTGAGTCATGGTAATGTAGCCGTAGGTCTTGAACATCATCATGGCATTAGGC
CTGCCGGGGAGCATGTAACCAACGATGAACTCGGTGAAGACGTTGAGGCCAATCTGGACGTTGGTAACGGCCTGGACCAT
GCCGACGGGAATCATCCACACAGATGATATGATAATGGCAATGATAATAGCCCACCAAGTTAGGCCGGTATCCCAGACGT
ACGCAGAGACAAAGCATAGCGCGAAGCACGGCAAAAAGATGCAAAGAAACCACCAGTCCGGCACAGGGTTATACTTGCGC
ATCATCTTAGCATGCACATCGTCAAGCGTGCCGCTGCGGTCGCGCCAACGCTGCCAGATTTCACGGGAGTGGAAGAGGGC
GGTGTGCACAACGACGGAAGCGATGCCAGCAAAGGACAGGCCGTAGCACAAGGCAAATGTGGTAGAGAGGAAAAGGGGCG
AGTATTCCTTGTAGGCTGTAAGGTCGAGGCGATGGTCCGCCGTTATGATACGGCTCACGTTGTATGAATGCTGTGTGTTG
TCCCAGCTGCCGGAGTCGCTGAATGGCAGCCAGTCGGCGTACCAGGTACCAGTCCAATGGATGCCGGCGGCGACGATCCA
GAAAAAGAAAACAACACCGATCAGCGTGTTCATAAGCGCGTGCCAGGGCGCAATCAGCGGCGAGAAGTTGTAGCCGCTAA
TTTGGGTCCAGTCAAACGTAATAGGCAGCAGGCCCATGCCCGTCCAACCGCCAAAGACCTGATTCACGGTCACGTTGTGG
GGCGCGATAAAGGTTGGGAAAACGAAGGCGCTGAGGGCTTGGAAGAGAAAGCCCGGGATCCAGTACCAGCAAAAGGAGCC
GAGGAAGACGTAAAAAAAGTAGTGGTAGCGGCTGATTTTCCAGCCGTTGGCCTTGGCCGGGTCCGTCTTGGAGTGGTCAT
GCAGCGTGTACATGAAGACGGTGTTGACCAGGTTGGCCGGCCAGATCATAGACGCCGGCTCGACGAGGAACTTGCGCGCG
ATGCCTGCAAGGCCGAAGCCGATGCACTGCGTCGACAGGGCCAAGCAGATAGCGTAGCCCCAGCCAAAGTCAAACTTGTA
GAAGCCTACTTGCGCCGTCAAGATGTCGGTAAAGTACCCGGCCCCGCCACCATAGGCTGCGTTGGACATAAGGACGATAA
GGCCGTGCTCTTTATAGTTGAATGGCCCCGGGCTCAAGTTGAACTCTACACGGCCTATCTTGAACACACGGTCTGGGAAG
ATGTATGTCCAGAACATGCCGATAGGGTAGGCGATCAACTGAGCCACAATGGACGTGATGGTTATAGAGGGCGACCGGAG
AGAGAAGAGACAGTTAAGACCTGAGAAAATGGTTGTCATAATCATGCCGATGGTCCAGGCACGGATCGTATTAGCCGGCA
GATCCTCGTCATAATTGTGCACCGCAGAACGCACTCTTGCCACCGTGTTAGCCAGACTGTTTTACTATGGACGGGGGAGG
AGGGGGAAGAAGGAAGGGCGCACTCAGGGTAGGGTGAGTCATCGACGACTTCCAGGACAAGGTCATTTTCCATCTTGACG
TCATGGCTGTCGACGGCTTGGTCGATGGCATCGATGTCTTCGAGCGGAATGTTCGGGTCGACCAAGGCCTGCTGGCGGAA
GAGCTTGAGCCGCCGAGCAGCCTCCGCGTCTGTCAACTCCTCTGCAGGTGGGGCCATGATGATCTTTTCATTCCCATTCC
CATTCCCATTGTCGGGGAGGATTTGGTTTCTGCCCGCATCCACGCCGATGCTTTCGCCGGGGTCGGCTGTTCTCTTAGAG
CGGAAAGTAAGCGGCATTGCAGGCAATACGGCACCAAGATCTTGGGTTAGATAGGAACTTCCAGCGTAGATTGATGGCGA
AGGAAGACTGGGGCTGCTCGCATAATTATACTCTAGGGGCGGTATCTTTTGTCCTTGCCGATGCTACTTGTATTACCCCC
CTTTGAAGGACTCAATACTCCAACCTTGTAACATACGACGCGAGTAGCGTATAGGGCCACGGCCTCTTATCTCGATTAGC
GGGCGGACTAGTGGCTACAATAAGAGTAGTGCGCCTAGAGACATCGCCTCCTTACCCTGCTGCCTCTTTGGTCCTACGAC
GTATTAAAAGATAGGCTTTATAATACGCAACACTAATTCCGCTATCTTGTCCTATTGGCTTACGATTTTAGCTTTCTTTT
GGCGGCCTTAAGCACAATATGTTGTGTACGGTGGATCAGACGATAGGTCGCTTGACAAGCTTTCGCTAAGATAGGTCTAT
TCCATGACGTAAAACGCTAAGCCGTTTTAAGCAGGTCGATAGACATTAATACGTATTTTCTTGGCTGTTTACTGTTTACG
GCAGCAGCTACCCAAATGCTACTTTGTTATCGACCTTCCTAATTTCTTAGTGCAGCGCTAATCACCTTCTCTTACAAGAA
TCTGTTGCGCGTAACCCTGTAGGTCTCGGTGCAGAGTTTTTACTGCCGCAGTGCTCGCGCTACTTTAGGCTGCCTCTACC
CCCTCACAGAATATATTATCACGTAAGGATAATGTGCCAATTAGGCGATATGCGCCACGGTCTAGGACCACGAGCTTCCT
CAGCGTGGTATCATTAGCGGCACGTCGCGCGTCGAAGTCACCCCCCAACGACGGCTGTATTAAGGCAGGTCAAATCATAC
ATAGGCCTAGCGTTCACTACGATAGAGGATAACAACACGGCCTGGAATTGGCGTAGCTGTCCGCTCTAGAACGGCAGTTA
GATTGGCCTTGTGCACCTTGGCAATGTCGCCTAAGCAAGGCGAGGATTAAGTAGTTATTTTATGCTCTTGTAAGCTTGCT
TCTTGGTATACCGTAAGAAGAAAACCTGTTGAATTATATGCGGCTAGTAAGCATGTATGCTGACGTGCATTTTAACCCTT
TCATGGGGTTACAGGTCGCAAGGGTGTTGAATAGGTTCACAGAGAGTCTAGCACAGCAGATCATGTAATAGCAACACACC
CGCGAAAATCATGGCAGCCACTAACTCGACGCCCAGATTGCTCGTTCAAAGTCTGCATGAACAACTGCGCTCGCAAGGCT
GACTGCGACCCTGGCGGTTATGGTGACTACTATCGCCCTCAAGACTACTTGCCCGCTTAATATTTGTGACCTAATCGATG
CTCCGTCTTTCGCGGCAGGGTTGCTGTCTTGTTTATGATAGAGGGGTTGACTCTGTTTCTCTCTCTCTGTTAGGTCTGCT
GCTCTAAGCATCTTAGGACTTTTGCGGCAGCGCCTACGTGTTCTGTGGCACAAACGGTGGATCGGCCCATCTGTGACGTC
GACCAGAGCAGCCATTTCAAGCTCGTTATGGACTACTATGAAGGCTGGGCACCTAGCCGGGTGTGCAACCGCTTCTACCC
CAGCAGATACCAGCCGGCGTCCACATGAACTTTGATTATGCCAGCATCGACCCCACGACTTTTAATATTGACCCGGCCGA
TCAGTCCGATGTTGGCCTGTGCGAGCGGATGGCGAACCTTAGGAAACTGGACGAAACCCTTAATATCCTTATTGCCGTGG
GCGGCTGATCGTTTGGCGATCCGGGCCCGACAACCACAACTTTGCAGTTCAATCACAGATGTCCCAGATACAGAAAGGTA
CGACTCATTTAAATCGCATGTCTCTTCAGCATTTATGTCGAGCACCATCACCGATAAATTAAGAGTTTCTTTTTTCTTCT
GTTCTTTCTGACGCGTAACGCAGTGTAACGCTTGTGTGCACGGGTAGGCCACAATCAAACTTTGTTTGTTTTAACCACAA
GAGGCGAATCCGTGCACGACTTTTTACAACATATCATAGACACAATCCTCCTTCAGCCACCCCTGGTCCGGCCGCAGTTT
CCACTGCCTTATCTCAGCCGTGGCCTGGGCAATTTCTCGCTGTTCTTCACTGGACAGGGGTACATCGTTCGCAAGGAACT
CCACGTAGTCTCCGTCGTAGCTATTGTCGATAAGATTATAACAAAGTACAGAAAACGCTTGTGTAAGAATTTGCTCCCGT
TTGTGTCCGCTGATTTCCTTACTAGAAGAAATGTGGGCCAGCGCGGCACAAGTAGCGGGAAGGGGGACCGTTAGAACATT
GCACGGGACTTTGGGAGCTTTGCCGTTTCTTGGCGTGCGCGGAGGCGGGTTAGGCTCGCCGTCTTCTGATATGGGGACCA
GCTCATCACGACGAAGACCTGTCCACGATATGGGAACAAAGACTAGACGATCTCGTGGAGCTTCTCCAAAGGGTGGTGAG
TCGTTAACGAGGTATCGCAGAGCGTTAGGGGCAAACTCGCATTCATAGGCAGGCCGAAGCGTTGCATCGTTAGCCGGGTG
CAGGCCGCAGCCGGTAGCTATTTTGCATATTGATGGAAGGGATTCATCTGAGACTAGCAGGAACAAGCTCTAAATTCGTT
AGCACGCGTGTGCGTAAAAGGAGACAGGCAACGACATACATTGTCTCGTGCGAGTGGGTAGCCGAGCCGAGTCAGCAGAG
TCGTTTCCCATTACACAAGTAATATTCCAGAGGTCCCGAGATGTTCAATCAATTGAGATATGCGATGTCGTGTATCCATG
TCGCTTGCCCTTTGAGTGATGGTAAAATCCCTGAGAAGAAGGAGCGAAGAAGGTGTCGAACACGATTAGCAAAATCCGGG
ACACTTTTCGGAAGAACAATTGGCCAACACTCTGTACTATGCGTAGAAGGCAGCGACAATCACAGACTCTTGTAGAAATA
AAATCTGAGTAGGAGTATGCAAATGCAAACAGCATTGTCTGTTACTAGCATTTCTAACTCATTCCCGTCTCCTATGGCCA
AAGCTCCTATAGCTATAGCATTTGACGGGACGATCTAGACTGCCTAAGTCCTAAGACTTCGACTTTGTCACTACGGCCAT
CGCTATATTAAGGTCTTCGGGATAGCGCTATGTTTTTTCCTAATGGCTGCCTATATCAAGGCCTTAGTCATTCTTGCCTT
CCAGATTACAATGTGTGCTCGTGCCATCTCTGTAGTAGATTACGGCACTGTGCACTGCACAACCGACCCTAATGCCTGTC
TTGGACACAAGAACGAAAAGCTAATCCCGGCTTCGTTTCTTCGGCTTGACGGTCCAAGGCCAGTCATTGCCCTAAGTATT
TCCGCTGGTCACGCTTGCATTCTGAAGGCGGACCCCAGTGCCAAGAATGCGTATTAGTTTTAGTTTTTGAAAACCACGTC
CGAGATGTGCTGCTTTCCGTTAAGTATCTAGTTTATAACTAAACACGAAGTTTAGTATTTATGCATAAAGTAGGATTCTC
AACTTTAACACAAGCTGTAGTCTTTAGTAGCACATGTATTTTGTCGTTCTTTTTAAATAGTATACAATGTGCTCGACGGT
GGAAAGCCAGGCGCAAACGCGTGTAGTACGATATTTATACCTCAGATTTAAGTACTTTTACCTGGTGATAAAGGTTATGC
CGTAACAGCCCAGGCAGCAACAAGACAATCCAAAGCGGCTCCCTGTGTAATTTCATTCACTGATGTCATTGGGCCACTAA
AATCGGCCCCGGTGTTGCATTCGGATGCCCCGTCAACAACTGTGACATTTAGGGCATTGTTCCAAAGCGATTGGGCATTT
GTCGTGATCCAAGTCTCCCAGTTACTATGGGGGTCGGCAAGCTGCAATTGTCTCAATCCACGGAAGAGGGGTCCTTTAAA
CATATCTCCCTGATCGTCGCAGCCACCGTCGCAGTCTGTGATGACTCCATTATGATTGGTGAATGCAGAGCCAGCCGCCG
TGACAGCATCAGCAACGTTTCCTGCAAGCTCAAGGTACGTTGCGTTTCCCGTTGCTTTGTACAGCTCAACTGCGGCGCCG
AGAATAACACCCTGGTTGTAGGAATATTTGTTCCCTTCGGCTACGCAGGAGTCGCCATCGACGCCATCAATGATGAGCCA
GTCGGAGCCGACGAGGCCAGAGTTGAAAACCCAATCCCATTTGGTCATCGCCTCTTCCAGATAGCCCTGACGAGCATCTT
CGGGAGCTCGGTTTGCCAAGCTAGCGGCAAGATTGATATAGAGCTCTGCCATAATATCTTAGTCGTCGTTGCTTATGGAT
CATGTGCTAGGTTGCTTACCATTTGCGATAGCAGCAACGTACGAGTGGCCTTTTTCCCAGTATATACCTCCACATGTTGA
CTCTCCGCCAGAAATGTCGTTGTAAAGACTCACAGCCAGATCTAAGTAGCTCGGGTTCTTAGTTAAATCGTACACGGAGA
TCCATGCATTGGCCCACCAGCCTTCATCATCGTAGTAGTCGTCGATGAAACCGGTATAGCCATTGAAGCTGGGTGCATTG
GCGTAAGTCGTTGCATACGTGCCAAAGTATGTCCCATTGTAGGTCGAGTCGAGCGATGAAATGTCGGCGAGAGATGCCAT
CAAAATAGCAGACTCCCACCATGACCCACCCCAGAGCCCCGTATGCGAGGTCCCATAGTAGCGCATCATTTGGTCACTGT
GAACATACATCAGCATGAGTTCGGTAGTGCACAAATAGTCGGCCATCCTACCAGGTACAGATGGCGTTTACATTGTACGT
CGCATCATCCGCCTTAGCTTCGCTAGCAAATGCCACCAAAAGAGAAGTGAGGCCCAAAAATAGACTCATGTTGCAGTTTC
AATTTGACAGAAAATCCTTCTTCTCTGCATTTTAAGACTAGAAGGCCATACATAACAAAGAGAGGAAGCGTTCTTATATG
GGCTAAGCTTGAAGGGAGCTATACCTGTAGCAGAGGCGCAGCTTACTAGTGAAAATGTACTTTTACTCTTATGTGCAATA
CATGTAAGGAAGAAACAATACAAGTCTTGCACACATTGGCCAGGTTGGAAGCTGCAAGATTGCATGGCCCGTTATATCCG
TGCCAAATGGGTGTCTTTGAGACCTCCACGTGCGTATTCATCTCCACAGAGAACCTATGTTCCCGACTAGCTTTCCGCCG
GTCCTCAATCAGGACCAATTTTATGACTGTGGAATACTATGTACCACTGCTGGGTTCGACCGTCCGAACTCTTATAGCTG
TCCCAATGCGTCCTGAGTTTTGTGCCGGCAATAACGAAGACGTGGATGTTCCTCCCTACTACGAGTCTGTTAAGACACCT
TACCTAGGTACTGTTACATACGACGTAGTACATGCGGGACAAATCTAGGGCGGATGAAACCGGATTCTATTCCTTCGTAC
TTTGATCCTGAAGTAGCCTAATGTGGAGCCGGCAAATCATATTATTTTGCTCATTTTTTCAGCTTTTAGTAACATAATCC
ACTCCTTAGACGGTCGCTAGCTAATTTCCTTATCTTAGTGTGCAGGTTATGTTTCCGTCACTAACAAGGGCTTAGCTCCT
TCGCTCCTACGGCGTCATACGGCAGCGAATTGTAGAGCAGACAGCGCGTGTCTTAGGAAGCCGGCGTAGAGACTGTGTTG
CGCGGTGGTGGCACGGACCACCTCTAGTGCAGAGTTTTCAGCCCAGACTTCCTCTAGCCTTAGATAGCTGTCTTCCTTCT
GAATACAACGATCTTCGCCTTATCAGACTGCCTTTCTGATCGGAACCAGTGTGCAATCCTTATCTTCAGCCCCCATTAAC
AGACACATAATCGTTGGGATGCTTGTTGTTATGCCGGGGCTTTCGATTTGCCCTCTAGACCAACCTAATATTCCTTACTC
CGTAGGACACTGTATAGTATCTTACATGTAGATCCGGAAGGACACGGTAAACCAAATCACGGATATACCTTACATCTTAA
AAGCGGAGCCTGCGGGCCTAAAGCAAAGGCCACGTACTACTGCAGCTGTCTAACGTCGCAAAAATGGCGATGCATGTTAG
CAATCAAATATGAAACACAAAGAGTACTAGCGTGCGGCATCTCAGACGGCAGTTATGCCTGAAAGAGCATACGTCCTTTT
CCCTACATAGTAGTTTTTCTGCTCTTTTATTTCCCGACCAAACCTTGTCGCCTACCCCTGCCCCCTGTTCGCTACTGCAC
AGGCCGCATGGTTTCAAACGACGGCCCGTGACTTGCCATACTATGTAACAAGTCGTGCGCGGAGATGGTAGGTTCTGGGA
AGCGTCGTGCTGGGAAGAACACGAAGCTATCTTACATAGTATGGTAAAGTACTCTGTACGGAGTATATAGTATACGGAGT
ATCTTACTTTGCAAGATACTATCCGTGGTGTGGACTAGATAGGTGACATTGTAAAAACAAGATAAAAAAGACATCTAGCC
TTCCTTGGCGCTTTCATTCCCCACAACTCTTCCGCCTGTGCAGTCCGTGGCTAGTACTGTTGGCTGCGTACGTCCAACCG
CCCGTGTCTCGGACAACGTTGAGGTAAATCCGTCCCATCAGAGCTATGCTTGTAGAGAGCGTTGCCATGACTTTAAGTTT
ACGTCCTGCTCAAAGCGGACACATTGACATCTCTAGGTTGTAATAGTCCAGAATCTGGCTGAAACATATCGGCTAGACAG
TGTCTATGAGGCCGATACCGAAACTCGAAAGTTAGCAGGTAAGGCGGTAGAATGAGAAGGCAGGCATGGGACGACCTCGC
AGACAAAATGGATAAGCAGCAGCAGGGCTAGAAGCGGGGGAGCCCGGACGCTAGACAACAGACGAAGGAAGAGACTGGAG
ATGGCAGAAGCCGATTCCAAGAGGGCAGAGCCGGGCTGCTCAGCGTACACAGTAGCGACTAAGGCGTAAAAAGAAGCTCT
AGGCCTGTGTGTGTTGTGCCTGTGTACCCGCCTGCCTGAAATATGCGCGGTCCCTCAACACGGAGGGCGCTACCTGGAGT
GGTCACCGTAAAGAAGAGTTATGCGCGATACGGCATCCTCGGGTAGGTCTTGACATAAAGCTGTAGTCCGGCACATGTTC
GGCAAAGTGTAGTCCGTAGTTCCTCCTAGATTAGACGTCCATGCCTAATGAGGCGAAGATCGTTGTATTCAGAAGGAAGA
CAGTTATCTAAAGTGTATTCAGAAGGAAGACAGTTATCTAAAGCTAGAGGCAGTCTGGGCTGAAAACTCTGCACTAGAGG
TGGTCCGTGCACCACCGCGCAACAATAACATACTGTGAAGGTTAAAAGAGGCTATACGAGTAGAACCTTGTTGCTCACGG
CCGAAAAAGACCTTTATCTACTACGCGATAGCGTCGTTCGGCCTATCGCATCTTGGTATATGTTCTTTATAGGAGTCTCT
TTAGAAGGCTTTGGTGTATCGCAGGTTAGGATACATGAAAGTAATATAAAGGCAGGCATGACACTTATAACCAATGATGG
CATCGCCACGTGCCTGTGGCAATTTTTTTGTACCAGCATAGTGTGGATTTCCCCGAGGTCACCTGACTTGACCTCGGCCG
CCGAAATTACTAGATAAGACGAAGCCCTGATCTGCGCGCATACTGCGCACAGTCTGGTCTTCAATCAGTCAACCACCGAA
CGAAATACCATCACTAGATCTTCTGAAGGCTTTAGAGCTTACTACGATACGTGCAACTGGTCCGGACGAATATCCCACAA
GGATTACCGTACGGGTCTTACACTGGTGATCACGCAGAACGTGCGTGACAGACTAGTGGTGCACGGAGTAGAAGCCACAA
TAGCAAACAACGACGGAGTGATGTACTTGTACGGAGTACTCTTTATGCCCCGCAGATATGGACCGGCAGAAAATGCATGG
GTGCTACGGCAAGAAATGCATGGGTGCTACGGCAAGATATGCGAGTATTTTGAGATCACACACCCAATATTACGGTTGAT
AAGACACGTAAGATATCTAGTCGCCCACCTTGGACGGGTCTGCGAGGTTGGGAGGCATCGCAGCGCAACGGCGCCTTACG
TCGTAGGGGTTAATGCTGTTCAGAGTGAAATGATAAACGTTACAAAGGAGGCGAGGTGCGCGATAACGCTCTTTGCATAG
CGGCCCCTCCGACACAGAGATAAGCGGCAGGTAGCATGTAAGATGCGTAAGTAAGATACATGCACGGGGTAAAATAGAAG
GCGGTGGCGAACGGAATAGCGAACCACTTAGCAAATGCCCCTAGATTTATTCCGTACATCACAGGGCGTAGCTCTGTGCA
AGGGCACACAGTCGTGCTGTGCTGGTCGTAGTCTAGATCCACATAAGTATTATCTTTCTGCTTGGCTATGTAAGGCTTAT
TACAAGCCCACCCATCTCTACTGCTGTGGATTTCCGAGGTCACTTAACCTCCGCCTGAAATCACTAGATAAGACTACGCC
CTGAACTGCGCGCACATCGCACGCAGTCCATCATTACTATATCTCCTGAAGGCCTTGAGACTACCACAAGACGTGCAACC
GGTCCGGACGCATCTCTCACAGAGATTGCCGTATTTCTACGCAGGTAGTACGCACAGAACTGACCGCGCGTTACAGACTA
GCGGTGCACTGAGTATGAGCTACACTACGGAGTACGGTCAAGTATCGACGATAGATAAGAACCCCACAAATTGAACCGTT
GCCCGACTGGGTGACGGGCGATGATTTCGGGCGATATGCTGGGTTAATGCGACCGATCGCAGGATGCCTGTCCAGCGGAC
TGGGCGTGTAAAGCATTGCATGCGCCTTCTCTCTTCTTTTTATAGGTGATGGGGTCTTGTCCTTTTAGCCTCATCTCTTT
CAATCACGCCCCAAACTTCAGTTTCGTTTCTTGCCTCGTCAGTAGGACCTAACATTTACCATGGATCTCAGCTATGAAAC
CAAGGAAACGGCGAAATTCCCGAGCGTCGATGTTGAATACCAGTCTGGGTCCATCGAAGCTGCCGAGCAGGGAGGAGGCG
CACTGGGAAATGTTCGGCGGTGGATTCGCTCCGTCGGGGCTGAGGAGTTTGGCATTGAGCCTATCACCAAAGAAATGCGC
ACGAATCAGCCGGCCATCGACCTCTGTACCATCTTCCTGGCCGCCAACTGCAACGTCACCACCTTGGCTACTGGGTATCT
CGGTCCTACGTCCTATGGACTTGGATGGTGGGACTCGTTCCTGTGCGTCCTCTTCTTCAACCTCGTCGGCGTCATCCCGC
CGGTCATATGCGCTACACTTGGCCCAAAACTGGGTCTGCGCACTATGATCATCCCCCGATACAGCTTTGGCTGGTGGCCC
GTCAAGGTCATCGCCATTCTCAACTGCATCAACCAAATCGGCTGGGGTATCGTCAGTGGCATCACCTCCGGCGACGTTCT
GTACGATGTGGGAAGTGGCCGGCTCCCCCTTGCAGTGGCGGTGCTCGTCGTGTGTCTGGTCGGATTCGCCTTCGGCCTGC
TCGGATACAAAATTCTACACATCTACGACAGATACTCGTGGATTGTTATGTTGATCTGCTTCATCCTGCTGGCCGGATTT
GGGGCGAAGCACTTTGTCAATATTCCGATGGGCTCGGGCGATACCGAGAGGTCCAATGTGTTTGCGTTTGGCGTTTCCAT
CATCGGCTACGAACTCGCCTGGTTGCCCGTTGCTGCCGACTATGGCGTCTACCTACAGGACACGATTAGCCCCACAAAGA
CCGGCCTCTGGACGCTGCTCGGACTGCTCAGCTCCCAGGTTTTGATCGAGTGGCTGGGTGTCGCCGTCGGGACGCTGAGC
CAAAGCACCGACAGCTTGTTTACCGACGCCTACAACAACAGCGGCGTTGGCGGTCTCATCGGCGTTATTTTCAAGTCATA
CAACAGCTCCGGTGTCACAGGCTTCGGCAAGTTTATCGAGGTTCTCATTGCCTTCTCAACGTCAGCTGTCATATCCACCA
ACATTTATTCGCTCGGCCTCAGCGTGCAAGTGATCTCAGGGAAGCTTCTCGTCGTGCCTCGATTTGTGTGGTCACTGCTT
GGTGGCTGCGTCTTGTTGGCCTGTTCCATTGCCGGCCGCAACGTTCTTGCCGATGTTATGACCAACTTCCTCTCTATCTG
CACCTACTGGCTCACGCCTTTCTGCACAATTTTGTTGTTGGAACACTTCATCTGGCGCCGTGGTTATGCGTACGATCTGG
CGGCATGGGACGACCGAAGCAGGCTGCCTCATGGTATTGCGGCGTCTGTGGCGTTTGTTGTTGGCACGGTCTTGTCGCTC
CTGTGCATGAACCAGGTGTGGTGGGTTGGTCCGATCGCGCTTGGCATCGGGCCGGCGCCGTATGGGACTGACATTAGCTG
GCTCTTGGCGGTCGGCGTGTGCACTCTTATTTATGTGCCACTCCGGCTGTGGGAGAGAAAGAGGTGGAATCTGTAAATGG
GATGGCATCGATACGTGTAAGGCGACAAAATTGGTATTGCTCTAAACCGCCCGGTGTTTTCGTTTATGCTTTTACAGCCT
TGGATGGCGTTGGGGGATACAAAATGTGCCTACGGACGCTCCGCTTTCAGCTGTCAAGTGTGTGATTTCCGCAAGCCAGA
TAAGAATTGTAATCTTGACAACTTTTCCTGTTCTGGCCAGTCACGCCGATCTCAACCCGTAACAGCAACTTACTCCGTAG
AACACTGGCGCCGGTCTAGGTACCCGGGGGTATATCCGAGACTGCGTTTCCACTGACTGTTTTGCCATTTGGGTCCCGTT
CTGTTCCATGTCCCGAACTTTGAGAAGGCATTTCAAACGTTACCAGAATATTTGTCGAAACAGTCTTTTGGCAATAGCTG
GTGATTTACGAAGCCGCTGTAAAGAGGTACAGAAATTGTGGTCGAAATTTTCAATCAGTGGCCATTTTGGTGTGCGAAGT
AGTGTGTAGTCTCTCCGGTGGGGTATCTTGTAGAAAAATGCGTTATTTTTTATCCAAATATTGTATCTTACGGAGTAAGT
AAGCAAATCTCGAATCAAATATACTGGCTCTATGACTGCCCCGGTGAATGGCGCAGTTTAGTGAGAGACTCGATCAGCTT
GCAATTTTAGTACCTCTCCGACTATTTCGGTAGCCGATCGTAGCATAAATGGACGTACTCATATGTAGTCTTACGTCCGA
AGATCAAATCCACCGAGGAGCAGCCGCCGATCTGTAATTATGAGTCGTCGTACCGAGCAAATCAACAGACATACCACTAC
TCCGTACTCCGTACTGCAGAAAGAGGGTTGGTCGTGTCAGATCATGGGCACCCGGTGAGCATGCGTGTATTGCCGTGTCT
ACGGAGTACGAATTAGTTACTTCCGAATTATGCCTGAAATCCCTTACTAAAGATGGGGCTTGGCACTATATGCCACAGGG
CACTCCGTCATGTATCTTTTTATCCAACCACAAGTCCTCATTTCACACCCACTCTGACTCGGGTCCAGTCCAATCAACAG
GTCGAGCTACGCTAAGGGACACACTGGATATCCGAATATCCGGCGGGGCGGCCAACAATTTCGATTTGTAAGCGCTGGAA
ACCCGAGAAGACAGGCGGAACAACGCCATCAACTACAGAACAGTACAGCTGCGTAACATCGCCACGGCAACCAGAGGAGC
AACTGTTCCCATTCATCGCGCAAAGTCCCGAAGGAGAAAAATGATGAAGGCGGTTCAGTTCAGCGAGTACGGTAGCACGG
ATGTGCTTACGGTGGTGGATATTCCGAAGCCGACGGCCGAGGCCAGCCAGGTGCTCATCCGAGTCGAGTATGCTGGCGTC
AACTTTATCGACACGTACCTGCGGACAGGGCTGTACACTTCAGTGCTTCCTGCAACAGCCGGCCGCGAGGCCGGTGGCGT
GATCGAGCACGTGGGTGAGGCGGTACCGGCAGAGTATGGGCTGGCGGTGGGCGACCGGGTAGCCGTGTTTGGTCCGGCGG
CGCTGGCCGAGTACATGGCCGCAGAGGCGAGCACGGTTCTCAAACTGCCGGAGAGCGTGTCGACGAGGGAGGGGGCGGCT
CTGATCCTGCAGGGGTTGACGGCCTGGACGCTGGTTCGCGACGCCCACGACGTCAAGGCTGGCGAGACGGTGCTGGTGCA
GGCCGCAGCCGGTGGCACGGGTGGTTTGCTCGTACAGATGGCCAAGGCCCTGGGGGCTACCGTGATTGGAACCGCTTCGA
CGCCGGCAAAGATCGAGGTGGCGCGCAAGCACGGGTGCGATCACGTGATCAACTACGCCGAGGACGACATGGAAACCGAG
GTGCTGCGGCTGACCGACGGCCAGGGCTGCCACGCGGTCTTCTCAGGCGTCGGCAAAGCGACGTTGGTGGCGGATATGAA
CGTGACACGGCGCAAGGGCACGTTTGTGACGTTTGGCAATTCGAGCGGGGCCATTGAGTCGGTGCGGCCGCTGGACCTAA
GCCGCAAGAATATCAAGCTGGTGCGGCCGACGCTGACCAACTACATTGCCACGCGCGAGGAGTTTTCCGAGCGTAGTGCC
GAATTGGTTGACCTGGTGGCGTCGGGTCGTCTGTCCGTCAGTATTGGTGGCGAGTATGGCCTGCACGAGGTCGGCAAGGC
CCAAGATGCTCTGGTTGCCCGGAAAACGGTCGGTAAGCTAGTCATCAAGGTCCAGTAGGGTGCTGAGAGGGCTATATGCA
TGGCAAGGGCGGACAGAGGCGAGGGTGGTATAAGCAAGTATGAAAAATTAGTGTAGGTTCAAAGAGAAGGCACTGCAATT
CAATATAGCAGTTGCGATAGCAGCTGAATGACAGTACATGAATCTGGTCCGCAAGTTCAACTGTTTTGGACATCCTCTCT
GGCCTCCATATTACATACCAGACATCGTGTTCCAAATAAGAATTCGGCATACATAGCCCTGCCTACTATTCTACGAGGTA
AACGGACCCCACTTTTGCACTATGGTATAGGGGAGGGGGTATGACAATACTACACCTCGTTCATTTCGGTCGTGTCCATT
CTTACTCCTTACCAACTTTTTCGTTCATGCAAGTAAATCTTAGTGTCTGTAATAGTCTAGGGCCTCATATCGACCGCTGC
CGTCGTAAAAACATGGCCCTAGGCATCGCCGAGGTCGTCTACTACCTCTATTGCTGGTAAATAAGATAAATCCGACCAAG
CCCTTTGCCTCCCTATATATCGCTGAAATACCCTGTTGGTCGTTTCTTTGTTTATGAACTCCTCCAGATAGATGGCTTTT
GCGACATCAGTGTCTGGTGCTAACTAGTTGTTAGAGAGAGATGTGCCAGAACTCTCATTGACGACATCTTGGCGTCCCTC
ATGCCCCAGTATACACAACAGTCGTGTGGCGTGTCGGACCGATGAAGAGAACAGTGTTTCTTGGCTTGGGTAAGAGCCCG
TTTGACGTCATGCAACTCGCTCATTACCTGCAAGGGACCTGACCTGGGAAGAATAAGCCTATCACAAAGGCAATAAAGCG
TCTTGGTTGGCCACATGATATGTTAACCTAGAAGGTAAAGACAGCAGCCAAGAAGGTCCGTGCCACCAGTATAGAGCCTC
TCATATGAGAGCCACCTCCTCATTTAGGCATGGAGTTTTGGAGGACGAAAGCAGGGTGCTAGACTCGGTTGGGAAGATCT
GATGAAGACCTGGTGACTGGTATTCGGCAGCTTCTCGACGGACGGGATCACGCTTACGTCGTAGATCTCCTAGGAATCCA
CACACCCGTTCGTGCATTAGTGTGGGGGCCATCTTACACACTTACCTACGAGATACATACGGAGTATGTACTTCTGTGAA
GGTTAAAGGAGGCTATACGTGGCGGTCATATAACGTGATGCACTGTGAGGAGCAGGAGGCTGAATAGGGTCTAGTGTGGG
CGAAAGAGTGTTGTGTACGGAGGTCCCTACCAAAAGTTCTTTCTCACCGCTTTGGCAAAATAAGAAGGTGGGTATAGTGC
TAGTAATGTATTGCTACTGTATTTACTACAGCAGTGTTAGCGTATTCCTATGTGCTAAGCGCCCTGTAAAAATATTAGTA
ATTGAATTATATTAGCGATAATATCCACTAAGCTCCAGCGTATCATCGCTAATAGCTTTCTCCGTATTATTTACACTCTG
CACTATGTACTGCCGCAGTTATAGACAAGCGGTGAGAACGAACTTTTGGTAGGGACCTCCGTACTAAGGAAGAAATAGAT
ACATCGCGACCCTTCTGGGGGTCCGTATTAATACTAGTGCCATGACCCGCTTTTGTGCCTTCTGACCAATCAAAGGCCCT
TACGGTCAAGTGGGGTGGTAGGGCTACAGTGTGGCGGATTCCACACAGTGTGGCGGATTCCAATGCTTGACAACTTCATT
GTTTTAAAAAAGCAGTTCATCTGTGCAGGCCAGTGCTCCCGTATCCGCCTTTGCGAGCCTAGGTACTGCTGATTGATTGG
CTACAACCTCTAACAAAGTTATTAAATACGGAGGACACGAAGCAGAAGACGATTAATGTTTGTAAGATGCCACCTGTACT
CCGTATTGTGGATTTTAGGGTGATTTTGGGGTTACATGACGCCCGAAATTACTAGATAATACTGCGCCCTAAGGAGGGCG
CCCAACACACTTAAACCTAGAATAATCAGTCAACCACCCTACGAAATATTATCACTAGATCTTCTGAAAGCCTTAAAGCT
TACTACGATACGTGCAACTGGTCCGGACGTATATCGCACAAGGATTATCGTACGGGTCTTACACTGGTATTACGCGAAGG
CAGCACATTCGCGTTACAGACTAGTGGTGCACGGAGTAGAAACCACAGTACTCCGTATTACACCGTAAATTGTGATAAGG
ACCTACCTTATATAAGCGGAAAGAAAACCTCGCCGCCTTAGCGATCCCCCATTTTCGTCACCACCTACGGAATGGTTTCA
ATAAAATTATTATTTTTGCCAGTGCCTTTCAAAGTTAAAAGGCACCCCCCTACAGCTATATATAAATTGAAAGAACCCCT
GCCTCTTGAATACGTAGGAACTAGTACAAGGAGACGCTATAACTAAAAGGGCTATCTACTCCGTGGTAACCAGACTAAGT
TATGAAGTACAGCAATTCTCCTATATTTTTTTTCTGCCACCATGGAAATCTACGACGTACTCATAAGGTGGAACCTTATT
ACCGTTTTATCTGTACAGGTGTGTACAAATATCAGTCGCCGAAGCAGACACGAGTCGACAATACATTCAGAAACAAATAC
AGCGTAAGCGAAATAATCAAACTTCATGTAAACATTTCTATTTACACAACCGGTGGCGCTAGATAAGGAGTTTGCTATTA
CGTATTATCTGATTTCGTACTTCGTCCCTCGTACTCGTTCGTACACGTTCGTACTCGTTTCCTACATGTCACACCTCACC
TAGACCTTCATCGCTCAAGAAGCCTTCTCACCGTTCTCGCCGTTCTCCGGACCTTCGTCGTCGGGGGTCCAGCTGGCACT
CTTCCATGGGACAACGCCCCTGACATACATAGTATCAACCTCCTCAAGGCTGCGGTTGTGCGACTCGATGATGAAGAAGA
AGACCAACAAGGCGCCCGCAAAGCAGCACCCGGCAAAGACATAGCCGTAGCGGTAGTTGATCGCGGCCGTGATAAATGGG
GTAAAGAAGGAGATCAAAAAGTTCCACAGCCAATTGCTGGCCATGCAAAGAGCCATGCAGCGGGCACGGTGACGCGATGG
GTACATCTCACCAGCAATGGCCCAGCAAAGACAGCCCCACTAGAGAAAATGTTAGTGGACAACGAGCGAACTGTGCAATA
GCAGAGAGTTGGAGATACGTACAGTGGTAGCAAAGCCGAAGATAAAGAGGCAGGCAAAGGCAATCATAGCGCCACCAGTG
CCGCGGCTGGTGACCGCGTTCGGGTCGCTGAAGTTCGAGTCGGGGTAGAGAGAGAAGGAGCCGAGAGAAGCGAAGACAAG
GAAGCATATGCCCATCCAGACGCCGCCGACTATAAGGCAGAGACGACGACCAAAGCGTTGACTAACCCAGAGACCCACAA
TAGTGGAACCAAAGTTGACGCCGCCCAGGATCATAGAGGTTACGTATGAGTTGGAGATGCCGACGGAGCTAAAGATCTGG
GTACCGTAGTAAAAGAAAAAGTTTGCACCGGTGAGTTGCTGAAGCGCCTGAATAAGGACACCAACAATCGTACGCCGGGC
CATGGCGGGGCCGGTGAAAATCTCGTGCCACTTCGTTTCACCTTGGTTTGCCTCCTCGGCGAGCTTTTCGCGCATCTCGG
CTAGCTCATGCTGAATCTCAACATGCTCGATAGGCACCTTGGAAACGAGCGAGAGGGTAAGGGCAGCAGCTTCAGGGTGG
CCGTGGCTAAAGTCCCAGCGCGGCGACTCGCGCATAAAGAGCATGCCAACACCGATAACCACGGGCGAGATAAAGCCGCA
GCCCATGGTGATGCGCCATGAGCCGGTGTCATTTCTGGTCTCGGTGCCGTAGTTGATGCAGTAGGCCGTAAAGATGCCGA
GCGTGATGAATAGCTGGTAGGCACTAACCAGGACAGAGCGGACCTGGCGAGGTGCAGTCTCGCTCTGGTACATGGGTGCG
AGCACAGAGCAAGCTCCGACAGCGAGGCCGGCCACGAGGCGGCCGATGGGGACCTGGTACCAATGCTTGGAGGCGGATAT
CTGGACAATATTGCCGACAATATGGAGGGTGCTCCAGGCGGCAATGCAGTACTTTCGGCCGAAGCGGTCGGCGAACGGGG
CGCTGATCAGGGAACCAAGCAGACAGCCAATGCAAAGAAAGGCGACCATGCAGCCGGTGCGGACCTTGCCTAGAGTGATT
TCGCCGGAGGAGTTGATGGTATCACCGAAGTGCTCGCGGAAGTTCATCATCTCGACGTAGCCGCCGATAGACCCACCCTC
GTAGCCGAACATGAATCCAGTTGTGGAAACAATTATTCCCATGACGATGGTGCGAACATTGACAGCATGGACAGGACCGT
CGACGAGGCCGGGCTGCATCTTTTCGACTCTGGGTGTGGTGGTGCCGCTGCTGTTCTCCGGCAAGGCGGGGGTTATACCG
GCCCGTGATGTCACTGTTTGAGTGGCCATTTTCTTGTCTGGTAGAAGACCTTTTGAGTGTATGTGAAGTGTAGTTGTGAT
TGCTGTGGAAGCATGAGGATTGATTCACTGAGGCCTAGGAAATCGTCCATTATAACGACCAAGAGAGGAGTAGCTAGCTC
CGCTGTGCACAGTGATGTCCGCCGTAATCGCGTGGTACTCGGGACGCGAAAGGGCAGCATAGTCTCATGACCGCCGCGCC
CATAGCAAGGCCGGCCCTTCTGGCGCGATCGGTGGAGCAGGAATAGGAGACCTCAGGACGGCCGGGGCCGGCGAGCAACG
ATTAAACAAGAGATTTCTCAGGTGATAGGGGGGCGGCGGCCAAGCAATGACGTGGGGATTGACTAGGCGCGGCGCAATTG
TCAAAAATCTGATGAGAATTTTTTTTCTTTCAACATCTCGGCGACATTTTCTACTTCGGAGCAAAGAAAAAGTTGGATAA
TAGCGCCGGCATCGCTATTATTTTCGGTTATTTGGCCTTTTGGAGAAAACCACTTGGCGGGCATGTAGGGAATACCAGCA
TGTCGGCTTAATAGTGTTGTTCGAATCGAATGGTACTCGTACGCTGCCGCACAGTCAGGGCCATCTCCTGCAGCTGGCCG
CCTGTCGCGACGTTGTTTCTTGCTGGTCAGCCAAGTCGGGTCTATCCGCCAGTACGCACTAACGCTGCCGTCACAGATTT
TCAGTCCCAGTGCCTGACTAAGACTACGAAGGCTAGTCCTAATGCAGAAATATCGCCGGATTTGACCTTCTGACGCACCC
ACTTTGACCGGACCGACTAGACAGCAATACCGTATCGCATATACTCCCTCTGCAATCGTATTTTGCAAAGTAGCAGCTTC
GCCCCAAGGCTCGTCTGACCAGTACTCCATACTTCGCGCTCGCTTTTTTTCCCTCCTAAACTGTGGCGAACAGTGTACGA
TTACATCTCACTACTCGTACGTACATACACGTAGGCTGTTGATCTACCCCCCACGAATACGAGATTTGTGTGCCTGGGAT
CCCACTTCGGACCTAAATTCGGCTCCTTCAGACCTCGTCACCTACGACGTACGGAGTACAATGTAGAAGAAGGGCCGCCA
AAAGTGGATCCTTGCTGCTGATCTGCATCTAAAATGGTTAAACGAACGCGTTTGTTTGTGATTTAATGCCGATTATTAGT
CAGCCACTTGCCCATACACAGTACTCCGTAGGTACTCGTATAAAAGCAATGGCAACGCTGCGACTTTGTGGGCTGCTGAG
GCCCTTGTCTCGTTGAAGGCATGAACGTCCACGTCATCGGTCTTGCAATGCCGACTGAACCATTCTCGCGATGCCACCGA
ATGGCCGAACGGTAGAATTGCCTGTTCTTAGCACATAGACCACCAAATTAGGCATCGGGCACTTCTCCCTAACCCACCAC
CATATTCTCCGTATCATAAGTGGCAAGTATGGGTCCGTTCCTCGAGCTTGCTGGCTCGGAGTACTCGCCGGCCGTATTGC
TAGAAGATTGTCTCTCCAGAGCGTGACCGACCTTTAGTCTGCATCTTACTCCGTACTCCGTGGGGCATACCTGGATTGCG
CAGGCTGGTATCAACATTTGACAGTTAAGAAGCCCCTCGGCGGCCTAGAGAGCGAATTCTACTGGAGCCTCTCACGTCCT
TACCTATTAGGATTGAACAAGCGGGTCTGATAATACTGCAGCATCTTATTGGGCTTGGACACCAACTCAGTATGATGATG
CCTTTGACGTACACAGATTACTAGTAAGATGCGAAAAGTGTGTTTCTTCAGCGCGACTATTGTCGAGGCTCAAGTCTAAT
CAGTATTTACGGTATACGATCTGTCACAGGGATATCTCGCCGGTCAGGAGCATGTAGGCCTGCACGAAATACTGGTAATC
ACGTGACTCCCATACTTGAAAAGCTCCTCCAATCTCAACATTGATCCGAAACTCACAAGACCTCTTTGCCGCTCATCAGT
CTCTTACGAATTTCTTGTGGATCGTAGCTTTTTAGCTCTTGCCAGAATATTGTAGATAAGCGTTCCTCTAAGGTGCGAAT
AGTGTCCAAAGGGGCAATGTCAGAGATGTACGACTTACTCCGTAGAGGAAACCTATTCAGTATTGTGACAACGTGGTCAC
TCAATGCTGGAAGAGGCCATAATGGCATTCGTGGGCGATCTTTCGACTTTAAAAGCTAAGCCGGCCGACGACGCGAGTTT
AGTTCTCATAGCTGTCTTACCACCTCCCAGGGTTGCCCTAGTCCTCGACGTGGACACTGTTTTGTGCTTTATTTGTGCTA
ACTGGGCTTTAATGTTAACCGATATGTCTCTTTACAATTTTCAGTGGCGAAGTCTTACGAGTACTCCGTGAATGTCTTTC
TTAAAGGCACTGTGCAGTAGCAACTCAAGGTCCCCTGAAAGGTACGGAGTACTTCTGTATGGCACCCCTTAAGAGATACT
CCGTACGGAGCACTCCGTGTACAATCGTTAATTGCGTCCAACTGTAACATTTTTCCGACTTCTTTGTAGCAATAAGCTTG
ACACTACGGAGAATTATTCGACAAATCACAAAACTAATATATTTTTCACACTCACTGAAATCCTACAGCCCGTACTCCGT
ACTCCGTATATAATTATTAAAGCCAAATAAACGACACTTAGCAATTATGCAACAAATTCCAGGTTTTTCAAATGTATGAA
AAGTGCAAACCGCTAAGGAATAGGCTTTTTTTACAACAAGCTTCCGCCTCATCAGTTTTCACAATGTTATGTGTTAGTCG
CTGTGGCCCTTAGTATACTCCGTAAGTTCTAGTACTTCGAGTACGCCCATTTCTTGACTGAACCGCATCGTACTCTGTAT
ACTGCCATTAAATGGGGACTTGATGATAATTACCTTACAAAAAATAAAATAAAATAAAATAAAATAACAAAACCCTATTC
GTCCTCTACGCGCCCCCCGAAAAAAATAACATTAAAGAAAACGGACTACTCCGTACAACGTGGTTTTTTCACGGCTTACC
CCTAACAAGTTAGTAGTTGAAATCGGTCCTATAAACATATGATTTCGAACTAGGTCTGCCAAATTCCTCCCCCCCACCCT
TACCCCTATTAATAAAAATAAAATCTGTGCTTTTAGGGCAGTACCAAAGAACACGCTCTTAAGAAGAAACTAGTTTTCTA
TCCAAGGTTTGGTTGTCATGTCCCTCTTCTAATGCAACTTCCAACTTCCTTCTTCGTAATATAAAAGGTTATTCTGACAT
TTTTTCGAAAATCAAACAGAGGTAGGGCGTAAGCCCTCGTATATAAACATTGCGGCCACAACGTCTAGCTCAGACACGTC
AACGCGTTCGGGCCATTCATGATTCATCGCTTCCATGACATTGTGTGACTGGAATATTACCAAACTTCTTACTTTCCCGA
TAGATACGGAAGTGAACGAACGGGTTGATAAGGCCTCGAAGCAACGCTCTCTTTTGTAGTTTGAAGATGAAGAGCTTGCA
TTACGCGATTTAAATCCGGGACATAAGGAGCCCTCACCTTATGACCTAATCTATGATATTACTTTATATATAAAACCTGT
TTACGATCGTGTTGTCGAGTGAAGCAGGTGAATCTACTGCCAATTTTTCTTTATGAGAGAATAAAGAAAGTCAATACACG
TTAAGAATCCGTCTCCTGTTCTCTCCTACGTAAAAGATGCAAATGCAGAATACATCCCCGATATGTACAGCACCTCCACA
CCACGCTCTGTTATTCTTCTTGAGACTGCTCGATTTCCAACCCGAGAACCGCGCCCCTGTTTTAGTCTTGGCCACGCATC
ATCCCGCTTAGGATAAGTGCTCTGAAAACAAAGTACCGCGTTTTCGAGTTATACACTTTACAGAACCTTTTTCTTCCTGG
AAGCCAGTGTACTGTCGGGTTTTTATTAATCCAATCTAGTCAAACCACTTTAAGAAAAAACTCTCCAGAAACAGCGCCCA
TTTCTCGTTCTTTTCCGACTTAGAATTATGTGTTGTCTATCAATTTCGTCATTATTATCGCAGGTCGTAGACTTGCTCAC
ACGTATGAAGGTAATAGACACAGGGTTTCAAAGCTTTCAAAGAAGAGCGATGGTGTCCGAGTAAAAATGTCTCTAGTCAG
ACGCTAGAGTGTTTTCCGCTTCGTACAGCATTCTTAGTCGCGACGTTTTCACGAATATTTACGGCCAAATCACAAGCTAG
CTTTCAGGCAGCATCAAAACGGCCTTTTGAAAAGTTGGCCCCACATCTTCAAGAGGACACAAAGGCTGATCCAACATAGC
CGAAACAGGTGAAAGAGTGCACTCTCCGAGTAATCATCTAGACCTGACTTGCATCTTAGACACGGAAACATTAACGACTC
TACAATTGCAGTATTTGACTTTTAAGACCCAAAGCACTTTGTGCCTTGTCCTTGTTCCCTGTACACAAAACGGGCATATG
TATCGGAAGTAGAAGCTAAGGAACCATGACATCGTATTGGCATCGTTTTAACGGTAAAATCACAGCGTTTCTTAGTTCTA
GGAGAGGCGGGATCGGCTATAAATATCCGTTATATACCTTTTGTCTCGATATTAAACTCCTCTTCAAAGTGATACACAAT
TAATGCGTTATTGTAACTGTGCTCCAAACCCTTGAAGCCAAATCCAATGAGGCACGACTCGATCTCAAAAAAAAACAAAA
GTGAGATTACGTTCCAACCTTATCGATCATACTAATTGTTATGTGCAACAATGATATACCGTTAAAGTGACACTAGAGCA
AATATGGTCGAGCCTAAGAAGGCATATTACTATGCTTGATTATACTCCACGACATCCGTAGAGTCCTAAGGCCTTGTTAA
GGTCTAGACCATAAATCCTGCCTTCTTAATTTTCTTCACGGGCCTTGCTGCATCAGTACCCGGTCCCAGAAAAATAAAAG
AACTTGCCTCTACGGTCACCAATGGTCCCGTCAACAGCATATTCCATCTCTTTAGCAACTCTGTGGACGTGAATCCAGGT
TTTGGTTCCTTGTGCAAGTCCATCCCTTAGCTCGTTAATGTTTTGCGCTGCCATCGCTCACTATTCTCTTTTCTCCAACA
GACTCACTGTCCCGCTGATGGTGACCATTGTCCTCTACGATCAACGCGTCACTCTACAGTGGGTATAGGAGAAAATTGTC
GCCTTTGGCGGCGACCAGAAAGAGGGTAGTGTCTTTTGCGAGAGCAGCGGCAGCAAAAATGTTAGCCGTCTTGTTCTCGC
CCAAGAGGGCGGACCTCCGTTCGGTGTAGCCATCCTGGAGTGCGACAAGTACGGCATTATCATGGGAAGCACGAATAGGA
ATTCCTCCGGGTTGGAAAAATTAGTCCTAGAAGGCGTGTACTTTTTAGCAACTTAAAACACTTTCTCTTCCGTAGATTCC
CGTGCAATATATATTAATATTTCGGTGCTAGTCTATCTGCTGTTCGAAATACTGCAATATCTGGAACTTATCTGTTGGTA
CAATCGCATGCCTTGCTTGACTATTACATCTTGGTAGATCACTTCTTCGACTTCAGGCCCTCGAAGCCCTCCTGCATCGC
CTCCAGAAGGCGCCAGTCAACGCTATCCTCAGCAAGACTCCAAGCCATGATTCCACCGAGACCACGGGCGGCGATGATCT
CACGGAATTTCCTGGTGATGAGCTCGGGCGTGTCCCAGGTCCAGAACAGATTCGCGACATCGTCGACATACCACTGGCCG
CCGTTTGCAGAGTCGAGTTGTCCGTTCGTGAGAGCGTCCTGGAACGACTGGGCAGTAGACTTGACCGCTGGGTTCGTGCA
GGTCCCAAAGTCGTTCTGGCAGCCAGTCGAACAATGGGCTGTCGTGTTTCCGCACCATCCGTACTGCGAGCAGCAGGAGC
CGTAGGCTGAACCGGTGCACTTGAAGTCGTTCGAGCTACCGCAAGATCCGTCGGTCGAGACGGTCAGTTTGGCCACGTCG
ACCACGACAGGGAAGGAGCTCGCCTCAAAGGTATCGGCACCCGAGGCACCGGTATCGCTGCCGTCAGCGGCCTCGGCAAG
CGCGATCGGGCAACCGATAGGCTGAGTGCAAGTTGTGTTGGCAGCCAAGGTAAAGTACTTGGCGTAGAAGGCAATTCCGA
GGTTCATCTTGGCAGGCTTCATCCCGCGCTCGATGAATAGGTCGATGGCGTTGAGAGAGCCCTTGATGTCGGTGTGGTGC
TTGGTCGTGGTGTCGCGGCGGTTCATCAGGTCGTAGGTCATGACGTTGACGACATCTACAGCAGAGTTGATCAAGGGCAC
CTTCTCGGCCGTGTAGGCCAGCATGTCGCGCTCAAGACCAGGCACGGCAATCGAAAGCTCCTTATCACCGATGGCCGACT
TGATAGCAGTTAGGAAGAGGGGGAAGACCTCGGCCTCTGTGGCATTGTTGGCAATTTGTTTGTAGTCGAAGCCGTTTCCT
CCCGGGTACTCCCAGTCAATATCGACACCGTCGTAACCTAGTCTGTTGAGAGTTGCAGCAATATTGCTGGCGTACAAAGC
ACGTGACTCCTCAGAAGCGACACCCACGCGAAAACCGGCAAGATCACCCCACCCACCGACGGCCATGCTGATCGTCACAT
CGTGGTCGAACATAGCACGAATTTCGGACAGCGGCTTGAAGGGTGTATACTCGCCAACAGGGTTAGTGGTGAAGAGCGAC
GAGTTGGCAAAGGCGGTGATCACGTGTGTGATGCCAGCGGTCATGGTCTTGTTAGGGAGGACGTCGGTGTGATATTGGTC
AAAGTACATGGAATAGCGCGGGGACCCAGTGACGCTGGAGGGTGCCGCTGTGGTAAGAGTGGCCCAGGCGGCCAAAGCGG
ATGTAATAGTCGATAGCGCAGGCATTTTGAATAATTAATGGAGAACAATTAGTACAAAATAAAGAATGAACGTCTCGTGG
AGCGAATCTAAGCAACTACCAGCGATACAAAAGAATGTGTGAATTGCTGATGATGATCATGTAGGCATATGTGTTCTACA
ACAGCGAGCACAGTCAGCTTATATACTCCTTTTCGTACTTTCTACATCAGCTATTCCATCAGGGAGGTATGGAGCAGGAG
GTCCGAGAGGGCGGAGAATTTCGAGAGTCCTGTATGGAATTCCTCGGTTTCGCTTAGTGCCTTTCCAAGGACTTGGGTTG
CACTCGTGATAAAAATACAGGTAGCATTAGTGCGATCCATATTTCGATCGTTGCACCCCGGATTGTCCTAATAATACGGA
ATACGCCTCCCACGGTTGGTCCCGTTTAAGAACGGTGCTCTTCGTATTCCAGCCATCGAATGCTTTGCACAGCATTTTCC
CGCAGCGAGCATCAGCCATTCAGTCAAGGGCAATGACCAAGCAAGGGTCCATGCACTACAGAAGAGCATAATATGTTCCA
ATATCATTCCGCCTATTCCATTGAGTCGTCCCACGCGGAGTGCAAGTGCGCGCCCTCCTTTACTCCGCATGCCCCTCCAG
CTTTGTCAAACCTTCCTTACTTTAGGACTGGCTCTAGATCTGGCCCCAGCTTCTTTCTTCAACGGCGCGTGTGGGGTGAA
GGCATTTCCAGAACCGAATGAGTGAAACGCTAAAGTGACAGGGGTCTGCAATGTGAATTTTAAGTTAGACTACAAATTTT
CAAGTCAGTCGATCGTGGTCGTATCGTACATCTTGGCTAGGGTCTGGAACTTGAAAAACTACAGGACACGGACCTAAAAG
GCTCGCTTGTGTAGCAGGCGGCCTTTCGTTGTACTCCGGATACCGCTCTTTTTTATATTTAATTTGACGAGATTGAATTA
CGCACTCCACTCATCTAGGCGAGGCGTGCATGAGCATATATCTGTCGAAACCCGACCCAATTTAGTGGGTGCTAGGTCGG
TTCTGATACGATGTGCCAATTGCCACTTCTTGTGGCCTGATACCGCCCGTTTCTATCAACTACTTTGTGCCCCATATCCC
GAAGGTCTTAATGTATTGAGAGTACTCCGTATAGCTTCGGACAACCCCAGAAATAACGACATAAAGCGGTTTGGTGGTCC
AAAGACGAGGTGCAAGAGCCAAAAATTGCGTCTTCTTATGCTTTTTTTACGGAGTACAAGCAAGGTGATTGCACACTTTG
TGTCGAACTCTTGGTGCTATTAATAACTTTTTATCATGCTTACTAGTGCAACCTGCTTAGTTTATTGTGAAACTTCTGAA
ACGTCTATGCTCCAATGCGCCAGTTCTTGCCAACAATACGTACCATTCCCTCTTTTACTTTCTTCGCAATATCGAACAAG
TAGCGTGAAGAGGGTGTCCAAAAGTGCAGCTGCACTCTACGGTGTTGGATATTGGTGTATGCACAAATTTGCGCAGTATC
AAAGATGCTGCAATTTTAGTTTATGATGCATCAGGCCTTTATGCCGATGTGGGGGGCTTACTGGTATTTGCGGAAAAAAC
TTTAGAGCTCTGACCCAATACGAAATGTTGCGACAGATGCCTGTTTGAGTTGTTGTGCAATTATTGCCTTCTTACTGCCG
ATAATGACCTAAACAGTACGGTTCCTTTGGCGAGTTATTTTGATGGAAAAAAAGCTATGGACAGCTGTAAGAGTCTTACG
GACCATTACGTCCGTTTATGAGAAAATGCGCAAATAATATAAAACAACAATAGGAGACATGCAGTATGTGAGCTGCAGTA
TCGCACAAATGATTGCCTCACATCGGCTCTAAAAGGTTGAAGACGCAGATACAAAGTAGATAGCTGATTCCATGGCCGAC
TTCGCCTATACAGGGAGAAACTAATAAGGACCACAACATGTTTGCGCAATTGTGTAGCTGTGTTAGAGCAGTTGAGAGAA
CCGAAGCGATGGAAACCAACCTCATGCACATGAAGATAGCTTTTCAATTCGTTTTCTGTTTGGCTATTGTTGCTTTTATA
TGATGCTGTTGCATCGGGCTCACTGAAAATGGTTGCAGAGCAAGATGAAAGCGTGGTAATAAACCCATCCTTGTTTTTAA
GGTTATAAGAACACCAGTATAAACGCACATGGTGATGGTCGCCTTGAGTCGTAATGATAATGTTGGTGACAATCGTAGGT
CGATAGCCGGGACAGCTACAACATCCCCAGTATCGATTATAACTACGTTTCATATCTTTATCGCATCCGAGGGACTAGCA
CTGTGATGCGGCTAGGAAGGTAGTCAACATCACCATTGCATCGAGGTCAACGGCGAGTCCATCTATCTTTTGATGAAAAT
TAGCTGCTGGGTTTGGGGAGAGTATTTTGTCCATCACCAAAAGCAGAGGAGGTATATAGGGGTTTATATCTTCAGAAGTA
ATCGCTAGTGGAAAGTCTCATCGATGTTCAATGTTGAGATATTACAGATCACAATTGCACTTATAGGAAACGAAACACAT
ACGTGCTACCAGTCACAAATCATTTCTACATACACCTCTTTATCCTGTACAGATTAACGTACTATATGATGCATATTGTC
GCTTTACTTCTCCCATAGATAGGTAAAGAACGAGAGACTGCAATGCAGCCCAATGATTTTCTCTAACACTTTTATGCATG
GATATGAAGTCGTACTTGTGCCTACTCAGATGCAGGAGATATGGCAAGTGTCTCGAATAAGTCTAGCCTAATTCCAAATC
GGGGTTTTACCGATTTCGATGGGCCAGTCAGCGTACGGAGTACCCAATAAGAATAAGAATACGCACGCAAAACGCGCTCT
ACGCCATACATAGTAAGTCTTGTACTATGCCGGCGAGAGGACAGCGAGACGTCGTGCGCTGTGCGTGTTCCAAATTAAGT
GGAGTGTAGCACAGGTGTCCTGTGCTCGTACGGAGATACATCCACAAAGCAGGGTGCTATCTGTCAAGCATTGGAATCCG
CCACACTGTGGCCCTTCCGCCCCACTTGGCCGTACGGGCCTGTAATTGGTCAGAAGGCACAAAAGCGGGGCCTGACACTA
GTATTAATACGGATCCCCAGAAGGGTCGCGATGTATCTATTTCTTCCTTAGTACACAACACTCTTTCGCCCACACTAGAC
CCTATTCAGCCTCCTGCTCCTCACAGTGCATCACGTTATATGACCGCTACGTATAGCCTCCTTTAACCTTCACACTATCC
ACTGAAAAGGTCCCTTTGTGCCAAAGCGGTCAACGCACTAGCTATGCAAAGAATGACTCAAACATTATTAAGATACATTA
GTACAGAGCTCTGTCCCGCTCGAAGCCGCTAATGTCCAGGCGACATGAAAAAATTGCAGTCGCAGCTACTTGAGGGTAAG
ATTCAGCGACCAGGAAGCAGTACGGCCCGTCCACCGCAATGGGCCAGAGCGATGCGAACGGCGGAGAGCTCCTGATCCAG
TCTCTGGCAAATGGGGAAAAGAAGGGAGAGAAAAAGGATCGCGGCACGGGCAAGGAGCGGAAGAGAGACCGTGATGCCCG
TTTGAGCATCAGCAAACCGGCGCGCGACCTTTGCGATACACCGGGCTCGAAGAAACGGCGCAGCGAATCGCAGCCGTTGC
AGGAAGAAGGAGAGGGGAAAAAGACGAAGACAGAGGAGAATGCACAAGAGAGCAACGGCAGCGGCTCGATTGCGCGGACG
GCAGACAATCCGTATATTGACTTCGATGGGCTCAGCCGGCCGAGCCGGGGCACGCGTGAGCGGCTGGAAGAGAGCGACGA
GGCCAGGGCGATTCGGCTAGAACGTATGAAGGGCGCCGTGCGGACACTGCTGGAATGCGTTGGCGAGGATCCGGACCGAG
AGGGTTTGTTGGCCACGCCTCTGCGATACGCTAAGGCGATGCTGGAATTCACAGAGGGCTACCAAAAGAACGTGCGCGAC
ATTGTCAACGGGGCTATTTTCCAGGAGGGCCACAACGAGATGGTCATTGTCAAGGACATTGATGTCTACTCCATCTGCGA
ACACCACCTCGTGCCCTTCACAGGCAAGATGCACATCGGCTACATTCCGAACAATGCTGTTATCGGTATCTCGAAGCTGC
CGCGCATCGCCGAGCTGTTTGCCCGCCGCCTGCAGATCCAAGAGCGCCTGACCCGTGAGGTCGCCAATGCAGTTTTCGAG
GTCCTCAAGCCACAGGGCGTGGCCGTTGTGATGGAGTCTAGCCACCTGTGCATGGTCATGCGCGGGGTACAGAAGGCGGG
CAGCACCACCATCACGAGCTGTGTATTGGGCTGCTTCGAGAAGAGGGAGAAGACGCGGAACGAGTTTTTCAGCCTGATCG
GCGTGAACCGACACTAGGATCATTGCTTTCTATTTTTGACCTTCTTTTTGCGTTTGGTAGAGGGCATGGACCTTTCAACA
AGGGTTACGGGAGGGGCGTTCTGCTTTGATTTTCATCATCACACTTTTGCTGCAAATCGTCTCAATTTCCAGGCCACGTA
GTGCCACCATCGCGTGTTACCCGCTTTCGTAACCATGTGTTGCTGTTGACTCTGATGTGATAACGCTCCAGCTACTGGAT
ACGAGACGGACTGCAACTTGAGACAGTAGCCAACCCACTCTTGACGCCCTCTCAGGACGCCCTGGACTAAATTGCAGACA
GTTTCCGACGAGAAAAAAGGAGGAACAATAAAGACAGACTGGTGCCCGCTTGAAGAACAATCAGAGAACTCGCAAAACAG
CTGAAAGCGCTGCACGCTGTCTCGTCCTCTCTGCAGCGGCTGTGCCTTGACGGCTGGCCGCTGGTAAACATGGCGGCCAC
AGCGTCTGCCTTGACCCTAGCCTCGTCTATGGTGGCGAGCACCCCATCCTGGATGGTGCTGGGCGCCGACGGGCCGCTCT
TCAGGAAAGGCTTTTGGGCTGTGGGAGGCCACGTGCAGGCCACCAGGATACAGGACGGACAACCAGCCTTCTTGCTGAAT
TCTAAGACCGCTAACAATGCCGTCGATGCCTAGCGCGCGAGTCGCGTTGATCATAGCTGTCTCCAGCACCTGCTCGACCT
GTAGCAGGCCGTCCCAACGACCTCAAAGCCGGCTTCGTTATGTCCACGCTGAGTTCCGCCCGTCTTGGGCATCTTCGCCA
CGCCAGCCGTGCAGTCGCAACCCGTTGCCGAAGCCGAAACTGTTTTATCTTGCCCATAGCCCTACTCCGTCATTCTGCCA
CCAACAGCTCTCCGTCAGTGATGCTACGGCGTTTGGCAGTGGCCGTGGACGATCGTGCCATTGTAGTACGGCCGTGGTGG
CGTCTTGGTCTGAGGTGAAGACGGTTAAAATGCGGTACGTGTGCAAAATGGCTCACCGTCGGAATCGCCGACGGAGTCAT
GTACTTGTACGCTGGAGTACCTGCACGTGATCTTATGAGTATACGGGATTGCGTCCGGTCTTAGCTCATTAACGTATCCG
CTCGTGCTGGTACAGGGGCTTTGCTGTAGATAAGGTTTATTTGTCGGTCTGACCAAGTGGCGGCCCCGCCGCTGTCATAA
TGAAACTGCTGCGTCTTTAATTCTGCTAGCAAACCAACAATCGATTCCAAATGCCTTCATCTTCTATATCCTCGGCCAAC
CATCCAATGCCCGCCACACCCACCAGCCACACTATCTCAAAATGGACGGCCTTAAGCGCGAGCTCATTTCTGAGGCTTCA
CGCCGCGGACTACCCAACGTGATCGTCTTCACGACCGGCGGCACGATTGCGTCCAGCGCACAGTCGGCCACGGCTATGTC
CGGCTATCAGCCCAGCGTGGGTGCCCGTGGACTGGTCGAGTCTGTGCCCGAGTTGCGTGACGTAGCCAACATCTGGGGCG
TCGAGCTGTGCAACATCCTCAGCAAGGACATGACGTCGGCGATGGCCTTGCGTGCCTCCCAGGCCATCGCTGCCGAGCTC
GCCTACCCTGACGTTGCCGGGGCCGTGCTTACCCACGGCACAGACACGCTGGAGGAGACGGCATTCTTGCTCGACGCCAC
CATTGCATCCTCCAAGCCCGTCGTCCTTGTCGGCTCTATGCGGCCGGCCTCGGCCCTCAGTGCGGACGGACCCATGAACA
TCTTCCAGGCTGTCTCCGTGGCTGCCTGCACAGCTGCTCGTGGCCGTGGCACAATGATTGTGACGAATGAGTAGGTTTAC
CGCGATTCTCTATCTGTCTTGTCTTGTGCCTGTGCCTGTGCACTTGTACTTATATTTGTCCTACAGCCGCATCGGATCCG
CATGGTACACCGAGAAGCACCACGCCAACTCGGTCGACAGCTTCTACTCGGCTGAGCAGGGCCAGCTGGGTGTCTTTCTC
GAGCACCGGCCGGTCTTCTTCTACGGGCCGGCCGTGCCGACGGGCAAGGTAGTGTTGGACGTGACCGCTTGCACAGCACT
GCCACAGGTCGACGTGCTGTTCGGACATCAGGATGCTAACACGGCGCTGATCACCGCTGCTGCTGCCTCTGGCGCTCGCG
GTCTGGTCTTCTGCAATGTTGGCAACGGCAGCTGGAACGCCGAGGCAAAGGCCGTGGCCAAGAAGCTGTATGACGAGACC
GACATCCCCATTGTTTTCAGCCGCCGGCCCGAGATCGGTTATGCACTGCAGCTGCAGGGTGATGATTGGGCTATTCCCAG
TGGCTGTCTGTCGCCGCAAAAGGCCCGCATCCTACTTCAACTATGCCTGCAGGCGGGCAAGACGTTCGCCGAGACAAAAA
GCGTGTTCCTGAGGACCATGGGTTTATAGGTCTTAGTAAATAAAGACAAAATGTCAACGAGTCACTTGGCTGTAAATCGG
TGTGTGTGGGTCTATCCTTCATACTGGCCGGCGACTAGATATCGGCTAATACCGTGATCGGTAACGTGCGATAAAGGACA
GCAGATGCATACTTGCGTCTTTGTCCCATAAAAGATTCCAATCGCGCGCCGAAACTCAGACTTGCCGGCAGCATTGCTTG
AGGGCGCAACCAGAAACACTAGCCCACCCAGAACAGCATGACTACTCTGAGCGACCTCCCATCGGTGACGGGCACGTCCA
GCCGGCACATTAACGTGTTGCTGATCAATCCGAACAGCACAAAGGCAATGACGGAATCCTGTTTGCGCAGCGTGCAGGGC
AGCCTCGCACCCAACGTGCACGTTTTTGGCTTTACCGGGCCAACGACGGGGCCGACGGCGGTCGAGGGTCGGGTGGACGC
GGCCATTTCGGCTGTAGACTGCTTCCGGGCGCTGCAGCCCCTTCTACGAGAGGATGCGGCCGTACAAATAGACGCCTTTC
TGGTCGCCTGCTTCTCGGCCCACCCGCTGATCGCCATGCTGCGCGAGGAGTACGCCCAGCCTTGCATCGGCATCATGGAA
GCGGCCCTGTATGCGGCTCGCATGTGCGGTGACAAGCTGGGAATCGTAACGACTAGCGAGCGCAGCAGCACCCTCCACGG
CCGTTCCGTCGTGGCCGACTACGGTTTCCAGCCGCACGTGTCGGCCGGCGGCGAGACTGGCCACGTGTCCGTACTGGAGC
TAGAATCCAAGCCGCGCGACATCGTCTACACCAGCATCCAAGCGGCCGCCCGCCGCCTGGTTTACGACAAGGGCGCTGAC
TGCATATGCATGGGCTGTGCTGGCATGACGGAGATGCGCCAAGCTTGCATCGATGCCGTTGGCCGCGACGTCGACGAGCC
CGCTGGAGGTCACGGCCGCAGGGCCATGGTCATCGACGGCGTCACTATGGGCGTCCACTTCCTTTCCGCGCTGGTTACCG
AGGATCTGGGCACGGCCAAGGGCGGTGCGTACCGCAGTTCGGCAGCTGGTAGAGCACGACGGGGACAGACGTACGTTTAG
GCGGCAGAGGGACAATGTTGGTTTCCAAATCAGCAGAAATGGACTATATGACAATCAAGATAGAAACAAGGGAGTGACCC
CTGATTCAATTATAGCAATAACCGATTTTCTGTACAAAGGAGCTGGCTGAAGCCGCACATGCAGACCGGGATCCTGAGTA
TCTTACAAACCAGTCGTGATGTCGGAGCAGTGCGTAATAACCTCGATCTAATGCACACTGTATGCTAGCATATCGGTGCG
ACAGCTGTCTGCCCCGGCGAACGGCGGCCAACGGCCGACGTCAGATAATGAGCCCTTATGAACTTGACTTCTGGCTGGTT
GCAATCGCTTCAATCGTTTCAAACTGCCATTCGATACCGCTCAGCAAGAATTCAGTCTGCCCACCCCCACCTACAGCAGC
CCAGCGTGTCAGTTTTCCTGCCGTCCTCCGTGCTCCCGCTTCTCTTAATACTCCTATCTCCCGTCATCTGCCCCCCATGT
CTCGCGTCATAACCGTCGGGGCCGCCCAGCTGGGGGCAATCCAGCTGGTCACACCGCGCGAGGTTGTCCTGACCCGCATG
CTGGCTCTGCTGGATGCGGCCGCAGCTTCAGGCGTGCGGATGCTGCTGTTTCCAGAGCTAGCACTCACAACCTTTTTTCC
ACGCCACAACTTGGCCGGCGAAGACACGGTAGACGCTTTTTTCGAGGCTGAGTCAGATGCCGAGCCAGACGCGCTGCGCC
GCAGTAACCCGCACACAAAGCCGCTCTTCGATCGGGCGCACTCGCTCGGCATCGACATCGCGCTCGGCTACGCCGAAAAA
TGGACGGCTGCCGACGGAAACGTCATGCACTACAACACGCTGTGCTACTACTCAGCTCAGACTGACGCTGTCATTGCCAA
GTACCGCAAGGTTCATCTGCCGGGCACGGCTGTGCCCACGGGTGGCGCCCAGGAGCAGCTAGAGAAGATGTACTTTGCGC
CGGGCGATCTCGGCTTCCCGGCTTTTCGCGCGCCTGGACTGGTGGATAATGCACTGAAGGCCGACAAGGTCCAGATAGAA
AATGCGGAAAAGATAGAGGGCCTCGGCGACCCCATCCTCGGTATGCTGATCTGCAACGACCGGCGCTGGCCTGAAGCCTG
GCGCTCATATGGACTGCAGGGCGCCGAGCTCGTCCTCGAAGGCTACAACACATGCGCTTACTACGCTAACCGGCCGACGA
GCGTGACCGAGCAGGAAGCCCTTGCCGTTTTCCACCACCGGCTCTCCTGCCAGGCCGGTAGCTACCACAACGCTTGCTTC
AGCATCCACGCCGCCAAGGCCGGCAATGAGGACGGTGGCCTGCTGATCGCCAGTTCGCTCATCGTTGCGCCTGGCGGCCA
GATTCTCGCCGAGTCTAAGACCAGCGACGACGAGCTTATCACGGCCACCATTGACCTTGCCGAATGCCGTGCCCAGAAGG
AAGGCGTCTTCGCCTTTGCGAAGCACCGCCGCACCGAGCACTACGGCCGCTTGATCGAACAGACTGGAGTCGTCGAGCCA
CCACTTCTGTCGTGGCCGTTTGGAGCCTAGAGTTTGGATTGAGGCATGCTCCCATATCTGTTGCTCTTCATATACCGGGA
AGGAAGAAACGATGCCAAAAGTATCAAGAAGAAACTATTAAAATATCAAACTGCCAAACTTGAAAGCCGATGCTGCCCAG
CGCAGTCCAATCTAACACTTTATACTATTTTCCCGTCCTCTCTGCTCGACTTCCCGATCTGCCACTCACGGAATAGCGCT
TCTGTCCGACGCAGACTCACACGCATCAGTCCCTTGCGACCGCCGGCGCCCCTCTGGGCCAATCGCAGCGCCCACCTCCA
CCGTTTAGTCAGCACCTCTAGTTCTGTGTGCATCGCATCAAGGTAGTGGCCAGAGGGGGCGCTGTCCTCGACGTCAGGGC
TCGTGCTGCTGTTGGGCGCCTGTGAGCTTCCGACGCTACTGACACTGTTCGCGTGTGGCCGGAGACGCAGCTCGGTCGAG
TCGTCCGGCGAGCTACCTAAGGGACTGCTGGTGGATGGATTAGTAAGCACTAGCAGATGCATGAGGAACGTAGAAGCGAC
TGCAAAATTATGTTTGGACCCTGGCATGTCAGCAAATAATTCGGCGTGAAAAGTCAACAGAAAACTCACAGCTGTGCCAG
AAGCCGTCCCAATCGGCCGTTGTCAGGCCCTCGATGAAGCGCACCAACTCCCGAGCTGACACCAGAGCACCCTTCATGAT
GGCAACAGCACCATCGGTGTCCCAAAAACCCGCCGGAACGGCATCGTGCTGCGCTGTCATGTCCGCCATGGCCAGGGGCC
GCAGCAGCGCACGGAACAGCGCCAGTTGTGCCACAACGTAGGCCAGACGCAGCGTGCCGCTCGTGCTCAAGGCGCCAATG
TCAGCCGCGGCCACGGCAATGCGTGTCGTCTCGTCAGTCTGGCCTTGCTGCCCCCCCGTCTGCATCAGTTTCAGTGGCGC
AGGAAGTGCCTGATGCCATTGTTTCAGCCGTGCAAACAGGTGCTTGGACGTATCTAGCGACGTCTGCAAGTCGCAGCATG
TTCGCTGGGCCGATTGCACAGTATAGAAGGCGGTGTGGATGTCTCGCAGTATGAGGGTCAGGCGGACGAGGTGGCAAAAC
GGAGCACCATCGTCGTCCTCTAAGCTTGTGTGGTCGTAGACGTCTGCTTCTGTCGGCAGCGGCACATCCGCATCATCGTC
GTTGATATGACTGCGCATTCCCTGGCCAAAAGCAGTCCAGGTCTCGGTCACAACGGCCGCCCACCACAGACGTGTTCGCA
GGCGGACCTCCCACCGTGCTAGGGCAGCCCAGCCAGCAGCAGCATTACGATGCAGGCCCAGGGCCTGGCAGTCGGCCACC
AGCACGGCGCACATGCGCCAATGTGCCGCGGCATCGCCAAACAGGTCGTCGCGTGGTGGCCGTTGCAGCACCAACAGCGT
GGCCTGCACTGTGGCTAGACGTGCGTCGTGGTGGCGTTCCAAGTGCAGGGCGTCACAGGCTATCCGGTGGATCTCGCTAG
CATCCGGCACCGCTTCGCCCAGGACGCACAAGACATCATCGTATATGACGAATGGAAGCGCCGACGCACAGACGGCCGCC
AGCAGCGACAGCGGCAGCTCATCGACGGCGCCATCGGTCGCCGGCATCTGCCGCCGGCTCAGCACGGGAAACGATGTGCT
GATGAAACGGAAGAAGATTCGCATCAGCTCGCGCGCCAGGCTGTTTGGCACGAGGCCGCCAAAGCAATGGCGCAGATGAC
GGAGACTGTCAAGCTCCGAATCGAGCCTGGAGTGTTCAAGCTGTGCCACATCGCCGACTGTGAATACAGGCGGTGGCTGG
AACTCAGCTAGGCCCGTCTCCAACGACTTCATGTACTGGTACGTGACGCCCGTGAAGGGCGACTGCGATTGCAGAGACTC
GTTGCACCGTCTCCGAGCGATCAGATACGCGTCCAGCTCACCGGCCAGGCCGACAAAGCGGCAAGGCCGGCCGGCACTGT
TTTCGAGGCTGACGCGGCTGCAGCTGCTGTCAACGGTCTGATTGACGGCATTGCCATGTGACAGTGCAACAGATGGCGAC
CGGTCTGAACCTTTCAATACCTTTGGCGAGACGGCCTGCCGACTGGTCAGCTCATTGTCGAGCAGCGGGTCAGCGGTCGT
GTCCACGTCCACGCTCAGGTTCAGGTCTTCGTCCTCGCCCTCGCCATCAGGTTCTCCCTTGCCATCTGGACTGCCCATGA
GCTGGGATCGGTGGAAGATGACGGGCTCCACAGAGACGTTGTCGTCTGTGGTTGCGGCAACGATGGTGTCATTGGTGTCG
GTCGCAGAGACCGCCGACGGGCAATCGCTTAGCAATCGACGACGGGCGCCGGGCCCCTTGACAAAGGTGCATTGCAGTCC
TTTAGTCCGGCACAGATCGCAAGGGGGGCGTGTCGTGATGACACAGGCTGCCTTGCGCGACCTACAGAGATCACAGGGCC
GGTTCCGTCTGGACTTGTACTGCCTTCCGCCACCTAGTTCTGGCATGTGGGTGTGGTGGGGAGTGCCCGAATGTCGCCAA
GACTAAAGAGACTGGCCTGCGGCCAACAGTCTGCTCGCGACGACGCCACAAGCACAGAAGTGGAACTAGCTGAGACGAGG
TGCCGGTCTTAGCGGCTGTGGGAAACAAGATAAGGCGGCGAAAGGGATAAGAATGGAGATTTGCATCGAGTACGGCTGCC
GGGCGATTCTGGTCGGTGGGAAGAAAGAGGGCGAAAAGAGGAAACGAACGATTTAGGGGGAGATAAAATCTAAGATAGTG
AGATAAGACATGCCTCCTATCGACAAAAACGAGCTAGGGGGCCTAAGGGGCTTTGGAGAGGGAGGAGAAATGCAGTAGCA
GCGAAAAAGTGGAGATACTGTGGAACGCACGCGGAAGATTGGCAGGAGGGAGCAAGCCGAGAGGGCCAGGGAAAGCGCGA
CGGAAGGGACACAGGAGAGGGGGACGGGAAGGCCAAGTGCAGTCATCCGGGTACAATTCCTAGAAGACAACAAACACGAC
ACTCGGGTCTGACAGTCCTCCTGCAATCACAAACGCAGAAACGCCTCGTTCAGCTCGGTCCGCTCAAATGGGATAAGGCT
GCAACGCCTGCTGCTTGCAGACCGGTGGTCGTCGGGCATGCCAACGAGAAAGCCGAGAAACCAGGCAGATACCCTGAATC
CGAAACTGAGAGCTGCGTTAGCAGTACAACCAGACACACTGGTGGTGATAGCCGGAGCTCCCCACCCCAGCAGCAGTGCC
ACTGAGCTTTTGCAGAAGTGGGGGATAAGCTGTGAGGCCAATCAAGATGTCGCCATTGGCGGTCTCGCCTTCCACCCGGA
AGCTGGAGGGCCTTTTCCATAGCGAGGAGCACGTATACCAGCGTCATCCGTTCGCAGCCAAACTGCCGCCGGTATAAACC
GACAGGGGCCGCATCGCCATTGTCTCTGTGCTTCCTTGCCTCTGACTCCGCACCTGTCTCTGTTCTTCTGCCACGGCCCA
TCTGCCACCATGGAGCTCATCTACTACGCTATACTCGCTGGCGTATTGCTGCCGGCCTGGTTCATGTCCTACTGGATTGT
GCCCTACTTCACCACCTATGCCCACCTCAAGCACATCCCGGGCCCGTTCGTCGCAAAGTTCAGCAACATCTGGCTGGCCA
CTGGAGCCCATGGCGGCCAGAAGTTCGTCTGGGTCGACTGGGCACATCGCAAGTACGGCAAGGTCGTTCGTGTCGGCTTC
AACCATGTGTCCATTGCCACACCAGAGGGCCTACGCATCGTGTATGCCCATGGAAACGGCTTCCTGAAGGAGTAAGTGTC
GGACGGTCCCAGTCTGGAGATGCTCTCGGGAGAAGCAACGCTTGCTGACAGGCTGTCCACCAGCCACTTCTACAACGCGT
TTGTCTCCGGCGTGCCGGGCGTCTTCAACGTGCGCGACCGCACCGAGCACGGTCGCAAGCGCAAAATCGTTGCCCACGCT
TTCTCGCCCGGAGCTGTTCAGGATTTTGAGCCGCATATGACCAACAACCTGGAGCGCTGGGTAGGCCAGCTCGACAACAT
CGCATCACACCCCGACTCACCCGACGGATTTGCCAGCATTAACATGATGCCATGGTGCACCTTTGTGGCCTTTGACATCA
TTGGCGACCTCGCCTTCGGTGCGCCCTTTGGCATGGTCATGCGTGGCCGCGACGAATGCGAGTCCACTATGCCCGGCAAG
GCCACAATCTATGTTCCCGGTGCCGAGACGCTCAACCGCCGTGGCGAGGTCAGCTCAACCCTGGGTCTGCTGCCGCAAAT
CCGGCCTTTTGCCAAGTACCTGCCCGACCCCTTCTTCTCGCGGGGCCTCCAGTCGGTGGCCAACCTCCACGGAATCGCCG
TTGCCGCCGTCGACAAGCGTCTAGGCTCCCAAGACGCTGCCGAGAAGGGTGGTATTGTCGCCCAGGGCCGCCACGACATC
CTCGAGATGCTGTGCCGCGCTAAAGACGGCAGCGGCCAGCCCATCAAGCGCGACGAGCTTATCTCCGAAGCCCTGACGCA
GTTGATCGCCGGCAGCGACACCGTCTCCAATACTGCCTGTGCCGTTACCTACTGGATCCTTCACGGCGAACGGGCTAAGC
CCGGCTCTGTTCTGCCCCGCCTGCAGGCCGAGCTTGACGCCGCCGTTCCTGCCGGCACCGCCGTCGCCTCTCACGCTATG
GTCAAAAACCTCAAATTCCTCCGCCAGTGCATCGATGAGGGCATGCGTCTGCACTCCACCTCCGCCCTCGGCCTGCCGCG
CATCGTCACCGCACCCGAGGGAATCGACTGTGAGAACGAGCACTTCCCCGTCGGCACCGTCCTGTCCGTTCCCAGCTTCT
CCATCCACCACGATGCCGACATCTGGGGCCCCGATGTCGAGGAGTTCCGTCCCGACCGCTGGCTGGATCTCACCCCGCGT
CAGCGCATCTGCTTCAACCCCTTCTCCTTTGGGCCCCGTGCCTGCGTCGGCCAGAACGTCGCACACATGGAGCTGGCCCT
GATAATCGGCACTGCCTTCCGCCGCTACGACTTTAACCTGTATCAGCCCCAGCTGATGTCGCATGAGGGCTTCAGCAAAA
AACCTGTCGATTGTTGGGTCGGTATTCGCCGACGTAACTGACCGGCTAATTATGGATAGTACTATGGCTATCTCATGATG
GATGACATAGGATTTCTATGTTGGCTCCGGACGTAGACGTCCATTGTGTTGGACCCTGGGAGATTAATCTCACGTGTCTA
CACACGCTGTCTTGGACTGCAGACCAAGGGCCCAGAAGAGCCGAGCTACTGTCTTGTACAACTACGGGGGTATATCGGAT
CCGAAGAGACGAAAGCGAACAGATTCAAGCTTACAGGCATTGCACGTTAAAGGTGGGGGCAATGAGGTAAATTCCGCGTT
TGCGGGGCGTTATACATCCATTGTGCAGATCTGGTTCCAAATCAAGAAGTCCGTAACACTAGATGTATCTATCTTACATA
CGTATAAAACACCCCGGCCGTAATTCGTCTCCCACTCTCAAGATTGCCATTGTGTCGAGATAAGAATATCGCAGAGAAAC
CAGTCAATCGGGACAGCGCTAACGTTTGTCAGTGGCCTGATCTAAAAAAACGGGGACAGCGACCAGTTGACGAAATTAAA
TGCCAAATTGTAGATACAATTCCTGGACACTAACGCATTAGTCCTGCCATATCTTGACAGGGTCTGTGTCGCACTACATA
CTCGTTCATCAATGGACCTTCTCAAACCTTTTTTGTAAAACCGTCCCTATCCGTATTTACCACGAAGATGCCCTGAATGC
CAGGGAACGGACTACATTGGTAGATGTCGAGGTATTAAAGATATCTGGCTAGGCCCCTGGCAAACGGGTCCCGATACATG
GTTAGAGTGTATTAGGCCATACCAAGGATGAGGTGAGTTGTACGCTCAAAAGGGATAACAGCGTACGAGGACGGCTGCAT
TACCACCCTAAGTCGCTACCAGCGAAAAAGACGATCCGTCTGTCAAATCAACGCATTTCCAGTGCAACCTGCCCTTTTAT
ATGGGGTGCTAGTTTAAGGAAGCCACCGTTGGCGACAGCCGGTACGAATTTAGGTTTCTGTGTAGCTTCTGACAGTGTGT
CCAAATAAACATTCGGCTTACTCTGGCATGCCTGTCAAAATGTCAACATTGAATATCTTACAAGGTCTGGAAATTAGATA
GGATCTACAGTATTGTTTAAGAAAGAGTTCGTGTGCTGTTGGCGTTGGCGGAGAGTTGTATAGAATGGCTTGGGTTAAAG
AACCTACGGGTAGTGCGGGGCACGTTAGATGATATAGCCAGAATTGCCTTAAAAAGCTTCCATGATTATAAGTCCGCCAC
CCCCCCTTTCGACCAATAATTACTTAATCCACGCACATCTTTTATTCAGTCTTCCTAGACTTCTTCACTAGTTACATAGT
GAAAAACATGCATGAATCTATTTATAGACTCCGCCTGCATCTCCCTAGCCGTGTTTTCCGGTTAAATTTCTCTTATAACG
CGCTCTTTAACCGCTATAACCTCTTAAATTCGTATAAACCGCTTATTCGGCGCAGGCTTTACTTTACAGCGCTTACTAAC
CTTTTGCGCTAATTATAATGCCTTTAGCTTAGTAATTCGCTGCTTTTAAAAGGCTATTATAGCTGTTTTTAAATTAATTG
CGTAGCTAGCTTTATAAAGAAGGCGCTACGTAAACTTATTTAAGTTACTCTCTTTCTTTACTAGCGTAATCTGCTATAGT
ATCTTTTAACCTATAAATAGCGTATTAAAAATAATAATGCTAGATTAAGTATAGTATAGAGAAGTTATATAAAGTATATT
TAAGGTTCTTAGCATAGCTAAAGCATATAGCCCTTATAGTAAAATAAATAGATTTAAAAGTTATAAAGAGTAGTGTACAA
TACATAGTTATAAAGGCTTAACTAGTTTATACTATTGTATTAAGACTTTAACTTAACAAACTATAAGAGACTAGTAGGCA
AAGGCCTGCCAGCTAATATATACATAGCTAAAAGATGCAGTATAGCGCAACCCTAGTAGGGCGTGGCACAGCTAAGTAGC
TATGCTAGTCCTGTACAACGTGTTAAGATAGTTTGTAAAGTCTGTCGCTTAGTAAGTAACTAGTTGCCAAACCGGTGCGT
AGGGACGCGTGTATAGAATACCCTTACACTATCCCTCCCCTCCCTAGGTAACGCCCCTATTAGCCTAAAGGTGCACACGC
AGTAGCTACTTGCATATTAAAAAACCTTCTTTTATAGAGTTAGGAAAAAAAGTTAAGCGCTCTAGGTTATTAGCTATTGC
CGAGCAGTTGTAGACTACTTGCTTATACGATTACATTTAGGTAATGTAGAAGCGCACACGTACTGCTTAGTCTATAGCAG
TAGTAAACGCTAGATCCTGCCTAATGCACAGGTTGTCTTGTTTGTTAAAGCTTTTTAGAAGGCGTGCAGCTTAGATCCTA
GTTAGGGAACGCTTAAGTTGCTGCTAATAGGTGTTATAAAGGGGCTAGCCTTAAACACTAAGTGTATAGGGGTATAGTGT
GCGCTAACTAAAAACGGCGGCGTAAGGCTTACAACTTTTAACTACTAGCAAGGTAAGATAAAGGTAATAGCGGCCGTTTA
TTGCCTGCTAATTTGTAAGGGTATTCTATACACGCGTTCTTACGCACCGGTTTAGCAACTAGTTGCTTACTAAGCGACGG
ACTTAACAAACTATCTTAATACGTTGCATAGGACTAGCATAGCTACCTAGCTATGCTACGCTCTACTAGGGTTGCGCTAT
ACTGCATCTTCTACCTACGTATATATCCTGTCTCAGTCAGTGCTCTTTCGCCCTCACCTCACCCTCTTTACTCGTTTTCG
TTCAATGCTTAAACGTTCTTACATATCAATCACCTACCAAATCCGCGTTTCAACGCCCTTCTGTACACCTACTGCAGTTC
GCATCATCTACACCTCTTTTCATATTTCTCTTACACCTTCATACTTCCTATTAAATGAGCTACATGTTCCTGATTCATAG
TGGCCGCGCTACTTCCGCCGCATTTAGCATCCGCAATACTATGTTAGACACGCTCAAGGTACGCTGCTTATATGCACACT
CTCTCCTACTGCCTAATCGCACTGGCCACGCCTATACTCTTCGCTGCCGCAGCCATCTTATAATTCTACTCTTCAACCCT
TACTCTACTTAATGTTCGGAATATAATGACTTAGTACTATTATGCCTGCTCTAACTAACCACCTTTCGCCGCGCCTATAA
AAGTTAGCATGTACAAGCCACATAACATATCACCTTATTATATCATATACAACGCTTAAATGCGTTATTACACTTAATAT
TTATATTCTTGCAATGGTGTTCATAGTGGCTTACTCGTCCTCTGCTAGTTTGCCTATCTATTAATTAATACATGCTTACT
TATTAATCATAACCTATTAAAGCAGGTCTCAGATAATCTAGTTGCCCTTTTACTTATAATAGACTAAACACAGCTATCTT
ATCACAATCGTGTTAAGTCGTGCCACATGCTGTAATCTACTAAAGGCTTTAAACTTAGTTTTATTACTCATTTATTATNT
AATGACTTATTAACTTTCAACATAACCTCATACTCAACGACCTAGCCAACGCTAACAAGCCCTTGCCTACGCTCAATCAT
AATATTATATGTCCATATATAATACTATTATATAGCGCGAATCCTTTAGTACAAAGTTGTAACCAATACAGCTAACTTAG
CCTCATGCCCAGTTCCCTTATGCCAATTATTGTTAACGACCAGTTTTCGTTAAACAATCAGAAGGGTACTTACTTAAGGT
AAGGCCTACGGTACCGTTAAGGCCACTGCAAACGCAGGTATCCCTCCTTACTCAACAAGCGAACCAAGCCTTTTCTTCCC
AAAAACCTAATTCCCTTGCCTTTCTACCCTTCTTAAGGAAGAGGCAATACGGCGCCTCTTTTCTTTGCTACCCTTATCCC
TCTACCACCCCTTATTTGCTCCCACCACTATGGCCTCATTCTCTTGTTTTTCTACTCTATCCCCGCGCGTCTTTCCAACC
TTTTTTTCGCGTCTGGGTCCCCGAAATCGTGTCTTCCCCACCCCTTGCGTCCTACAATCTCCCGCTTTTCCAAGTCTTAA
ATAGTGTCATACCCCTAATTAGTTCCTGGCCCCCCCCCGTCGTTCCCGGTGTTTGGGCCGCCCACCTTCCTGGCTCCTGC
GCTCTCTCTTTCTCTTCGAGAAAGGTCTCTTTATTTATTCCCCCTCGCCTCTCCAGTTCCCCATTAATTTCTTTTTTTAT
ACAAAACTATCTTTATAAAAACAAACGACTTTTTTTTTTTCTCCCTCTCTCTTTTTCTCCTTCCGCACGCCCTACAAAAA
AAGGAACTTCTTCCCCCACTCCCCTCTTCTTCGTCGTCGCGTCTCTCTCTCCTCTTCTTTCTTTGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTGGTTTGTTACTGTTGTATTTAAGAC
TTCAACTTAACGAACTATAGGAGATTAGTAGGCAAAGGCCTGCCAGCTAATATATACGTGGCTGGAAGATGCGGTGTAGC
GCAAACCCAGTGGGGCGTGGCGCAGCTAAGTGGCTGTGCTAGTCCCGTGCAACGTGTTAAGATAGTTCGTTAAGTCCGCC
GCTTGGTAAGCGACTGGTTGCCGAACCGGTGCGTAGGGACGCGTGTGTGGAATACCCTTACAATCTACCGCGTACTAGTA
AGGCTAGTAGGCACGGTTTGCAAGGTATACTTAAATAACATTTTAATCTACTCCTAGACTAAGAAGGAGTATAAGAAGCA
CTTTTAATTAGTTTTTAAGCGGCTAGAGGCTGCGCAGCTATATGCAAATCTTAAGAAGTGCGAATTCTTTAAAGAGGAAA
TTAATTTCTTAAGGTTTATTATTATTATAAAAAAGCTAGCTATAGACCTTAAGTAGGTTAAAGCTATTGCTGATTAAAAG
GCTTTTAAGTGCGTATAGAACGTGCAATTCTTCCTAAGGTTTGTAAACTTTTATAGACGCTTTATTTCCTACTACTCTTA
TATTATATAGGCTTTAATAAAGTTAATAAAGATAGGCCTTAGCTTGCTATATAAGCGCGGAGCCGTTGTTACGCAACTGT
TTGTGTTAACTAAAAAAGCAAAGGTTGCTTTTAAATCGCTAAAGATAGCATTTATATATAAAAGTATTCTACACATGCGT
CTCTACGCACCGGTTTAGCAACTAGTTGCTTACTAAGCGGCGGACTTAACAAACTATCTTAACACGTTGCATAGGACTAG
CACAGCTACTTAGCTGCGCTACGCCCTACTAGGTTTGCGCTACACTGCATTTTCTAGCTACGTATATATTAGCTAGCAAG
CCTTTGCTTACCAATCTTTTATAGTTTATTAAGTTAAAGTCTTAATACAATAGTACAAACTAGTTAAGCCTTTGTAACTA
CACATTGCACACTAGCCTCTTACATTCTTTAACTTTTTTTCTACAAAAAGCAATGTCTAATTATAGGGCGGCCACTCTGC
GATTAGCACGCAAACTGTTAAAAGCTAAGAACGTGCTAATGCTACTCCTTACGCTAATGCACGGCAGCCACACTTTGCGC
GCAGCATCTGCAAGCACCCTAACCCTGTCCGTCGAATTAGAAACAAGACTAGTACACGTGCCGCTTAACGACACCTTGCC
GCTTAACAACACCTTGCCGGCTAAAAAGCAGCTGTAAAGCGATGAATACACTTGCATTATACAGACGCTAGAGGCACTAA
CTAACATTATAGCTGTAAAGGTTATAGGGCTATTGCCTAGCAGTTGCTACCGTAACAACAAGCCACTATAATATAGTATT
AGAAGGTTAGAAATTAGTGCCTTTGCTATAGAGACAAAAGAGTAGTTAGCAACGATAGAGGACGCCTACAACACTAATGC
ACGCAGCGACGCGTTGGAAAACATAAAGATTATTTAGGTAGGTAGTTAGCTAACTACTACACTAGCGGCTAATTGGCGAA
AGCACTACGACCGACTTTACGCTAGTAAACCCTTAGTTATACGCTGTATATAGACGCGCTTTGTTGCGTTTATTTGTTGG
GAACACTTAAACTTTAAATTCTAGATGCACTGCATTTATAAGGAAAGCTAGACGCTTTAGTAGGGCAGCAAGTTGCTGAT
AGCATACTAGCGGAAATAAGACTACTTGCAATAAAAGATTAGCAACACCTTTAACTAGGCAGGCAAAATTGCTTAAAGGT
ATTAGCGAGGGCTTAACGACTACTTAGCAAAGTAGTATTAAAATAAGACTATTAGCAAGTTTTTTAGTATAGTAATAAAG
ATTGCTAATGCTTGCAAAGAGTATTAGTCTTAAGGCTAGGAATAAAGAAAAAGATAAGATGACTAGAAGCGGGCAGTTAC
GGTTAATAGCGTGCTAGCTAGTAAGCTAATAAAGAAATAGCGTTATAATAATAATAAGATAAAGAATTGTAGTCTTATAA
AGAGCAACCTAAGCCTATAACTAGTTGCTAGCTAAGGTTAGTCTACTTTTTAACTTGCTAACTTTAGTAGTTTAAACAAT
ATTAACGTTGCATTAAAGTGCTAGAATTATAGCAAAAGTAGGCATACCTCTTAAGAGTGCTTTAAGCTTAAAACCTGCAT
ATAAGTTAAGAAGCTTTAAGTAAAACTAGAAGATAGTCTTTAAAAGCTTAACAACTAAAAGGCAACCTACTTTAACTAGG
AAAACTAGTAAGGTTAACAAAAAAGCCTTGCTTTTTATTAACCCTACTAGTATAGCTAACTAAGAATGTAATTCTTTACT
ACTATACCCTAGTTAAAGCATAGATGCTTAGCAATTGCTAAGCTGCTATTGTTGCAAACCTAGATTCTTATGCTAACTTA
AACATAGTTAACTTAAAGGTTGTTTAACAGCTTAATTTAAAGCTGCTTTAGTAGCACTTAAACTTAAACCTAGTCTTTAT
TAATAGGAAAGCATTATAGGCTTACAGCTTATATAAGCTAACTATTATGCTAATAAAGAATAGAGTCTTTTGCGCGTTAA
TATAAGTCTTTATAGCTGTTTGCTAAGTAGGCGCTAACTATAAAGACATTATCCTAAGTTATAAAGAACTAAGGTTTCTA
AGCGTTGTTATTAATACTGTTTAACAGGCCTAGTTATTCGCTATTATAGTTTTTAAGACTTTTAAGCGAATAAGCTAACG
CCTATGCAACGGCAAAGAGTTGTTTGCTATTTGCTTAACGTAGTTAGATTTAAGTCCTTATAAACTAAACATTCTTACTA
TAGACAATAATCTAGCTTTACCGGACCCTAGCTAGCGACCGCCGTTCTATATACAACTGTTTGCCGAAGTGTTTAACACT
AATAAGGCAAAGGAACTACTCTTGTTAATAGACGCAAAACACCCGATTAAGCTAAAAGACGGCGTAAAGGTGCTGTATAG
CCCTTTATACCTGCTGTCTTCTGCCTAGTAAAAGGAGCTTTGCCGCTTTATTAACAAGTTATTAGCAAACAAGCGGATCG
CTTATAGTAATAGTCTAGCTAGAGCCTTAGTAATCTTTATCTTAAAGAAAGACGGTACTCTTTATATATACATTAACTAC
TAAGGTTTAAATTAAGTAACTAAGAAGGACTACTACCCTTTCTTGTTAATTAGTAAGCTGCTAGATTGCTTAGATAGCGC
AAAGGTGTTCTTTAAAGTAAACATAAAGAAAGCGTACTATAAGATTTAGGTTAAGGCCTTTAATTAGTAGAAAACTACTT
TCTAAATAAAATACAAGCTTTTTAAGTTTTATATTATGCCTTTTAGACTAACTAACGCGCTAGCTATATTTTAAGCATAT
ATCTACCGCGCACTAGCAAGGCTAGTAAGCACGGTCTATGAGGTATACCTAGATAACATCTTAATCTACTCTTAGACTAA
GAAGGAGCACAAAAAGCACCTTTAATTAGTTTTTAAGCGGCTAAAGGCCGCGTAGCTGTATACAAATCCTAAGAAGTGCA
AATTCTTTAAAAAGGAAATTAATTTCTTAGAGTTTGTTGTTACTATAAAGAGGCTAGCTATAGACTTTAAGCAAGTTAAA
GCTATTGCTAATTAAAAGGCCTTTAAGTGCGTATAAGACGTTGTAAGGGTATTCCACACACGCGTCCCTACGCACTGGTT
CGGCAACCAGTCGCTTACTAAGCGACGGACTTAACGAACTATCTTGACACGTTGCACGGGACAAGCACAGCCACTTAGCT
GTGCCACGCCCCACTGGGGTTGCGCTACACTGCATCTTCCAGCCACGTATAAATTAGCTGGCAGGCCTTCGCCTACCCGT
CTCCTATAGTTCGTTAAGTTGAAGTCTTAATACAACAGTACCAACACGTTTAAAGCCTTCGTGACCACACATTGCACACC
AACCCTTACAGACGTGCAATCCTTTCTAGGGTTTGCAAACTTTTATAAACGCTTTATTTCTTACTACTCTTGCATTGTGC
AAGCCTTAATAGAGTTAATAAAAACAAGCTTTAGCTTGCTGCGTAAGCGCAAAGCCGTCGCTACGCAACTGTTTGTATTA
ACTAAAAAGGTAAAGGTTGCTTTTAAATTGCTAAAGACAGCATTTATAATAGCAACAATTCTTTGCTACTATAATAACAC
AAAGCCTACACAGGTAGAAACGAATGCGTTAGGCTACGCTATCTTTAGCATTATCTCTTAGCTTGCGGACAGTAAGTAGC
AACTAGTTGCTTACTACTTGCGTAAGCTAACAGCTTATAAGATGCAGTAAGAAGTAGGATAGTAAAAGCTTTTAGCTATT
ATTAAGAGCTTAAAGCACTAGCATTATTATTTAGAAGGTTTAAAGGACTTATTTGTAGTCTTAACTAACTACTAGGCTCT
AAAAAGCGTTGTTAAGGCATTGGCAAAGGATCTTTAAAACTAAATTGCTTAATAGGTATTTTGCCTTTTAGCGTTTAACT
TTAAGATTAAGCACTGCCTAAGGTCTACCAACCTAGCAAACAGTCTGTCCTGCCGAGTAGACTATATAAAAAGTAACATT
ATATATAATAACATGCTTCTTTTGCTTTTTAGTAAGCTATAGATTATAGACTAGTCGTTAAGGCTCTTTATACTAAAAGC
TTTATTGTTATTAGTATAAAAGGCGCAGGTTACTACTAGCTAAGAACAGCTATTACAACCCTAGTGCTTCTTTAAACTAT
ATAATACTATTTGCAACGCTTAAGGCTAAGACTAATTACTAGATAACTTGTTTGCAAAAGCTAAACAAAACTAGAGGAAC
AACACTTATTATTTATAAAAAGAGAACACTTTGTTCTATAAGGATTGCATTGTCGTCCTATTAGCAGACAAGCTGCAGGT
AAGGCTAATTAGTCTACACTACAACTTTTTTATAGTAGGCTATATAGAAGTCTATAAGACTGTAGAACTTCTTACTAGAA
AGTACTACTAGCTAGACATAGCTACTAACGTTTGTACGTTTGTTGTAAACTATTTGTTATACATAAGCAATAAGGTTCTA
TAGGATAAGCTGTATAAATACCTTTAGTCTCTACTTATGCCTATTTAGCCATTCTAGCACATTAGTATAGATTTTATAAC
TGGTCTTAAGTTAAGCCTAGGCTTAGACGGCTGTTTGTACAACGCTATCCTAGTAGTAGTCGATTGCTATACAAAGCATA
GTATGTTTATCTCTACCTAAAAGATAGTTATGGCTGCTAAGGTTGCCTAACTTATCTACAACTATATAAAGACTAAGTTT
AGTATCTTAGAAGTAATTATTAGTAATAAAGACAGCCTATTTACTAGCTAATTTTAGCAAAAACTAATGCAACTTTAAGG
AGTCTAGCTAATAATGTTAACAGCGTACTACCTATAAACAGACAGTAGCACTAAGATCTTTAACTAAACCTTAGAGCGTT
TCTTGCAAACGTTCTACGGTTGTTTGCAACACTAGTAGATATAAGTGTTAAGTATAGTAGAGTTTGCGTACAACAACGCT
TGCTATACTACAACAAAGACCTTTCTATTTTATACGTTATACGTATACCACCTTTGTTTTATAGACAACTTTCTCTTTAC
TAAGGCCGCGGTAAAAGGCGTGCAAAAGCGTATTAGTTAGCTATAGGCTGTTTGGCAAAAGCTAGAAGTGTTGTAAGAAA
AAGCAATTTGCTAATAAAAGAAAGGCTACAACAAGCAACGCCTATATAAAGACTTTATTAAAGGCAAATTTATAGGTTTG
TTAATAAAACACTTAAACTTAGCTAGCTTAAAGAAGCTAAACCTAACCTTCTTACGCGTTTGCATTATAAAGAAGCTAGG
CCTAGTTATATATTAAGTTGCCTTGCTATTATAGTACGCACGCTAATATAACGTGTTTTACGTCTTTTGCCTTAAGCTAT
AGACTGCTATAGTAAAAAACGGGGAAGAGCTTTCGTTTTTAGAAATAGTAGAAGACTAGGAGGAGTATAAGGTTAAAGAT
ATTATTACTTACCTTAGTAAGGGTTTGCAAACTTAGTTTTTAGTAAAATAGAAAGGCTAGCCGGCTAAGTATAATACCTA
AGAACTTAAAGAGCACTTAGCGCACGCTAGCTATAAGTTGCAGTCTTATTAAAAGACTGCAAAACACACTTATAAGAAAT
AAGAAGACTATAAGGCAATAGCTAGCTGTATGCTAACTAATTGTTAGTTAACTACTCTGGCTATTTTTTGTGTAATTGTG
CACTATAAACTACTTGTTCTAGCTTTAAGGGCGCTCTTTAGAGCTACAAACCTAAAACATACTATTGGTAGGCTGTTACT
TAGCTACTAGCTACTTGTTACTATCTTTCTTTGTAGACGTTCTCTTTACTCTCTTGTCTCTCTTCTTAACACTATCCTTC
TTGTCTTTCTTCTTGCCGCTAGACAAGCCTTTGCTAGCTGGCATATAGCTACTACTAGCCGTTAACTAGCCGCTTGCTAG
CGCACTCTTACTAGATGCTGCTTTACTACTACTACTAGCTGCTGCGACCGCCTTACTACTACTAGCTATAGCACTAAGAA
TAGTCTTAGCGCTACGCTAGCGCTTAGCTAAGGCTAGTAACTTAGCGCAAGACTGTTGCTTGCTAGGCGCTGCTAAAGGC
AGCGGCTAAAGAAAGACTACTGCTTAGTTAATCTAGGCTAGCTTAACTAAGGCCGCTATAGTCTGCGGGATCCGCTTAGG
CGGCCCTTCTACTCTTATAGTGTAGTAAATCGTGCCGCTATAGCTGGCTTAGATAGTTGCAGCGTTCTAGGCTAGGCTAA
GCACGATGGAATAAGGATTAGCCTAGGTGACAGGTTAACAATAACTTAACGATAGGGATTAAGAGACTTGCTATTGCTTT
AAGAGTAGTAGCAACTTAGGTCTACGCTTACAATGGTATGCCTATGTCTAGGGATGTTAGCGGTAAGAGCTAGGCTACCT
TTGCCGACCGTTGCGCAGGCGTTAGGGTAAGCTTTATCTCTTGCTAGTACTAGTAGAGGACACTAAAGCGTAATACAGCC
TATTATGCTATCTTAAAACGTTCGCGCTAGGAGCGCTAGTTGGTTGCTAGAGGCTTTAACTTGTTTTTCTGCAAGGCGCG
GCTAAGTTTCTTAGTTATTGCTGTTAGGGCTATTAACCTTTAGGCGATTGCTGTGTAATCGCTTAGTGCTGCAATAATAT
TGTTAACTATTATCTGCTAAAGCAGCAACTTGTTTGTGCTAGCTAGAAATTCTTAAATGTATTAGGCTAAGCCTTTAATC
TCTTTAAGAAGCTATTAGTTAGCAATTAGCTACTAGCGCACACAAGTTAACGCACTTACTAGTAAGCATAATATGTTGTT
AGCTATATAACCAACGTAGCACGCTAGGTTCTTTAGTGTAGCTATATATAAGAATTTGTAGTAGACGTTTAGATAGGCTT
TAAAGACGTAGTTTAGATATAAAGCTTACTATAGAGTTAGCTATTGCTTAGCAAACGCTATGCTAGCAAAGACTTACGCT
TTTAAAAGATAGTGCGTGTGCTTAGGAAGGGCGTTTTATAGGGTTTGCATTTATAAAAAAGTTTATTAAGACTTAGGAGC
AGCTTTAGTTAAACATTGTTTATAAGCAATCGTTAGCTAGCCGTTGCGTAAAGTTGTAAACTATTATATCAACTTACTAC
ACAAGTAGGGTTAAAGAAAAAAAGGCTAAAGAGGTAAGAGTAGTCTTATAAGTATAGATGAATTTGTCTTAAATTATAGA
ATACACTTACTTTTTTATACTTTAAGGCAACAAAGAAGCTGCGTTCTTAAACGTTTAAATGTATCTTAAAAACTTACTTA
ACCTTACTTTAATAATAAGGTAAAAAACGTTTAAAATTAAATAAAAAGACGTCTTAGTAGTAGACTACCTTTGCTATTTA
GTAGACAATAGTTTTATAATTAATAGGCAATAAACAGCTGCTATTACCTTTATCCTGCCTTGCTAGTAGTTAAAAGTTAT
AAGCCTTATGCCGCTGTTTTTAGTTAGCGTACACTGTACTCTTATACACCTAGTATCTAAGGCTAGCCCTCTTACAACAC
TTATTGGCGGCAACCTAAGCGTTCCCTGACTAGGATCCGAGCTGTACGCCTTCTAGGGAGCTTTAACGAATAAGACGACC
TATGCATTAGGCAGGATCCGGCGTTTACTGCCGCTATAGACTAAGCAGTACGTGTGCGCTTCTACGTTACCCGAATGCAG
TCGCATAAGCAAGCAGTCTGCAACCGCTTAGCAACAGCTAATAACTTAGAGCGCTTAACTTTTTTTCTAACTTTATAAGA
GGAGGTTTTTTAACAAGCAAGTAGCTGCCGCGTATGCACCTTTAGGCTAATAGGGGCGTTACCTAGGGAGGAGGGGGATA
GTGTAAGGGTATTTTATATACGCGTCCCTACGCACCGGTTCGGCAACTAGTCGCTTACTAAGCGACGGACTTAACAAACT
ATCTTAACACGTTGCACAGGACTAGCATGGCTACTTAGCTATGCTACGCCCTACTAGGTTTGCGCTATACTGCATCTTTT
AGCTACGTATATATTAGCTAGCAAGCCTTTGCTTACTAATCTCTTATAGTTTGTTAAGTTAAAGTCTTAATATAATAGTA
CAAACTAGTTAAGCCTTTATAACTATGCATTGTATACTACCCCTTTTATAAGCAACTAGATTAATAAAAGCAGTAATAGC
ATTAATAAGAGTAGCTTTTAAGATGTATAGATTCTTAAGCGTTAACTATAGCTAATATATTTAATTACTAAGATTATATT
TAGCAGCCTTTAAAACATGCTTATTATATATAAAAAGCTTAAAAGAAAACTAAAATAAAAATGTAGTAGTAGATCTAACT
ATAAACAACTTAAGGCTATATAAGTAAGAAAGAGAAGAGCTTATAGTTAATACTAAAATCGGTGTAAAAGCTTATTAAAA
AGAATATAATATAAGGTTTAGGCTAAGTATTAATTATTATCCTAAGACTATAAAAGAATAGGCTAAGGGCGTGTTTAGTA
GTAGTAAACGCTAGTTTATAAGCGTTTAAGGGCAGTAATTGCTATAAAGAGATAACCTATTAAGGGTCTTAAAGTTAATA
AAAAACGTATTAGGTTAATAGTCTATATTTAAAAGAGTAGAAGAAGTTAAGGTATAATTTAATAATAAGGCTTTAATAGC
TTTTAGCAACTTATTACTATTAAGAGGTAAGTAATCTAGTTTAAAATTAATAATGCTATTAATAAGCTGTTCTTTATAAG
CTAAGAGAGGCTTTAGCCTATTATAAAAGCGGACAAAAAACACGCGTAATATTTGTGTGTATTAGAAAAATAAACCTAAA
AGATTCGACTATAATAGCTAATTAGGTAGCTAACTTGCGCTTACTTAGCAAACTTAGTAGACAACTTATAATTAGTTGTT
TTTATATATATATAAGCGCGGTAGCTAAAGGTATAAAGATGCTAGGTATATAGTATAGCTGTATTATCTAGCTTAAGAGC
TTTAAATAGGTAGTAGTAAAGAGTTTAGTAGTTAAGGTTTTATTATAAAGAAACTAGGTTAACTATTATAACTATAAATT
TAATAGTAAAAGGCTAAAGGCTATAAAGATAAAAAAGTCTTAATAAAATAAGGCTTATATATACTTTATTAAGAAGTATA
TATCTTATACGCTTACTAGTACCGTTTTACTAAGAAGACTTTTAAGTAATAATAATTAAAGTAGTACTATAAGCTGCTGC
CTAGCGTTAAAGTTTAGAAGTTTTAAAAAAGCTAAGCTATAAGTTAAGACTTTATACCTTTATTATATTTAATTGCTTAA
ATTTTTAAGTTAGCTTAAGTTTTAAAGTAAGCTATAAAGCAATAAAAAGCGTTATAAATATTAGCCTTAGAGATTATAAA
GCTAACCTAGTAATAGCATAATAAAATATTAATAAAATAAAGAAGATAGTAAAAACCTATATAACTAGGTTTAACTTTAA
TTATATTTACTTAAATAAGCTAGCTAGGCATAGTTAGCTTTATAAAAGGGCGGCGATTAATAATCTTAGTAAACTTAGCT
AGATAATAAGTTTTATAATACTTATTATAGCGGCTAAAAAGTAATGCTAGCCTAGTAGTAAGCTAATTTAATAACGTTAT
AAAAGGTATAAAGAAGTATTTTATATATAATATAATAGTTAATAATAGATATAAAGTAGGCTATAAAAAGCGTTATTATA
TTAAGTATAAAGGTTAACTAATTTATATTATATTTATTAGTTAGTATAGCATACTTAACTAAGTAATTATTGCTAACTAG
CATATTAACGCTATTAAATATTATTAAAGGTATACTTAAGTAGGCTAGGTAAGTTAGGCAGGCAAAAAGGTATCTTCTTA
ATAAAAGGAAGCAGCCGTATATTTAATAGCTAATTCTTGCCTTCTATACTCTAAGAAAGTGCAAGAGGCGCTCTTTATCG
TAGGTGCACCTTTAGCGCACCAAGTGCGCAGGACAGGCGCGACCCCGTTTCTACTTGGCCTGTGCGCTAGCACGTGCTAT
GGCCTGTGCGCAGACTGCGCCACGCAGCCTGCGCTACTAGCACCGCTTCTAGTTTACAATGTGCATCTAATACGCTGTGC
GCATACTACGTACGGCTTACGCGTAGCCTGCGTCGGTCCTCTTTCTAGGGCGGTGTTACAAATATATTGTAATAAATACC
TTTTTCTAATAAAGAGTTAGTAAAGAGAAGGTAGTATAGTATAAAGAGGGTAAAAAGTGTAAATTTAAACGTAATATATA
AAACTAAACTATTTTTTAAAGGTACTAAAAGGTAATAAGACTACCTTAACTAGTAGTAATTAAGACTCTAGTTATAAGGA
TTTGTCTAAAGGAAGAAGTTATAGTTAAAAGAATAAAACTAGTTAAAAACTAAGCTAAGGAAACTAACAGCTATTCTAAG
GAAGGGAGGAAGGAAGGTATATATATTATATTCTTCCTAGCTTAACTAATCTTTACCTAGTAAAGGTCTTAGCCGGCCTT
AGCCTAATCTAAGGGTTAAATTAGGCTATAAGAGAGGCGTGCTAGTACTAGCACCCCTTACTTACCCTAGTTAATAGGCT
AGCAGCTATTCTACGACATTTACATTCTAACCTACCTAGCTAATTAGCTTCCTATCTCTTCTAAGATCGGTCTATTAGGC
CTAATAGTAGTACTATTCGAATTAGAGGGCTTATCCGATCTAAATGGTAAAGCTGCCGAAGTGACTAGGCTTAAAGCGGG
CGAGATAAGAGGGTTAAGATTAAGGTAGCCTAAAATTTAGTGTCTACTTTAGGCTAACTCTTTATCTAAAAAGGCTAAGA
GTAAAACTAAGGCTTATTCTAGGCTATAGCCTGTTACAAATATAGTTTTTTATAGTATTTAGTTTAAGCTGCTAATCTTT
GCAAGCTACTTTAAAGTTATTTGTTTTAACGCTAAAAGCGTTAGTTACTACAACTAGTAGTAGTACTAGCCTTAAATAAA
ATCCTTTATATTAAGTTAATTAAGGATTAATAAAAGAGAGTTATTTTAAAGGCTAAATTAGTATTATCTAGTATAAGAAG
GTATATTACTAACCCTAAAGAAGTAGTATACTTTATAATAACTACTATAAAGAATAGCCTTACTAACAAAAGGTACTAAA
AAATAAGTAAAAAGAAAACAATTTTTGCCTTAAACTAAAGTCTAAACGTTTTTAGTTAAAATAATTAAAATAAAACAATC
CTACACAGCAAGAAAATGCTGCCTAAAAGAGGTTAGCAATAACAATGCCGTTATATAAGAAAGGAGGCTTAAAAGAGGCT
CTTAAATAAAAATAATGCAAGGGTGCAAATTAAAGCTGCAAGTTAGTGCGAAAATAGGCGAAAAAACACAAGTTAGGTAG
TTTCTGGTCAAAATAACCGGGAAAAAGGCCTTAAGGAAGCCGACGAAGTCGGAGAAGCTCGTAAGATGAAAATAAATGAT
GCTTTTGATAAAGAGTGCGGATTAAGAGGGCTTATGACCTTATGGAAGAAAAGCATGGGATTTTCTGAAAGGAAGCTAAA
GCTAGTGGATGCACTGCGGCAGTGAAAAGTCTGCACAGTGACCCACAAGGTCACGTGCAACATCTTCCCCTGCCATTGAC
AGAAGGCACAGGCCACGACAGAGATCGGTAACGGTGTGGCCAAGAAGATCTACCCCGCACTACCCTAGTTCGAAATCGGC
AAGTGCCACCTAGCAATACGGGAACTTGGTTTTGCTTGCGTACTCGTATAATGTACTGCGTACTTTTGCGACTAAATGCA
AGTCGTTTACGTACAATGGAAACTTGCTTTGCTCTTTTGTAAGATAATATCTTTCCATAATGGTACTTGCATTAATTTTT
GGGTTGATTATCAAGGCAGAGTGTTTCGAATCTCAGACTCACTAGTTTGCCACGCCTTCAAGGGCGCTTTGCCAATTCTG
TAACTGTACAGCAGATGACTCCAGAAAACTAGCTATATCGAAGAATGTGATAATAATTACCAATAGCTTCATTAGGTACG
ACTTTGGTCAATGATAATATAGTGCTACTCAAAATGCTGCATGTACCGTACCTCGTGTCTCCCATCGGAGCGGGTGCATT
GATTTTCGAGACAGTGCAACAATGGACCGTAGTGCTGCAGCCTCCCTCTCGATTTACGAATTACGAGAAGTAAAGTGATA
CGTACTACAACTCGTAAATTATAATGGCATCCCACGCCAAGAAGAGCCGTACGATATTGGCCTCCAGATGACATCACAAT
GGACATGTTTGCCGAGTTGCACTGTATGGCAGCAACTTGGCACACCGGACTAAGCACCAATGCAAGAGAAAGCGCCGAAA
ATACAGGCGTTCACTTCGCACTACCTTTTTTTTTTTTTTTGGTTAGGCCACCGCCTTTTGGAAAGTCGCACTGTTCGATA
CACTGCATGTATAATATAACTCGCAGTCCTTTGTCGTGCCTTTTGTTGCTTAAAATCCTTTCCACTTTCTTCAATTTCTT
CAATTTCAATACTTATATTTTGCGATCACAATGTTTCATTCAACATCAGGAGTTAACGATCGTGGCTTCACTACCGAGCT
AGTGCATGCCAAGGAGAAGCAATCGTCTCTGGAGCAGTTGGGTCCTAGGTTTTCTTCCTCCGAAGCAGCACGTGGAAGTG
CTGACTCGCTAACACGTCGGCTACAAAACCGCCACATTCAGCTCATAGCCATCGGCGGGTCAATTGGCACGGCGCTCTTC
CTGAGCATTGGCGGTGGACTGAATAAGGGCGGCCCTGGCAGTCTGTTCATTGCTTACACCCTCTACAGCATTGTCCTGGG
TCTGGTCAATAATTGCATTGCCGAAATGACAGTTTACATGCCAGTGAGCGGTGGCTTTATCCGTCTTGCAGGGAAATGGG
TTGACGACTCGCTCGGCTTTATGGCTGGGTGGAACTTCTTCCTCTACGAGGCGCTGCTCATACCCTTTGAGATATCTGCC
TTGTCGATCGTCTTAACGTATTGGCGCGACGACATACCAACTGCTGCCGTCTGCGGTGTTTGCATTGCTGCATATATGTG
AGCCTTCCTCTATCACCCTTTCACTATTCCCCTTATTTTCTTTCCGTTTTAAAAGCTTCCTTCCACTTGCAAATACGTAT
AGGCAGGCAATACCCAGCGCTGTCCAGTCTCCTATTCACATCCAGCTACGCTCTGCGGATTAAGATCAGGTAGAGTATAG
CGAGGGAAAGCAGGTATGGTCATCCGCCGTATGTCGGATGCCCATATCCTACCCGAGTACAGTAACCGAGAGAAAGTTCA
AAGGAACAGACGCACCTCCATTCCATTCTATATATAATGTGACACGATACACTATTGAGGATCACCGCTGAATACTAATT
TTTCGGTACACTTCATCGGGTCTTAATTAAAGCGTTTTAAACATCTTTGTCGTGGAAGTGTACGGCGAGGCTGAGTTCTG
GCTCGCAATAGGCAAGGTCTTCCTTATTGTCATGCTCTACTGCTTCACCTTTGTGACGATGGTGGGCGGCAACCCGCAGC
ACGACGCATACGGCTTCCGTTACTGGAAGCACCCGGGATCGTTTGCCGAGCATCTCTCCAAAGGGGCTTTGGGTCGGCTC
GAGGGATTCCTGGCTGCGCTCTGGTCGGCCTCCTTTACTGTTGTTGGGCCTGAATACATCTCAATGGTGGCGGCCGAAGC
CAAGCACCCTCGCATCTACATTAAGAACGCGTTTAAAACAGTCTACTGGCGTTTCGGTGCCTTTTTCATCCTCGGGTCGC
TGTGTTGTGGCATCGTTGTGGCTTACAACGATCCGGTCCTGGCTGGAGGCTCTGGCTCAGGCACGGCTGCAGCATCGCCT
TACGTCATTGCCATGGAAAACCTAGGCGTTGATATGCTGCCACATATTGTTAATGCTCTGCTCTTCACCAGCATCTTCTC
CGCCGGAAACACGTACTGCTACTGTGCCACCCACAGTCTGTATGGACTTGCCCTTGAGGGTCGGGCTCCCAAGATCCTGA
CCAAGTGCTGGCGTGGAAACCCGCTCTTGTGTTTCTGCATCGTCATATGCTTTCCGTTCCTCTCCTTCCTCTCGGTCTCC
AACGGGTCAAATGTGGTCCTGACGTGGTTAGTGAACCTGGTCACGGCCGGTGGGATCATCAACTACATCGTCATCACGAC
GACGTACATTTGTTTTTACCGCGCCTGCAAAGCCCAAGGGTTCGACCGTACTCAATTGCCATATGTCGGCTACTTTCAGC
CCTATTGCGCATACATCGGACTTACGTGGATGACTGTGGTCGTGGTCTTCTACGGATACTCCAGCTTTCGGCCCTGGAGC
GTCCAAAACTTCTTTACCTACTACACCATGGCCATCCTGGCCCCCATTCTGTTCGTCAGTTGGAAACTAATTAAGCGCAC
CAGCTTTCGTCGACCGCACGAGGTCGATCTGGTGTGGGAATCCGAGGCCATCCGCGAGTACGAAGCACTCGAAACAGAAG
CCCCTGTCGGGTTTTGGGCCGAGTTGATGGAGATGCGTGGGCCAAAGTTCTCGAAGCTGGAGCGGTCTAACGTTGCGGCG
GTCTGAAATAGCTATAGGATAGTTGCAATACTGGAAGCCTTCTCGAAAGAGGGTCTGGGACGGATGCATTGGCTTATGTC
ACAATGCTTTTGGCAATATACAACGCGTTTTATTATACCATTGGGACAACCCGGATGCAGCACGTCCGAATGGCAGCACA
TAAAAACCTTCTCAACCTTGACCGAGTAGTTCGAAGTACCCACCATGTATGAAGTGATTCACTACACACGCACAATTTGC
GTCGGGCTACTGCTACTACTACAAGACCGCAATTCCTGGCACACTAAAATCCGTCGGCCCAGCCGACAGAATCTTTTATA
CTTTTCATTTTCATACACGATGGAATACGAAGAGAGCACCGACTCGGCCCCCGGCAGCCATCTGGATTCCCGCCATGGCG
CGAACAGGCCGCTGGCCGTGATTGCGGCCACTGGGATTGGGGTGAGTGCATGGCGTCGTCGGCTGAAGCTACTCTCGCTG
ACTGTCAGATCTTTCTCTCCGCTGCCGACTCCACCATTGTCATCGCCTCGTACGGCCGCATCGGCAACGATCTAGATGCC
CTTGGTGAGGCCAATTGGGTCGCCCTGGGCTACTACCTAACCCTCAGCACCTTCCAGCCGCTGTACGGCCGCCTGAGTGA
CATCTTTGGCGTCCGCCGCTGTCTGCTCTTCGCCTATGCTACCTTCGGCCTCGGCTCTCTCCTCTGCGGCCTCTCCGGCT
CCATCTGGCAGCTCTTTGCCGCTCGTCTCTGCCAGGGCATCGGCGGTGGTGGCATGACCACGCTTGTCAGCATCCTGCTT
ACCGACATTGTCCCACTCGAAGACCGCGGCCTCTGGCAGGGCCTCTTAAACATTGTCTATGCTGCTGGAGCCGGAGCTGG
AGGTCCGATCGGTGGCGCATTTGCCGAGTCGACATGGGGCTGGCGGGTCTCCTTCTTTGTGCAGATCCCCTTTAGCATCC
TCGCATTCGTTGCTGTCAGCCTAGTTCTGCCCTCGTCTGCCGGTTATGCCAGGACATCTGCATTTCCTACGACCGTTGAG
CCTCACGAATTTCGGGAATCCATCGATTTACACCAACCACATAATTCTCCTACGTCTCCCCTCACTCGCATCGACTTTCC
TGGTGCCTTCTCCCTCTTCGCTGCTATCCTCTCTCTCCTCGTTGCCCTCGACCGTGGAAGCAATGTCGGTTGGGCCAGTC
CATTCTGCTGGGCTCCTCTTGTCGCCTTCCCCCTCTTCGCAGCGATCTTTCTCCACATCGAGACCGCCGTGGCCGTTGAG
CCGTTCACCCCCCCTGCCTGGGTCGCCCGCCGGTCTCGTCTACCTGCCTACCTCTCCAGCCTCTTCGCCTTTGGTGCCAA
TGTAGCTCATGCCTACTCCCTCGCCATGATCTACCAGGTAACCCGTGATGCATCTCCCCTCCAAGCCTCCCTTTTGCTCC
TGCCTGGAACAATCGCGGAGGTCATTGGGACGCTCTTGTCCGGATTTCTGCTCAAGCGCTCCTTTAATTTGTACCGCCTC
AACATATTCGGTTATGCCATGGTTGCCCTCGGGAACGTCTCCATTGCCAATGGTGCTCGGTCTTCTACTCGCCTGGCCGT
TCTCCTCTTCGGAAACGCTATGGCGGGCCTTGGAAACGGGTTTGGAATTATTACTTCTCTTGTCAATCCCGGTGTGTTTC
TATCCGTTTTTTTCAATCATGATTCATAATCAGAGATGCCTCTTCACTACAACTCTCACCTAACCTCCTCTAGTCGCTTC
TGCCAAGAAGGAGGAACAGGCAATAGCTGTTTCGTCTTGCTACCTCTTCCGCGTCATCGGATCAATCACCGGTATTTCCA
TCACCTCCGCCTTGACTCGGAAATCTCTTGGTGCTATCCTGCAATCCACGCTCGATGCCGACGATGTCAGCTACATCCTC
TCGCAGACTCGGCACAGCCTCGACTTTCTCTCCGATCTGGACCCAACCCTTGCGGCGATCGTTGCGACAGCGTACGGCCG
AGCTCTTGGCTTAGGCCTTTGGCTTCCAGCAGCTTATGCTGTTTGTGCTGTCATCAGTAGTATATTTCTGCGAACACAGA
GAACCCAATTGTAGCGTTGGAATCATGAGCTGGAAGACAATTATAGACACAAAACTATCATCTTATCACAGTTCTCGCAA
ATAGACTTTGCATTCTTGCCGCATTGTAGCAGCCTTTCCCACTCCTTTCCAGTACTTTTCCTTCAGCTAAAGAATAGCAA
ATCCCTTCTCGGCCCAACTCTCTCGTCCCATCTGGGAAACACATACGTGTCTGTACCCACAAGTGGCTGCCCAGCAAAGT
CCGCCAGCCAGTGAAGTGCTGCTCAAGCTATTCAATAATGATTAGTATCTCATTTCATAGAAGAGATCCAGCATTATGAC
GAAAGCCAGGAAGCTCCACGTGCCCAGAACACGTCGCAGGATCATTTTGTTCTGACCTTTGGGGGCTGAAAATCTTTCCT
CTCGGAGCCGCTTCACACCCAGCTGCTTTTGTTCCGCCGTCAGCTAGCGGGAGCAAGTGGGCATATTAGGGAAGAAGATG
ACGCCGATGAATGCAATAGGGCTAGTCATAACAAAACACAGGATAAGCACCCTTCTTCACCCCTGCAAGCCGTAGCCGTG
TTTCAGGTTGGTGTAAGCGTAAGCCTGCAAGTAATCGGCCATCAGCTAGCCAATCGGCTGGCAACCCAAAAGGGCGTTTC
TGCTGCGAAGCGTTTCTGCGGTGTGTCAGAAGACAGGCTGTGTATAAACGACGTTCATAACGTATCGTATACGGGCTTAA
GAACCTACGAGTTGACTATGTGCATCAGGCCAATATAGGAAGACGTAGCAGCAAAGCCGATGAAGGACCGCATGACCACC
AGCTGATTGTGTGTCTTGACAAATGTAGTTAGCCGCGTACAGTGAGAGGTACGTTCTTGCTTTCTTTTGTTAGCTATTTG
AAATGGATTCGCCTCATTCTATCAATGGCCAGTACGGTGTTGATTGTGCAGCTATAAAGCTTGTGGCTGTGGGGGGGTAC
TATGGCCGTGCAGGATCCGGAATATGCACCCCTGTATTCCGTACGGAGTGGTGTATGTCGTTATTTAGCCGACTGAACGG
CAACTCTACTTAAAATCTTTGATGTAGCAGCGGTAGCATCGTTACCATCATCACTACCATCACTACTAACACTACGGAGT
AACAGCACCGTTCAGGACAGGACCCATATTTACAGACACCACTTTAATCCCACGTCCTGGCTGGTCCACTAGAGCCGTGA
TTACGTGACAACAATTTTAGCTCCTTTTTGGAGCGAAAGCAAGGTGTTGATTGCGGGTCAAAAAGTTCAAAAAACATGTT
TATGATCATGTAGGAACGACTACAAAATCACCCTAGTTTCCCTTTACACAGACAGGCGGCAAGCTTGTAGAACAAAACCA
TAGCTGCAGTAGCATTTCCCCAAAGATGTGCAATTTAGACCGTCCTGACTAGATGGCCACAATCGTCTTTGCTCATATCA
GACCTCCGTTACCGCCACGTCGTACTCACCGAGGTCGTAGAGATCCCACAGCCAGAGGGTACGGAGTAGGAGCGATTGGG
ATCGCTCTCCCAAACGATGGAACCACCAGATTCAACGCGGATGAACTTGTACTCAAAGGTAGTGCCAGCCGGGAGACTAA
CGGTGACGAACCAGAAATTGTTGGAGGATGTGTAGTCGGAAGCACTGAGGGCAATGGCACTGCTGGTGTTCCAACTTCCA
AGCTTTGCAATTGAGCCTGTGAGGAACACATTTTCGCCATATGACGTCGTGGCAATTTCATCAAATGTGACGGCAACTGC
TGTCGGGGTGCTACAGGTACTGGAGGAGATGCTCGTGGTGGCAGTGTTGGATGGTTTCGTCGCCGTCGCTGAAGCCGTTC
CGCTCGTCAGGGAACTCGGCCACGAGGCCGTGGGTGCGGTGCTGTAGGTGCCGATGGCTGAGGTGGCCGAGCAGACGGCC
GGCACGCTGGATGCGGTCGTCTCGCCCCAGGGCTTTGGTACAACTGCATTACGGCGCATATTGGTCGTCAGCAGGGCAGC
ATAGGACCAGGTGAGGTCGCGGGCAGACAGCGATGTTCCGGAAGACTTGTCGAACTGCTCCGAGAGGGAGCCGTTGGTCA
TGGCGTGAGTCTGGACGATGCTGACGAAGCTGTCGGCATACGTACGGACGGCTGAAACAATGGCGCTATAGGTCGAGCTC
GAGGACGAGTATGTTCCGACAGCGGCTGAACTGTACAGGTCCGTGAAGAAGGACAACGACGTGGACGTGATGGTCAGCGA
ACCTGTCGCATTCCACTGGATGATAGCGTCGTACAGCTGCTCCGCGGCGGCCAACGTGGTCAGGAACCAAGGATTACCGT
TGTAGTATGAATCCTCCGGGTAGCGGCCTGTTGCGACTGCTTTACCCGTAGCCAAGCCGCTGTTGATACTGTAGATGCTC
CGGAATGCGTCCACATAGACCTTGTGGTTCGCTAGCGCCCGTGCTGAACACGGCTGAAGCGTACTGTCGTCACATCCCGC
CCTCGGATCAAACGTATGGATGCTGCTGATCAGTGTGTTGGCGTCCTTGCCTGACCGGCTGTACCCAAAGTTGGCGTTGA
CGTAGCTGCCCGTCCAGAAGCTCTGCAGATAGCAGAGGATCTGCGGTGCCTGCGAGTCGCAGTATGTGCATGACGATTCG
ACGCGAGCCGCAAATGAGCTGCCCTCCACCAGAGCCCGGTGCTGTGCTGAGACAGTGAAGAAAGAGGAACCGCTGACTTC
TTCCCAGAGGTCTGAGATGAAAGCATTAGACACGGGTGTCACATACTGCAGCCTGAGGATAGATGCTCACCGTAGCCTGT
ATTGTTCCAGTATTCAGCTACATAGGACAGATCGTTGCGAACAATTGGCCAGATGTTGTTGATTGCATATGAGGAGTAGC
CGTTGTCCTGAGGTCAACCAGCGGGTTAATATTGTAAACGGTAGAAGTCATTTCGAAATCGAAAAAGATAATCGCAGTAC
CACAACCAACGCACCAGGAGCCAGTTTCCAAAGTCAATCAAGGCTGTTGCCCGCAAAGCCGGTCCGTCGCGCTGTGGCCG
ACCCCAGCTGCCGGTGAAGGCAGTCTCATCGACGTTGAACTTGGGCTCGCCGAGTCCGGTGCCGTCTGACAGTGAGCCGG
ATGGATTGGAGACCGTCTGCAACACCGCCTGTGCGTTGACATAATTCTCCAACGTCGTCTGCAGGCTGGTCTCGCCATTG
CGGAACAGCTCTACCAGCGTCTTGGCCACGAGCGCGGCATCGCGACTCCAGGAGTAGTAATCTTCCTTAGTCAGCACGAT
GAGCATCACGGGACTATGGCATCACGAGACCGCTGGATATGAGAATGAGAATGATAATTGCCAGATTGGGTGATGCCTTC
ACGTACAGTCGGGACTGTCAGTGCTTGGACTAGCAATAATGATGCCACTGTCTGCACTGGTAGCGTACTGGCCCTTGTTG
CCAATGTTGGCGAGGATGCGGTCGATCGCGATGGTAGCCTCGGATTCCAACCAGCTGTCCAGGCTAGTGCTCTCCCGGAA
GCGCAACTGGGCGTCGAGCGAAGATGGTGCAGCCAAGGCGACGCGCCCTATGGTAAGAGCACATAGGGCGCGAGAGACAG
ACAGAAGCATGTTGGGTAGAGTGGGGCGGAGGGAGAGTTGAGTGGGTCAGAGTGTGATCAGGAGATGAGGGCCTGATGAG
GACCTCTTGAGGAGCTCAATTGCTGGAGGGGAGGCAAAGAAGAGTCTGTCTGGGGTATCGGGCACCCCTTCCTTAAATAC
TTCTCGAGGAAAGGCATACGCGCTCAGGCCGAGCGTGACAATAGGGCCGAAATGGAAAGAAAAGAAAGTAGGTGAGCAGA
AATAAAAGAAATCGTAAAATAAACCATAAAATAGCTGGCAGGAATGACAATCAGACTCGCAGCTCTTTCCTCCACCACTC
ATCAGTCTCTATCCACTCTCCACATTTACACTCGCCACGCACCAAAAACCACTCAGGAGCCGCCATTCAATCTAGGCCCC
AACCCCTGGCCAACGAGTCATACCATCGCGGCTCTCTCCGCGCCAAACCTGTCACATGCTCCGGCATGCGGGGTCTCCAC
AAAGTCGGCCAGCTAGGCCGGAAGCCACGCTCGAAAACGTTGCATCGTCACTTGACTCTTTCGGCCCTATCATTGCTGCA
GTGCTCCTCGTGGCCTGTGCGCTGGCGCTGCCGTGTGCACACAGAGCATACCCGAAGAGGAAGCGCACCGCAACGCTGTA
CTACGACAGGCAGGTCGGCCGGAGATGGTCACCAACACAAGCCAAGTTTCGGTGGCACTCCGGAGACGGAAGACGCTTTT
CGGCCCACCGTCATGAGAGGCCGACGAAGATCGTGGTGGCCAGACGCATGTAGCAGTCGAGCTGCCAAATGCAGTTAGCG
GTACAAACGCCGATCAAACAACTTCGCCCACTGGTCATGCTGCCTTGCCGAGCATTACCTGGGGGCCGAACCAAGTCGGT
GAACCAAGGAGCCGAAGTATCTCCACTTTCCCCGCGAGATCTCCAACCGTGGACGCTGCTATCGAAGGGCTGGCTTAAAA
GGTCTTGGCTGTCATTCCTGCATGTCGTGCATCGTCTATGGAAGGCAGATGTCAGCTGTCTGCTGCCTATTGTAACATAT
GCACTATGTATCACACTCACTATAGCCACATTAGATGGTCTTGCATCGCCTTGTGGGCCCTCCTCGGCCAAGTCGCCCTA
GCACTGACTCCAGTACAGTGGCGCGGCCAGTCTATTTACTTTCTTCTAACAGACCGGTTTGCCCGCACCGACAACAGCAC
CACTGCTGCATGCGACACCAGCAAGAGGGTTAGCCTCTGGTTCTGTCTTAGTTTGTACTTAGAGTCGATCGGCTAAAGCT
TACAGGCGTACTGCGGTGGAAGCTGGCAGGGAATTATCAACCAGGTAAGTGCGATTAGGCGCACTTCTGGCACTTGCTTA
TACTTGTCCATAGCTGGATTACATTCAAGGAATGGGCTTCACAGCCGTATGGATCACACCAGTGACGGGGCAATTCTACG
AAAGCACATCTGATGGGACGTCGTATCACGGGTACTGGCAACAGGACATGTCAGTTGGAGAACCTGCCCTTCTCTTGATG
TGGCTCTTTGTTGACACTCTGACAGATATGATTTAAACCCCAACTATGGAACCGGAAGTGACCTCCTGAAGTTATCCAAA
GCGCTGCACGACCGTGGAATGTACCTCATGGTCGATGTGGTGGCGAACCACATGGTGAGCTAGAGGGGGCGTAAATACAG
TCTTGACGGGACCCACGTACTGACAGACACCAGGGCTACGATGGCAGTGACTCATCCGTGGACTACAGCGTGTTCGACCC
GTTCAACGCCGCGAGCTACTTCCACCCTTACTGCCTCATCTCCAACTATGAAAACCAAACAGAGGTAGAGGACTGCTGGC
TTGGAGACTCATCTGTGTCTCTGCCGGACCTCAACACATCCCAAACAGCTGTTCAAGACATATGGTACAGCTGGGTGTCA
TCTCTGGTAACCAACTACTCGGGTAAGTACTCACCTCTCTACTGTCTCACAAGCCTGCTTTTAACAAACTATCCAGTTGA
TGGTCTGCGTATAGACACCGTAAAGCATGTGCAGAAGTCATTTTGGTCTGGTTTTAACGATGCTGCCGGGGTCTATTGCG
TTGGCGAGGTCTTCGACGGCGACCCGGACTATGCCTGTGCTTACCAGAAGTACCTGGACGGTCTGTTGAACTACCCGATC
TACTATCCGCTTATAAGCGTCTTTAGCGGTTCCGGCACCTCTTCTAGTATCAGTAGCCTCTACAGCATGGTAGCCTCAGT
GGCGGCCGATTGCACTGACGCTACGCTATTAGGCACTTTCGTCGAAAACCACGACAACCCTCGGTTTGCCAGCTACACGA
CCGATTATTCCCTGGCCAAAAATGCGCTAGTATTTCTCTTTCTCAGCGACGGCATCCCCATCGTCTATGCTGGCCAGGAG
CAGCACTACAGCGGCGGTGCAGACCCGGCCAATCGTGAGGCGACTTGGCTTTCCGGATATAACATCACGGCCGAGCTTTA
TGTCTTCCTCCGCACTACCAACAAGATTCGCAGCCTTGTTGCCACCCGTGACTCTGCCTGGACCACCGCGCCAAATACCC
CCTTCTACCAGGATACCACCACGCTCGCCATGCGAAAAGGATCCGTTTCTGGAAGTCAGGTTATTACTATTGTCAGCAAC
CTCGGTCAGGGTGGCAGTAGCTACAGTCTCACCCTCAACAGCACTGAAACTGGTTACACTGCTGATGCCTCCTTCGTCGA
GGCATATTCATGCGCAAGCCTCGCCGCAGATTCAGCCGGCAATGTAGCTGTTCCGATGTCTTCGGGCCTTCCCAGAATCC
TTGTCCCGGCTTCCTGGATCAGTGACAGCGGTCTGTGTGGCTCTTCTGTGTTGTCTGCGACTGCTACCAATTCGGCTTCG
ACGAAAGCGTCCTCTGCAACATCCTCATCTTCCACTATCACCACCGCTTGTACAACAGCAACAGCCCTTCCCGTCATATT
CAAGGAGACGGTGACCACCGTGTACGGTGAAAACATTTTCATCTCGGGATCTATCTCCCAGCTTGGCAATTGGAATACAG
CCAACGCTGTAGCCTTGTCCGCAGCCAATTACACCACCGCTAATCCGCTTTGGTTCGTCACGGTCACGCTGCCCACTGGC
ACTGCATTTGAGTACAAGTACATGAAAGTAGGCAGTGGCGGTACTGTCATCTGGGAGAGCGATCCCAACAGGTCGTTCAC
CGTGTCCTCTAGTTGTGTTGGGACAGTCGTTGTAGACAGCAGCACCTGGCGTTAGCTCCTCTGTGTTCAAGTCTAGTGAA
GCCAATGGCATCTTTTTCTTATCCGATACCAAGCCCTGGTAACTCAATTGGCTAGAGTGTTGGACTTTTACTTCCGTTCA
GAGAGATCCAGAGGTTGCGGGTTCGACCCCCGCCTGGGGCGCTGTCTCTTTTTTTGCTGGTGGCACAAGTGCGAGGAATT
GGCCTACTCTTTTCGAAGCAACCGATGTGCCGACAGCAAATTACACACCATCTCAAATAGACGTCTTTAAGCCGACTTGG
GCCGACCTGATTCCAATCTGACATTATGCAGCGCTTGATTGTTACGAACACGCTGTTATACGAGAATTGCTCACGAGTTC
CAAATTTATATTAAGCTGGCTGTTCAAATCTTACGACGCATGTTCTTTTTATTTCTCGTAAAATTGGATTGTAGCACCCG
AGTGCATGAAATAATGGCGAATGTACAGCGCCTAGTGGTAAAAGTAGCGATATAAGTATACTAAAAGGGGACATCGATTA
TAGACTTCGCAGGCTAACTCCGAGTAATTTAGTCAGGTTGTATTATGTGTTACTCAAAATAGCCCGTAGATATCGAAAGT
GAGGTGCAATTAGCTCCTGTCAAACATAATTACAGGTCTCGACGTCGTTCAGCCTTATTTACTAAGTTCGGCCCTTTTGT
GTCCGTTTCTATACCGCCCATTAATACAAAAGCTTGCGTGTTAATACTTTTCTCTACTCCTTTCTCCTGTCCTTGTCTCC
CATTTTCGTACTATTCACCAGCAGCCAGGGTTGGGAAAAATACTAGTAGTACTTAAGTACTAGAGTACTATAGTAGTAAT
TAATAAGTAAGTATTCTAGAAGTTTCTATAGTAATTAGTAACTAAGTAGTCTAGAAGTTTCTATAGTAATTACCAACTAG
ATATTCTAGAAGCGTCTAAACTAATATAAGATATATAAATACCAGCCTTTATCCTCCTTTACTCTATATTTTTTTAATTA
CTATAATAATAACACAAATAAAACAAAAACAATAGCAACAGCAACAGCAACAGCAATAGTAATAACATACTTTTAGTTTA
TTTTTTTATTTTACTTACTAGTAAGTTATATTTTATTTATATCCCTTCTTTTACTTTACTTTATATACTTTATTTGTATA
GGTTATATTATAATCTATAATATAGCTTATTCCTTAGTTTATCTTACTTAATATATCTTAAGCAAAAACTTAAGCTTATA
TATATTAATAATTTAAACTAAGGGATAATCTATAAAGCTTATAAGCTATAAAGATTATTCTTTAACTTATATATAAGCAT
TTACTTAAGCTTATATATTACTACTTTAAGTTAAAGAATAAGTAGTAAAACTTATAAATATTATATTTTGTATCTTTTTA
TAATTAAAAGGTGTTAAAGGGTATATTTATATTATATAGCTTACTAACTTTTATTAGTTAAAATAGACTCTAACGACTAT
ATAACTAACCTTAACTCTAAAGTTACTTCTTTTATTACTGCTTCTAGTAATAAAAGAAGTAAGCAGCATACTTTTTATAA
TAACCTTAATTTTATCTTAGATGATTTTAAATTAACAAGTTATATTATTAATTATATGTTAAATATATAGACTTTACTAC
CTTATAAAGAAAATAAGGAAAGAAAAGTATTAGTAAAGTATACAACATAAGTAATATTTTACTAACTAACTAACTAATTA
ACTAACTAACTAACTAACTAACTAACTAATAAGTGTAACTATAAGAAGATTAATACGCTTATAGGCTTTGAAAGCTTAAA
CTATATAAAGCATTATAAGCGTCTTTATTTATCTATAGCCTTTAATAAAAAGGCTAAAACTAAAAAAGGTTTATAAACTA
GTAAGTTAATTAATACTACTTTATAAAAAAAGTACTTTACTAACTTAAATTAAAAGAAGAAACTATTAATAATAGCCCTT
TAAACTTCTTTAACCTATAGTCTTAAAAACAAGCCTAAGTAAATACAAACGTTAAATTATTATTAAAGGTGTACTTAGGT
AGGCTAGGTAAGTTAAGCAAGCAAGAAGGTATCTTCTTAACAGGAGAAAGCAGCCGTATATTTAATAGCTAATTCTTGCC
TTCTATAGTCTAAGAGAGTGCGGGAGGCGCTTTTTATTATAGGCGCACCTCTAGCGCACCAAGTGCGCAGGGCAGGCGCG
ACCCCGTTTCTACTTAGCCTGTACGCTAGCACGTGCTGTGGCCTATGCGCAGACTGCGCTACGCAGCCTGCGCTATAAGC
ACCGCTTTTAGTCTATAATGTGCATTTAATACGCTATGCATATACTGTGTACAGCTTGCGCGTAGCCTACGTCGGTCTCC
TTCTTAGGGCGGCGTTATAATTACTCCTCTTTTATGCCTAACTCCTTTAAAGCAGGTCTTAACAAAAGGCTTGCAGCCTT
TATTCTTAGTAGTAGTAGTGCTTGTTTGTAAGGGTATTCTACACACGCGTCCCTACGCACCGGTTCGGCAACTAGTCGCT
TACTAAGCGACGAACTTAACAAACTATCTTAACACGTTATATAGGACTAGCACAGCTATATAGCTGTGCTACGCCCTACT
AGGTTTGCGCTACACCGCATCTTCTAGCCACGTATATATTAGCTGGCAGGCCTTCGCCTACTAGTCTCCTATAGTTTGTT
AAGTTAAAGTCTTAATATAATAGTATAAACCGGTTAAGCCTTTGTAACTACGCATTGTACACTACCCTCTTACATTCTTT
AACTTTTATTCTATAAGAAGCAATGTTCGATTATAGGGCGGCTACTCTACAATTAGCACGCAAACTGTTAGAAGCTAAGG
ACGTGCTAATGCCACCCTCTACGCTAATGCACGGCAGCTATACCTTGCGCGTAGCATCTATAGGCACCTTAACCCTGTCT
GTTAAGTTGGAAATAAGACTAGTATATATGCTGCTTAACAACACCTTGCTGGCTAAAAAGCAGCTGTAAAGCGATAAATA
CACTTGTATTATATAGACGCTAAAGGCATTAACTAACATTATAGCTATAAGGGTTATAGGGCTACTACTTAGCAGTTGCT
ACTATAATAATAAGCTACTATAATATAGCATTAAAAGGCTAGAAATTAGTGCCTTTACTATAAAGATAGAAGAGTAGTTA
GCAATAATAAAGAACGCTTATAACACTAATACACGCAGCAACGCGTTAAAAAATATAAAGATTATTTAGGCAAGTAGTTG
GTTAACTACTATACTAGCGGCTAATTAGCAAAAGCACTGCAACTAACTCTACGCTAGTAAACCCTTAGTTATACGCCTTA
TATAAACGTACTTTATTAAGTTTATCTGTTAAGAACACTTAAACCTTAAATTCTAGATGCACTGCATTTATAAGGAAAGC
TAGACGCTTTAGCAAGGCAGTAAGTTGCTAATAGCGTACTAGTAGAAATAAAACTACTTACAACGAAAGATTAGTAACAC
CTTTAATTAAGTAGGCAAGATTGCCTAGAGGTATTAGCAAAGGCTTAATAACTACTTAGCAAAGTAGTATTAAAATAAAA
CTATTAGCAAGTCTTTTAGTATAGTAATAAAGATTCTTAATACTTATAAGGAGTATTAGTCTTAGGGCTAGAAACAAAAG
AAGAGATAGGATAACTAGACGTAAGCAGTTATAGTTAATAGCGTGCTAGCTAGCGGGCTAATAAAGAAATAGCGCTGCGA
TAATAATAAGATAAGAAACTACGGTTTTATAAAGAGTAACCTAAGCTTATAACTAGTTGCTAGCTAAGGTTAGTTTACTT
CTTAACCTTTTAACCTTAGTAGTTTAAATAATATTAATGTTGCGTTAAAGTGCTAGAATTATAGTAAGAGTAAGCATACC
TTTTAAGAGTGCTTTAAGCCTAAAACTTGCATATAGGTTAAGAAGCTTTAAGTAAAACTAAAAGATAGTCTTTAAAAGCT
TAATAACTAGAAGGCAACCTACTCTAACTAAGAAAATTAGTAGGGTTAATAAAGAAGCTTTGTTTTTTATTAACCTTACT
AGCATAGCTAACTAAGGATATAATTCCTTACTACTATACCTTAGCTAAGGCATAAACGCTTAGTAATCGCTAAGCTACTA
TTGTTATAAACTTAGATTCTTATACTAACCTAAATATAATTAACCTAAAGGTTATTTAATAGCTTAGTTTAAAGCTGCTT
TAGTAGTACTTAAACTTAAACCTAGTTTTTATTAATAAGAAAGCACTATAGGCTTGCGGCCTATATAAGCTAACTATTAT
ACTAATAAAGGATAAGGTCTCTTACGTGTTAATATAAGTCTTTATAGCTGTTTACTAAGTAAGCGTTAACTATAAAGACA
TTATCTTAAGTTATAAAAAACTAAGGTTTCTAGGCGTTATTATTAACACTATTTAATAAGCTTAGTTCTTTACTATTATA
GTTTTTAAGACCTTTAATCAAATAAGCTAACGCTTATATAATAGTAAGAAGTTGTTTACTATCTACTTAACGTAGTTAGA
TTTAAGTCTTTATAAACTAGACATCTCTACTATAAACAATAATTTAGCTTTACTAGACCCTAGCTAGCAACTACTATTTT
GTATATAACTGTTTACTAAAGTATTTAATACTAATAAGGTAAAAAAACTGCCTTTGTTAATAAACGCAAAGCACTTAATT
AAGCTAGAAGATAGCGTAAAAGTGCTATATAGTCTTTTATACCTACTATCTTTTGCTTAGCAAAAGAAGCTTTGCTACTT
TATTAACAAGTTATTAGTAAACAAGCAGATTGCTTATAGTAATAGTCTAGCTAAAGCCCTAGTAATTTTCGTTTTAAAAA
AGAATAATACTTTATATATATGCGTTAACTACTAAGGTTTAAATTAAGTAACTAAGAAGAACTACTACTCTTTTTTATTA
ATTAGTAAGCTATTAGATTGCTTAAATAATATAAAGGTGTTCTTTAAGGTAGATATAAAAGAAGCGTACTATAAGATTTA
AGTTAAGGCCTTTAATTAATAGAAGACTGCTTTCTAAATAAAATATAGGCTTTTTAAGTTTTATATTATACTCTTTAGAC
TAACTAACGCGCTAGCTATATTATAAGGGTATTCTATACACGCGTCTTTACGCACTAGTTTAGCAACTAGTCGCTTACTA
AGCGGCAGACTTAACAAACTATCTTAACACGTTGTATAGGACTAGCACAGCCACTTAGCTGCGCCACGCCCTACTAGGTT
TGCGCTACACCGCATCTTCTAGCTATGTATATATTAGCTAGCAAGCCTTTGCCTACTAATCTCCTATAGTTTGTTAAGTT
AAAGTCTTAATATAACAGTACAAACCAGTTAAGCCTTTGTAACCACGCATTGCACACTAGCCCTTTACATTCTTTAACTT
CTTTTTTACAAAGAGCAATGTCTAATTATAAGGCGGCCACTCCGCGATCAGCACGCGAACTGTTAGAAGCCAAGAACGTG
CCAATGCCACCCTCTACGCCAATGCACGGCAGCCACACCTTGCGCGCAGCATCTGCAGGCACCCCGACCTTGTCTGTTGA
ATTAGAAACAAGACCGGTACACGTGCCGCTTAACGACACCTTGCTGCTTAACAACACCTTGCCGGCCAAAAAGCAGCTGC
AAAGCGATGAATACACTTGCATTATATAGACGCTAGAGGCACTAACTAACATTATAGCCGCAAGGGTTACAGGGCTACCG
CTTAGCAGTCGCCACTGTAACAACAAGCTACTGCAATATAGTATTAAAAGGCTAGAAATTAGTGCTTTTGCTACAAAGAC
AAAAGAGTAGTTAGCGATAATAGAGGACGCTTATAACACTAATGCACGCAGCGATGCGTTAGAAGACATAAAGATTATTT
AGGTAGGTAGTTAGCTAACTACTATACTAGCGGCTAATTAGTAAAAGCATTACGACTAACTCTGCGCTAGTAAACCCCTA
GTTATACGCTGTATATAAACGCACTTTGTTACGTTTATTCGTTAAGAACACTTAAACCTTAAATTCTAAATGCACTGCAT
TTAGAAGAAAAGCTAGACGCTTTAGCAAGGCAGCAAGTTGCTAATAGCGTACTAGCGAAAATAAGACTACTTGCAATAAA
AGATTAGCAACACCTTTAACTAGGCAAGCAAGATTGCCTAGAGGTATTAGTAAGAGCTTAACAACTACTTAGTAAAGTGG
TATTAGAATAAGACTATTAGCAAGTCTTTTAGTATAGTAATAAAGATTGCTAATGCTTGCAAAAAGTATTAGTTTTAAGG
CTAGGAATAAAGAAAGAGATAAGATAACTAAAAGCAAGCAGTTATAGTTAACAGCGTGCTAGCTAGCAAGCTAATAAAGA
AACAGCGCTATAATAATAATAAGATAAGAAACTACAATCTTATAAAAAGCAACTTAAGTTTATAACTAGTTGCCGGCTAA
GGTTAGTCTACTTTCTAACTTACTAACCTTAATAGTTTAAACAACATTAACGTTGCGTTAAAGTGCTAGAATTATAGTAA
GAGTAAGTATACTTTTTAGAAGTGCTTTAAACTTAAAACTTGCGCATAGGTTAAGAAGCTTTAAGCAAAACTAAAAGATA
GTCTTTAAAAGCTTAACAACTAAGAGGCAACTTACTTTAACTAGGAAAACTAGCAAGGTTAATAAAGAAGCCTTGCTTTT
ATTAACTCTACTAGCATAGCTAACTAAAGATATAATTTTTTATTGCTATACCTTAGCTAAGGCATAAACGCCTAGCAATT
GCTAAGCTGCTGTTGTTATAAACTTAGATTCTTATGCTAACTTAAATATAGTTAACCTAGAGGTTATTTAATAGCTTAGT
TTAAAGCTGCTTTAGTAGCACTTAAACTTAAACCTAGTCTTTGTTAATAAGAAAGCACTATAAGCTTGTAGCCTATATAA
GCTAACTATTATACTAACAAAAGATAAAGTCTTTTATGCATTAACATAAGTTTTTATAGCTATTTGCTAGGTAAGCGCTA
ACTATAAAAACATTATTTTAAGTTATAAAAGATTAAAGTTTCTAGGCGTTGTTATTAACACTATCTAACAAGTCTAGTTA
TTTGCTATTATAGTTTTTAAGACTTTTAAGCAAATAAGCTAACGCTTACGCAATAGTAAAAAGTTATTTGCTATTTGCTT
AATATAGTTAGATTTAAGTTTTTATAAACTAGACATTCTTACTATAAATAATAATCTAGCTTTACTAAACCTTAGCTAGC
AACCGTTGTTTTATATACAACCGTTTGCTAAAGTGTTTAATACTAATAAGGTAAAAAAACTGCCTTTGTTAGCAAACGCA
AAGCACTTAATTAAGCTAGAAAACGGCGTAAATGTGCTATATAGCTCTTTATACCTGCTATTTTCTACTTAGCAAAAAAA
GCTTTGTTACTTTATTAATAAGTTGTTAGCAAACAAGCAAATTGCCTATAGTAATAGTCTAGTTAAAGCCTTAGTAATCT
TTGTTTTAAAGAAGAATAGTACTCTTTGTATATACGTTAACTATTATGGTCTAAATTAAATAACTAAAAAGAACTACTAC
TCTCTCTTACTAATTAGTAAGCTATTAGATTGCTTAGACGGCGCAAAAGTGTTCTTTAAGGTAGATATAAAGAAAGCGTA
CTATAGAATTTAAGTTAAGGCCTTTAATTAATAGAAGACTGCTTTTTAAACAAAATATAAGCTTTTTAAGTTTTATATTA
TACTCTTTAAACTAACTAACGCGCTAGCTATATTTTAAGCATATATCTACCGCGCACTAGCAAAGCTAGTAGGCATAGTC
TACAAAATATACCTAGATAACATTTTAATCTACTCTTAAACTAAGAAGAAGCATAAAAAGCACCTTTAATTAGTTTTTAA
GCGGCTAAAGGCTGCGCAGCTATATGCAAATCTTAAGAAGTATAAATTCTTTAAAAAAAAAATTAATTTTTTAAAGTTTG
TTGTTACTATAAAGAGGCTAGCTATAAACCTTAAGCAGATTAAAGCTATTACTAATTAAAAAGCTTTTAAGTGCGTATAA
AACATGCAATTCTTCTTAAAATTTACAAACTTTTATAAACACTTTATTTTCTACTACTCTTGCATTGTGTAAGCCTTAAT
AAAGTTAATAAAAACAGGCCCTAGCCTATTGCGCAAGCATAAAGCTATTGCTACGCAACTGTTTATGTTAACTAAAGAGG
CAAAGATTGTTTTTAAATTGCTAAAGACAGCATTTATAATAGCAACAATTCTTTGCTACTATAATAACATAAAGCCTACG
CGGGTAGAAACGAATGCGTTAGGCTATACTATCTCTAGCATTATTTTCTAGCTTGCAAATAGTAAGTAGCAATTAGTTGC
TTACTACTTGCGCAAGCTAACAGCTTGCAAAATATAGTAAAGAGTAAGATAGCAAAAGCTTTTAGCTATTATTAAGAGCT
TAAAGCACTAGCATTATTATTTAAAAGGTCTAAAGAACTTATTTGTAGTCTTAACTAACTACTAGGCGCTAAAAAGCGTT
GTTAAGGCATTAATAAAGAATCTTTAAAACTAAATTGCCTAATAAGTGTTTTATCTCTTAGCGTTTAACTTTAAGATTAA
GCACTACCTAAGGTTTACTAACCTAGCAAACAGTTTATCCTACTAACTAGACTATATAAAAGGTAACATTATGTATAATA
ACGTACTCTTCTTGCTTCTTAGCAAGCTATAGATTATAAACTAGTTGTTAAGGCTTTTTATGCTAAAAGCTTTGTTGTTA
TTAGTATAGAAAGCGTAAGTTGCTACTAGCTAAGAATAGCTGTTGCAACCTTAGTGCTCTTTTAAACTATATAATACTAT
TTGCAACGCTTAAGGCTAAGACTAATTACTAAACAACTTGTTTGCAAAGGCTAGACAAAGCTAAAGAAACAACACCTATT
ATTTGCAAAAATAAACACCTTGTTTTATAAGAATTGCATTATTGTTTTATTAGCAAATAAGCTGCAAGCAAGGCTAATTA
ATCTATACTACAACTTTTTTATAGCAGGCTATATAAAAGTCTATAAGACTATAGAACTCCTTACTAGAAAGTGCTTGCGA
CAATGTGCCTACGTCTAGAGACGTTAGCGGCAAGAGCTAGGCTACCTTTGCCGACTGCTATGCAGGCGTTAGAGTAAGCT
TTGGCTCTCGCTAGTACTAGTAAAGAACACTAAGGCGCAATGCAGCCTATTGTGCCGTCTTAAAACGTTCGCGCCGGGAG
CGCTAGTCGGTCGCTAGAGGCTTTAACTTGTCTTCTTGCAAGGCGCGGCTAAGTTTCTTAGTTATCGCTGTTAGGGCTAT
TAACCTTTGGGCGATTACCGCGCAATCGCCTAGCGCTACGACGATATTGTTAACTGTCATTCGCTAAAGTAGCAACTTGT
TTATGCTGGCTAGAAATTCCTAAATATATCGGGCTAAGCCCTTAATCTTTTTAGAGAGCTATTGGTTAGCAATTAGCTAC
TAGCGCACACAAGTTAACGCACTTACTAGCAAGCATAACGTATTGTTAGCTATATAACTAATATAGCGCGCTAAGTTCTT
TAGCGTGGCTATATATAAGAATTTGTAGTAGACGTTTAGATAGGCTTTAAGAACGTAGTTTAGACATAGAGCCTACTATA
AAGTTAGCTATCGCTTAGCAAACGCTGTGCTAGTAAAGACTTACGCTTTTAAGAGATAGTGCGTATGCTTAAGAAGAGTG
TTTTATAGGGTTTGCATCTATAAAAAAGTCTATTAAGACTTAGAAGTAGCTTTAATTAAACATTGTCTATAAGCAATTAT
TAGCTAGCTGCTACGCAAAGTTGCAAACTGTTGCATTAACCTACTGCGCAAGTAAAATTAAAGAAAAAAGGGCTAAAAAG
GCAAGAGCAGTCTTATAAGTGTAAACGAATTTGTCTTAAATTATAGAATGCACTTGCTTTTTTATACTTTAAGGCAACAA
AGAAGCCGCGTTCTTAAACGTTTAAATGCATCTTAAGAACTTGCTTAACTTTGCTTTAACAGCAAGGTAAAAAACGTCTA
AAATTAAACAAAAAGACGTTCTAGCAGCAGACCGCCTCTGCTGTCTAGTAGGCAACAGTTCTACTATCGGCGGGCGACAA
ACAGCTGCTATTGCTTTTATTCTGCCTTGCTAGTAGTTTAAAGTTGCAAGCCTTGCGCCGCCGTTTTCGGTTAGCATATA
CTATACTTTTATACACCTAGTGTCTAAGGCTAGCCCTTTTACAACACCTATTAGCGGCAACCTAAGCGTTCTCTAACTAG
AATCTAAGCTGCACGCCTCCTAAAAAGCTTTAACAAACAAAACAACTTATACATTAGGCAAGATCTAGCGTTTACTACCG
CTATAGACTAAGTAGTATGTGTGCGCTTTTATATTACTTAAATGCAGTTGTACAAGCAAGCGGTCTGCGACTGCTTAGCA
ACAGCCAATAACCTAGAGCGCTTAACTTTTTTCTTAACTTTATAAAAAAAGGTTTTTTAACAAGCAAGTGGCTGCTACGT
ATACACCTTTAGGCTAATAGAGGCGTTACTTAGAGAGAGAGAGGATAGTATAAGAGTATTCTATACACGCGTTCTTACAC
ACTAGTTTAGCAACTAGTTGCTTACTAAGCAGCAAACTTAACAAACTATCTTAATACGTTGCATAAGATTAGCATAGTTA
CTTAGCTACGCTACGCCTTACTAGGTTTACACTATACTGCATCTTCTAGCTATATATATATTAGCTAGCAAGCCTTTGCC
TACTAATCTTTTATAGTTTGTTAAGTTAAAGTTTTAATATAACAGTACAAACTAGTTAAGCTTTTGTAACTACGCATTGT
ACACTAGCCCTTTACATTCTTTAACTTCTTTTCTATAAAGAGCAATGTCCAATTATAGGGCGGCCACTCTGCGATTAGCA
CGCAAACTGTTAGAAGCTAAGAACGTGCTAATGCTACCCTTTACGCTAATGCATAGCAGCTACACCTTGCGCACAGCATT
TGCAGACACTCTAACCCTATCTGTCAAATTAAAAACAAAACCGGTATATGTGCTGCTTAATAATACCTTGCTGCTTAACA
ACACTTTGCCGGCCAAAAAGCAGCTGCAAAGCAATAAATACACTTGTATTATGCAAACGCTAGAGGCATTAACTAACATT
ATAGCTGCAAGGGTTATAAGGCTACCGCCTAGCAGTCGCTACTATAACAACAAGCCACTGCAATATAGTATTAAAAGGCT
AGAAATTAGTGCCTCTGCTATAGAGACGAAAGAGTGGTTAGCGATAATAAAGAATGCCTACAACACTAATACACGCAGCG
ACGCGTTAAAAGATATAAAGATTATTTAAGTAGGTAGTTAGCTAACTACTATACTAGCAGCTGATTGGCAAAAGCACTGC
GACTAACTCTACGCTAGTGAACCCTTAGTTATACGCTGTATATAGACGTACTTTGTCGCGTTTATCCGTTAAGAATACTT
AAACCTTAAATTCTAGATGCACTGTATCTATAAAGAAAGCTAGACGCTTTAGCAAGGCAGCAAGTTGCTAATAGCATACT
AGCGAAAATAAGACTACTTACAATAAAAGATTAGCAACACTTTTAACTAGGTAGGCAAGATTGCTTAAAGGTATTAGTAA
AGGCTTAACGATTATTTAGCAAAGTAGTATTAGAATAAAACTATTAGCAAGTTTTTTAGTATAGCAATAAAGATTGCTAA
TGCTTATAAAAAGTATTAGTCTTAAGGCTAAGAACAAAAGAAGAGATAGAACAACTAGAAGCAAGCAGTTATAGTTGATA
GCGTGCTAGCTAGCAAGCTAACAAAGAAATAGCGCTATAATAATAATAAGATAAAGAACTACAATTTTATAAAGAGTAAC
TTAAGCTTGCAACTAGTTGCTAGCTAAGGTTAGTTTACTTTTTAACTTGCTAACCTTAGTAGTTTAAACAACATTAACGT
TGCGTTAAAGTGCTAGAATTGTAGTAAGAGCAAGTATACCTTCTAGGAGTGCTTTAAGCTTAAAACTTGCGTATAGGTTA
AGAAGCTTTAAATAAAACTAAAAGATAGTCTTTAAGAGCTTAATAACTAAGAGGCAACTTACTTTAACTAGGAAAACTAG
TAAAGTTAACAAAGAAGCCTTACTTTTTATTAACTTTACTAGCATAGCTAACTAAGAATATAATTTTTTACTGCTATACT
CTAGCTAAAGCATAGACGCCTAGCAATTGCTAGGCTACTATTATTATAAACCTAGATTTTTATACTAACTTAAATATAGT
TAACTTAAAGATTGCTTAATAGCTTAGTTTAAAGCTGCTTTAATAGCACTTAAACTTAAACCTAGTCTTTATTAATAAGA
AAGCATTATAGGCCTATAGCTTATATAAGCTAACTATTATGCTAATAAAGAATAAGGTCTTTTACACGTTAATATAGGTT
TTTATAGCTGTTTACTAAGTAAGCGCTAACTATAAAGATATTATTTTAAGTTATAAAAGACTAAGATTTTTAAGCGTTGT
TATTAACACTATTTAACAAGCCTAGTTATTTGCTATTATAGTTTTTAAGACCTTTAAGCAGATAAGCTAACGCTTATACA
ACAGCAAGAAGTTATTTGCTATTTGCTTAACGTAGTTAAATTTAAGTCTTTATAAACTAAACATTTTTACTATAGACAAT
AATCTAACTCTACTAAACCTTAGCTAGCAACTGCTGTTTTATATATAACTGTTTGCTAAAGTGTTTAACACTAATAAGGC
AAAAGAACTACCTTTATTAGCAAACGCAAAGCACTTAATTAAGCTAGAAGATAGTGTAAAGGTGCTGTATAGCCCTTTAT
ACTTGCTGTCTCTTACTTAGTAAGAGGAGCTTTGCTACTTTATTAATAAGTTGTTAGTAAATAGGCAGATTGCCTATAGT
AACAGTTTAGCTAAAGCCTTAGTAATCTTTATCTTAAAGAAAGATAGTACTCTTTATATATACGTTAACTACTAAGGTTT
AAATTAAGTAACTAAGAAAGACAACTACTTTCTTTTATTAATTAATAAGCTATTAGATTGCTTAGACGGCGCAAAAGTGT
TCTTTAAGGTAGATATAAAGAAAGCGTACTATAGAATTTAAGTTAAGGCCTTTAATTAATAGAAGACTGCTTTTTAAATA
AAATATAAGCTCTTTAAGTTTTATATTATACCTTTTAGACTAACTAATGCGCTGGCGACATTTTAAGTATATATTTACTA
CGTATTAGCAAGGCTAGTAAGTATAGTCTATAAGGTGTACTTAGATAACATCTTAATCTACTTTTAAACTAAGAAGAAGT
ATAAGAAGCACTTTTAATTAGTTTTTAAGCGGCTAAAGGCTGCGCAGCTATATATAAATCTTAAGAAGTGTAAATTCTTT
AAAAAGGAAATTAATTTCTTAAGGTTTGTTGTTACTATAAAGGGGCTAGCTATAGACTTTAAGCAGGTTAAAGCTATTGC
CGATTAAAAGGCCCTTAAGTGCGTATAAGACGTGCAATCTTTCTTAAGGTTTGCAAACTTCTATAAACGCTTTATTTTCT
ACCACTCTTGCATTATGCAGGCTATAATAAAGTTAATAAAGATAGGCCCTAGCTTGCTACGCAAGTGTAGAGCTGTTGCT
ATATAACTGTTTATGTTAACTAAAAAGATAAAGGTTGCTTTTTAATCGTTAAAGATAGTATTTATAATAGCAATAATTCT
TTGCTACTATAATAATACAAAGCTTATATAGGTAGAAACGGATGCGTTAGGCTACGCTATCTTTAGCATTATTTTCTAGC
TTGCAAATAGTAAGTAGTAACTAGTTACTTACTACTTACACAAGCTAACAGCTTATAAAATATAATAAAGAGTAGAATAG
TAGAAGCTCTTAGCTATTATTAAGAGCTTAGAGTACTAGTGTTACTATTTAGAAAGTTTAAAGGATTTATTTATAGTCTT
AACCAACTACTAGGCGCTAAAAGGCGTTGTTAAGGCATTGGCAAAGAATCTTTAGAACTAAATTGCTTAATAGGTATTTT
GCTTTTTAGCGTTTAACTTTAAGATTAAGCATTGCCTAGAGTCTACTAACTTAGTAGATAGTCTATTCTGCTAACTAGAC
TATATAAAAGGTAATATTGTATACAATAACGTGCTTCTTTTACTTCTTAGTAAGCTATAGATTGTAGACTAGTTGTTAAG
GCTTTTTATGCTAAGAGCTTTATTGTTATTAGTATAGAAGGCGTAGGTTGCTACTAGCTAAGAACAGCTGTTACAACCCT
AGTGCTCTTTTAAACTATATAATACTATTTGTAACGCTTAAGGCTAAGACTAATTACTAGATAACTTGTTTATAAAGGCT
AGATAAAGCTAAGAGAATAACACTTATTATTTATAAAAAGAGAACACCTTGTTTTATAAAGATTGTATTGTCGTCTTATT
AGCAAACAAGCTATAGGCAAGGCTAATTAGTCTACACTACAACTTCTTTATAAAAGGCTATATAAAAGTCTACAAGACTA
TAGAACTCTTTATTAGAAAGTACTACTAGCTAGATATAGCTACTAACGTTTATACGTTTATTGCAAACTATTTATTATAT
ATAAGTAATAAGGTCTTATAGCATAAGCTGCATTCTTAGACGTTTAAATGCATCTTAAATACTTACCTAACTTTGCTTTA
ATAGCAAGGTAAAAAACGTCTAAAATTAAACAAAGGGATGTCTTAGCAGCAAACTGCCTTTGCTATCTAGTAAGAAATAG
TTTTATAATCGGCGGGCAACAAACAGCCGCTATTGCCTTTGTCCTGCCCTGCTAGTAGTTAGAAGTTATAAGCCTTGCGC
CGCTGTTTTTAGTTAGCGTACACTGCACTCTTATGCACCTAGTGTCTAAGGCTAGCCCTCTTGCAATACCTATCGGCAGC
AACCTAAGCGTTTCCTAACTAGGATCTAAGCTATACGCCTTCTAAGAAGCTTTAACAAACAAGACAACCTGTGCATTAGG
CAAGATCTAGCGTTTACTGCCGCTATAAACCAAGCAGTACGTGTACGCTTCCACGTTACTTAAATACAGTCGCACAAGCA
AGCGGTCTACGACCGCTCGGCGACAGCCAATAACCTAGAGCGCTTAACTCTTTTTCCTAACTTTATAAAGAAAGGGTTTT
TAATAAGCAAGTGGCTGCCGCGTGTACACCTCTAGGCTAACAAGAGCGTTACCTAGAGAGGGGGGGGAGAGTGTAAGAGT
ATTCTATACACGCGTCCCTACGCACCGGTTCGGCAACTAGTCGCTTACTAAGCGACGAACTTAACAAACTATCTTAACAC
GTTATATAGGACTAGCACAGCTATATAGCTGTGCTACGCCCTACTAGGTTTGCGCTACACCGCATCTTCTAGCCACGTAT
ATATTAGCTGGCAGGCCTTCGCCTACTAGTCTCCTATAGTTTGTTAAGTTAAAGTCTTAATATAATAGTATAAACTAGTT
AAGCCTTTGTAACTACGCATTGCACACTAGCCTTTTATAGTTTTATAGTATTTACATTTGTATTTACATTAGTTTTTACA
CCTTTTTTTATACTTGTAAGGTTTAAGGAAGTTTTATTTTTATTTTCATTTGTATTAAATAAAGAAAACTATTTTGATTT
TAATTTTTCGTTACTTTTTACAACTTCTTTAGATACAATTATTATATTATTATCATTAAGATTAATAATGTTATAAGCTT
TTTCCTTATATTTAAATTTATCTTTTAAATCTTTTAGACTTAATATTATTTTATTAAAACCGTTGCGGGATATTTTTAAG
ATCTTAGACATTTTACTTTCTTTTATACCTTTTTTTAACTTACTAAACAAACCTTTTCTAGACTTGTCGGTTTTATTAGA
ATTATATAAAGTTTCTAAATCGTTATTTTTATTACCATTATTATACAAGTACTTAAAACTTATAAATCTAAACTTACTAT
TTTTATGTAGATAAGTCTAAAGTTTGTAAATATTTAAAGAGAATTAATTTACGGTTTTATTTATATAATTTTTTATATAA
TCTTTTTTAATATCTTTAAAAGAAGATAAGAAAAAGGATTCTTTGTTTGTAGTACTAGAGAAATCGGCTTTAACTTTATT
ACTTACATAACTTCTATACATCTCTTAATTGTTAAACGTTATTTGATTGTAAAGGTTTTTAACTTTATTAGTCATTAAAT
CCTCCGAATTTCCCTAAAGATAATCGTTAGCTACTTATACATCCGAATACTCTTTAAGTACACGATCTGTATTAATATTA
ATATTACTTTCTAATGAATACCCGAAAGACTCGTTTTTAATACTTCATTCGTTGTATTTATAATCATTAAACAACCCGTT
ATAAATGTTATATATAGAAAAATCTTTAAATAATAAAACAATATCTCTTATTTTTAAATCTTCTATTTTTATATTTTTAA
GGTCTAAAGAATAACAAAAATCCTAAAAATCTTATTCGGCCTTAGAAATCGGGTATGCACCTTTTAAAAAACCTATTAAT
ACGCATGTTAAATAAACAAACACACTTAAATAATACATTATATAAGAACGACTACTTAATAATATTTTTAATTTATCTAA
TAAGACTAATAAAATACTTTATATTTTATAAGTTTTATTTAACAAGTTATTAAAAATATTAAAAATCCTTTCATAGTTTA
ACGAACTTTTATTATATATTAATAAACTTTTATTCTTTTTATTAACTGTATTTTTATTAACTGTATTTTTAACAGTATTT
TTATTTACATTCTTTTTATTAACAGTATTTTTATCTGTATCTTTATTAGTATTTAAACCAATAGTATTTATAGGATTAGT
AATAGTAGAAAGTTTTTTCTGTTTATCTTTTTTCTGTTTATCTTTTTTTGTAGGTTTATTATCTATTATTTTTACGGGTT
TTGTTTCTATTATTTTTACAGGTTTTATAGATTTTACAGGATTTGTATTAACAATTTCAGGAAAATATTCTTTTAAATCT
TTCTTACTAACATCTGGATAACACCTTACCATATAATTTAAGAATTCTTTTATACGATTATTTATTACAAAATCTTTTAG
TACTATTTTTCTAGATTTATAACTGTAATAACTATAACGACTTATAACTATTTCTGGATAAATACCCTTTATAAAATCTA
ACAACTCCTTATAACTATTAATATTTATACCACCTATTTTATTTTATAACACCAATTTCACGAAATTAAACACTGCCTTT
TTATAATTTATATTTATAAACTCTAATACTTTACGATCTTCCGAAAGGTTTGTAGAAGTACTAACTAATCTTACGTTAAT
GCACGCTTTAACACCATTTTTACCAATCATTTACAATTTTTATACATATTTTAATTTTAATTTTTCTTTTATTCTTTTAT
TTTGTCTTTATTATTTTATTTAACAAAACTGTTTTAATAGTTTAACATTTAGCCGTTATGCAAACAGGATAGAGGAGTCG
CACCTCTTTATAATCTTTATTATATCCCATTATAAAGAGTTTTTACCCCTCTATTTATATAACGTTCTAGTGTTATACAT
TGTACTAACCACCACATTTTTTACGTTTTATTTCCGTATTACTTAATTCTCTAAAAAACAAATCCATGTTAAATCCTATT
ATTTTTACTTTTACATATTTAATAAAACCTTCTGTTTCTATAGTACGAGGCACTAAACGACTAATAGTTACACGATTCTT
TAAGTTTAATATACTTTGTTTTGTTAATTTCACTGTCTTTGCAGGTTTATAACTATACACAAAATCTATTAGACTTTTAT
AATCATCAAAGTAGTTTAACGGTATACCGTAACGTCCTAATACAGTAGAACATAAAGCGGCTTTAATGAAACCTCTTATA
CTAGTTTCTATATAACTTTTATATTGTTTAGAATCCGTATTAAACACTCCAAAAGCGTACACAGGTAATGTTGTTATACT
CATTATTTTACGTATACGTCTATAATCACAAGCTGTATTTCATGCTTGTGTATCTAACAAGGTATTTAAATCATTCTTTA
TAATACGTCTTTTATTGTTATAAGCCAATGTATATTTTTTATCTCTAAAACTAGACACCACGTTACCACCATCTTTATAA
ATATCAATTGCACTACGTAGACCAGACTCTACAAATTCAAAACTTTGTACTTTCGAGTCTATTAAACCGCTTATTTCAGT
TGATAAGAAACCATTATCTAAACCACGTGTTTAATAACCTGTTAAAGCCAATACTTTACCACTATATAATAATTGACCTC
TTGTTTTTATACTAATTAAACCTTCAGAATCTTCGGTTTTTATTTCCAACCCTAAATGGTTTAGGTCATCGCCTTCTATA
TCAGTTAGATATAATCTTACACGTCTATAAATTTAAAGTAAAACTGTATACTTTTCATCTAAACCTAATAATAATAACTC
TAGATTCTTAATATTAGTTAAAAAACCATCCGTTGTTACAGACAATACTTTACTACCTAATCTTTATATGTTAGTTATAC
ATTCTCCTATTAAAGCTCGCACAAATCCTGTAATGTAGCTTGCTAGTAAAGGGTTTAATAATTTACCTCCTTCTACACAA
ACGTAAGTTTTACTTATTACATTATAACAACTTTTACCACTTAAACCCATCGCGGTTAAACCGTAACAAGAATTACCCAT
TTCTTTATACATTAAATTATAAAACGTTTTCTTTAGATATTAACGTCTTTTATATTATAAATCCTTTATAATATCTCTAA
ACGGTGCTGTATAATCCATATTAATACTATCTACATTTTTACCTTAATAACAACCTTTAAAAAGTACTAACACACACTTT
TTTATTTTTAATATACACCCCTAAGACTTTAAAGCTACATATTCCGCACCTGTTATTATACTAACACCTTTTAAAGGATA
GATATCTGAATTTTTATCAACTGTAGTCGGTATACAAGGATATTTTGTATTTTCTAGGAATTTATATTCAACTTCTAATA
CAATATAATTAAAGATCTAGTCGTAATCGGTAAATGTATTATACTCTTTTTTATTTATTATCCTTACTTTTAAATATAAT
AGATAACCTAACAAAGACATTACCGTAGTATAAGCACTTGTTAAATTATAATCATATTATACATTACCTAATTTATCGAC
ACCGTACATTATAGATTCATTACAACCCCCTCTATAAGCTTTAACAAAAGGTATAAATAATTCCAGTTTAGGCATCATTT
GTGTTTTCTTAGGAGTTATATAACTTCCTATATTACCTAAAGAAACTCCTTAATAATCATAACCTTTATAACCTTTTTCT
TCTTATTCCTTATATATATAAGCCTTTCCTATAGATGCCATTGTTAAAGGAACCCCTATTTTATATTAGTCAAAATAAAA
ATCCGTCATAGAATTTACATGTTTTAAAGTTATCTTAGAATCTTGTTGAGCGTATAAATCAAACAATTTTTTATCATCCT
TTAAAAGAGTCTTTATATTTCCTCTATAAGAACCGATATCTACTTTTTCATAATCCTCTCTATATATTTTTCCAACAGCT
TTTAAACTTTTACATCCTTGCAGAGCTATTAAAATAGTATCTCTTATATGAATTTTGGTTGTTAGACCTTCAACTATTAA
GGGTTTCTTAACAGTTACAAAACTTCTTTGTATAATACTTAATAATTCTTTTAAAGTTGTAAAACTATCAAGCATACTTA
AATCTGCCGTAGACTCGTGCATACATATATAAGTTAACCTATTTATACTTATACTCACATGTTTGTTTTCCGTTAATAAT
ACATTTATATAGGACATTAGTTTAGACATTATTTTTATTATTCTTTCATTTAATGTTACTCCTAATTTTCCATATTTGTT
TAATAATATTTCATTTATATAACCTAACAATAAATTTAAATAATAAATGTTACCGTCACGACATAGATATTCACCATCCT
TTAAAAGATCCATTCAACTATATTTATCTATTTTAGAACATTTATATTCTTTAATAATATCGTTATTTACGTACCTAATA
AGATTGTTAACAAAGGTTCTTTCTAACGAGAAATAATAATTATCGGGTAATTCTTTATACTTAGACCCTAATTTTATTAA
AGTTTCTTTTAATATTAACACAAAATCTGTATATTCCTTGTTTTCTAAAAGAGCTATTTTACTAATTATATTATCACTAC
ATTCAAGTAATTTACCTATAATTCATTCTTCATTTATACTTATACTATTATTAGTTTTATGTTCATTAAAAAAGTCTTTT
AAACTATTTAATAATACTTTTGGTACCTTTACATAACATCCTATATTACCCGATAACTGTACCGACAATAAATCATTTTT
ATTCTTTTTAGAATCGTATAATTTATATTCACTATCAAAACCTATATAATTGTTTAATATTATACTAATACTACGTCTTT
GTAGTTTATGTTTTATACACAGATATAACATTTTCAAGATACATTGTTTTAACACCTTTACATTAGCATTAAAATCATTT
GTTTCCTTAATCTTTAACATTTTTACACCCACTTCTATATCTTTTAATATATCTAACACCAATAATCATATTATATAATA
CACAACACGATTAAAGTATAACGTAAATGGTTTTAAAACAAATTGCAGTTCTAATTTTCAAGACTCTTTTTCTGTTTTCA
TATAATTTTCACATACCTTAGTTATATATTCATCCTTATAACGTTCAACCTCTAGAGATCTTTTTAAATCCGATAATTCA
CGTTCTATTTCTATTTCTATATTAACTGCCGACTCTTTACTATAACTTTCTTATAGTAGGCTATATAAGAGTTTATAAAA
CTATAGAACTCTTTACTAGGAAGTACTACTAGCTAGACATAGCTACTAACGTTTGTATATTTGTTGCAAACTATTTATTA
TGCATAAACAATAAGGTCTTATAGTACAAGCTATATAGATACCTTTAGTTCTTACCTATGCTTATTCGGCTATTCTAGCA
CATTAGTATAGATTTTGTAACTAGTCTTAGGTTAAGCCTAGGCTTAGACAGCTGTCTATACAACGCTATCCTAGTAGTAG
TTAATTGCTATATAAAGCATAGCATATTTATCCCTACTTAAAAAATAGTTATAGCTGCTAAGGTTGCTTAACTTATCTAT
AACTATATAAAGACTAAGTTTAGTATCTTAAAAGTAATTGTTAATAATAAGGATAGCTTATTTACTAGCTAATTTTAGTA
GGAACTAATATAACTTTAAGGGGTTTAGCTAATAATGTTAATAGTATACTACTTATAAATAGATAGTAGTACTAAGATTC
TTAACTAAACCTTAGAGCGCTTCTTACAAACGTTCTATAGTTGTTTGCAACACTAGTAGACGCAGGTATTAAGTACAGTA
AAGTTTGTGTATAACAACGCTTGCTATACTATAATAAAAACCTTTTTGTTTTATACGTTATACGCATACTACCCTTGTTT
TATAGACGACTTCCCCTTTACTAAGGCTGTAGTAAAGGGCGTGCAAAAGCGTGTTAGTTAGCTATAAGCTATTTAGTAGA
AGCTAGAAGTGTTATAGGAAAAAGTGATTTATTAATAGAAGAAGGGCTATAATAAACGACGCTTATATAAAGACTTTATT
AAAGGAAAATTTATAGGTTTGTTAATAAAGCACTTAAACCTAGCCGGCTTAAAGAAGCTAAACTTAACCTTCTTACGCGT
TTATATTATAAAAAAGCTAGGCCTAGTTATATATTAGGTTGCCTTGCTATTATAGTACGTACGCTAACATAACATGTTTT
ACGTCTTCTGCCTTAAGCTGTAAACCGCTATAGTAAAAGACAAGGAAAAGCTTTTGTTCCTAGAAATAGTAGAAGACTAA
AAGAAGTATAAGGTTAAAGACATTATTACTTACTTTAGTAAAGGCTTATAGACCTAGTTCTTAGTAAAATAAAAAGGCTA
GCCGGCTAAGTATAATACCTAGAAACCTAAAGAGCACCTAGCGTACGCTAGCTATAAGTTACAGTCTTATTAAAAGACTA
TAAAACGCACTTATAAGAAATAAAAAGACTATAAGGCAACGGCTAGCTGCATGCTAACTAATCGTTAGTTAACTACTCTA
GTTATTTCTTACGCAATTGCGCACTATAAACTACTCGTTCCGGCTCTAAAGGCGCCCTCTAAAGCTATAAACCTAAAACA
TACTATTAGTAAGCTATTGCTTAGCTACTAGCTACTTATTACTATTCTTCTTTATAGACGTCTTTCTTACTCTCTTATTT
CTCTTCTTAACACTATCTTTCTTATTTCTTTTCTTGCCGCTAAGTAAGCTTTCGCTAGCTAGCATATAGCTACTACTAGC
TGCTAACTAGCCGCCTACTAGCGTACTCTTACTAGATGCTACTTTATTACTACTACTAACTGCCGCAACCGCTTTACTAC
TGCTAGCTACGGCACTAAGAACGGTCTTAGCGCTACGCTAGCGCTTAGCTAAGGTTAGTAACTTAGCGTAAAACCGTCGC
TTACTAGGCGCCGCTAAAGGCAGCGGCTAGGGAAAGACTACTACCTAGTTAATTTAGGCTAGCTTAACTAGGGCCGCTAT
AGTTTGCAGAATCCGCTTAGGCAGCCTTTTCGCTCTTACAGTGTAGTAAAGCGTGCCGCTACGGCTAGCTTAGATAGCTA
TAGCGCGCTAGGCCGGGCTAAGTATAATAGAATAAGGATTAGCCTAGGTAATAGGTTAGCAATAACTCAACGATAGAGAT
TAAAGAACTTGCTATTACTTTAAGAGTAGTAGCAACTTAAGTCTACGCCTACAATAGTGTGCCTACATCTAAGGACGTTA
GCGGCAAGAGCTGGGCTACCTTTGCTAACCGCTACGCAAGCGTTAGAGTAAGCTCTAGCTCCTACTAGTACTAGTAGAGG
ATACTAAGGCGTAATACAGCCTATTATGCCATCTTAAAACGTTTGCGCTAAGAGCGCTAGTTAGTTACTAAGGGCTCTAA
CTTGTTTTCTTATAAGGCACGGCTAAGTTCCTTAGTTACTACCGTTAAGGCTATTAACCTTTAGACAATTACTATGCAAT
TGCCTAGCGCTATAATAATATTGTTAACCGTTATCTACTAAAGTAGTAACTTATTCGTACTAGCTAGAAATTCTTAAATA
TATTAGGCTAAGCCTTTAATCTTTTTAAAGAGCTATTAGTTAGTAATTAGCTACTAGCGTATACAAGTTAATATACTTAC
TAGCAAGCATAATATATTATTAGCTATATAACTAATATAGCACGCTAAGTTCTTTAGTATAGCTATATATAAGAATTTAT
AGTAGACGTCTAGATAGGCCTTAAGAATATAGTTTAGATATAAAGCCTACTATAAGGTTAGCTATTGTTTAGCAAACGCT
ATACTAGCAAAAACCTATACTCTTAGAAGATAGTGCATATGCCTAGAAAGAGCGTTTTATAAGGTTTATATCTATAAAAA
AGTTTATTAAGACTTAAAAGCAGCTTTAGTTAGATATTATCTATAAGCGATTATTAGCTAGTTGCTACACAAAGTCGCAA
ACTATTACATTAACCTACTACGCAAGTAGGATTAAAAAAAAAAGAGCTAAAAAGGTAAGAGTAGTCTTATAAGTATAGAT
AAATTCGTCTTAAATTATAAAATGCACCTACTCTTTTATACTTTAAGGTAATAAAGAAGCTACGTTATTAAACGTTTAAA
TGCGTCTTAAGAACTTACTTAACCTTACTTTAATAGTAAGGTAAGAAACGTCTAAAATTAAATAAAAAAACGTCTTAGCG
GCAGACTGCCTCTACTATCTAGTAAGCGATAGTTCTATAATTAGCAGGCAATAAACAGCTGCTATTGCCTCTATTCTACC
TTACTAGTAGTTAGAAGTTATAAGCCTTACGCCGCCGTTTTTAGTTAGCGTACACTGCACCTTTATGCACCTAGTATCTA
AGGCTAGCCCCTTTATAACACCTATTAGCGGCAACCTAAGCGTTCCCTAACTAAGATCTAAGCTGCACGCCTTTTAAGAA
GCTCTAACGAATAAGACAACCTATGCATTAAGCAGGATCTAGCGTTTACTACTGCTATAGACTAAGCAGTACGTGTGCGC
TTCTACATTACCTAAATGCAGTTGCACAAGCAAGCAGTCTGCGACCGCTTAGCAATAGCTAATAACTTAAAGCGCTTAAC
TTTTTTTTCTAACTTTATAAGGGGAGGTTTTTTAACAAGCAAATGGCTGCCGCGTATGCACCTATAGGCTAACAAGGGCG
TTACTTAAAAAGAGAGAGGATAGTGTAAAGGTATTCTACACACGCGTCCTTACGCACTGGTTTAGCAACTAGTTGTTTAC
TAAGCGACGAACTTAACAAACTATCTTAACACGTTGCATAGGACTAGCATAGCTACTTAGCTGTGATACGCCCTACTAGG
TTTGCGCTACACTATATCTTCTAGCTACGTATATATTAGCTGGTAGGCCTTCGCCTACTAGTCTTTTATAGTTCGTTAAG
TTAAAGTCTTAATACAATAGTACAAACTAGTTAAGCCTTTATAACTACGCATTACACACTAGCCTTTTATACTTTGCCGT
ACTTAATACTTGCGTCTACTAGTATTATAAACAACTATAGAACGTTTATAAAAAGCGCTCTAAGGTTTAGTTTAAGATCT
TAGTATTACTATCTATTTATAAGTAGTACGCTGTTAATATTATTAGCTAGACTCTTTAAAGTTGTATTAGTTCTTACTAA
AATTAGCTAGTAAATAAGCTATTCTTATTACTAACAATTACTTTTAAGATATTAAACTTAGTCTTTATATAGTTATAGAT
AAGTTAGGCAACCTTAGCAGCTATAACCGTCTTTTAGGTAAGAATAAACATACTATGCTTTATATAGCAATTAACTACTA
TTAAGATAGCATTATATAAATAGCTGTTTAAGCTTAGGCTTAACCTAAGACTAGTTATAAAATCTATACTAATATGCTAG
AATAGCTAAATAGGCATAGGTAGAGACTAGAGGTATTTATATAGCTTATACTATAGAACTTTATTGCTTATATATAATAA
ATAGTTAGCAATAAACGCGTAAACGTTAGTAGCTATATCTAGCTAGTAGTACTTCTTAGTAAAGAGTTTTATAGTCTTAT
AGACTTTTATATAGCTTACTATAAAGAAGTTATAGTATAGACTAATTAGCCTTACCTATAGCTTGTTTGCTAATAAGACA
ACAATGCAATCCTTATAAAATAAGGTGTTCTCTTTTTATAAATAATAGGTATTATTCCTTTAGCTTTGTCTAGCCTTTGC
AAACAAGTTGTCTAGTAATCGGTCTTAGCCTTAAGCGTTGCGAATAGTATTATATAGTTTAAGAGAGTACTAAGGTTATA
ACGGCCGTTCTTAGCTAGTAGCAACTTATGCCTCTTATACTAATAATAATAAAGCTTTTAACATAAAGAGCCTTAACAAC
TAGTCTACAATCTATAGTTTACTAAGAAGTAAGAAGAGTATATTATTATATATAATATTACCTTTTATATAGTTTAGTTA
GTAGGATAAACTATTTGCTAGGTTAGTAGACTTTAGGTAGTGCTTAATCTTAAAGTTAAACGCTAAAAGGTAGAATACTT
ATTAAGCAATTTAGTTTTAAAGATTTTTTGCTAATGCCTTAATAACGCCTTTTAGCGCTTAGTAGTTAGTTAAGACTATA
AATAGGTCTTTTAGACTTTTTAAATAGTAACGCTAGTGCTTTAAGCTTTTAATAATAGCTAAAAGCTTTTACTATTTTAC
TTTTTACTATATCTTATAGGCTATTAGCTTATATAAGTAGTAAGCAACTAGTTGCTACTTGCTGTTTATAAGCTAGAAGA
TAATGCTAAAGATAGTATAGCTTGACGCATTTGTTTCTACCTATGTAGGCTTTATGTTATTATAGTAATAGAGAATTGTT
ATTATTATAAATACTATCTTTAGCAATTTAAAAGCAATCTTTGCCTTTTTAGTTAATACAAACGGTTGCGTAGCAACAGC
TCTACGCTTACGTAGCAAACTAAGGCCTATCTTTATTAATTCTATTAAGGCTTGTATAATGTAAGAGTAGTAAGAAATAA
AGCGTCTATAAAAGTTTACAAACCTTAAGAAGGATTATATATCTTATACGCACTTAAAAGCTTTTTATTTAGTAATAGCT
TTAACTTATTTAAGGTTTATAGCTAGCCCTTTTATAATAACAATAAACCTTAAGAAATTAATTTTCTTTTTAAAAAATTT
GCACTTTTTAGGATTTATATATAGCTGCGCAGCCTTTAGCTGCTTAAAAAACTAATTAAAGGTGCTTCTTATACTTCTTT
TTAGTTTAAAAGTAGATTAAAATATTATCTAAGTATACTTTATAAACTATGCCTACTAGCCTTGCTAGTATATAATAGAT
ATATACTTAAAATATATATAAAAGGCTAGTATGCAATGCATAGTTACAAAGGCTTAACTAGTTTGTACTGTTGTATTAAG
ACTTTAACTTAACAAACTATAGGAGATTAGTAGGCAAAGGCTTGCTAGCTAATATATACATAGCTAGAAGATGCAGTGTA
GCGCAAACCTAGTAAGGCGTAGCGCAGCTAAGTGGCTATGCTAGTCTTGTGCAACGTATTAAGATAGTTTGTTAAGTCTG
CTGCTTGGTAAGCGACTAGTTGCCAAACCGGTGCGTAGAGACGCGTATGTAGAATACCTTTACACTATCCCTCCTCTCTC
TAAGTAACGCCCTTATTAGCCTAAAGGTGTATATACAACAGCCACTTGCTTGTTAAAAAACCTTCTTTTGTAAAGTTAAG
AAAAAGAGTTAAGCGCTCTAAGTTATTGGCTGTCGCTAAGCGGTCGCGGACTGCTTGCTTATGCAACTGCATTTAGGTAA
CATAGAAGCGCACACGTACTGTTTAGTTTATAGCAGTAGTAAACGCTAGATCTTGCCTAATACACAGGTCGTTTTGTTTG
TTAGAGCTCTCTAAGAGGCGTATAGCTTAGATCTTAGTTAAGGAACGCTTAGGTTGCCGCTAATAAGTGTTGTAAAGAGG
CTAGCTTTAAACACTAGGTGTATAAGAGTGTAGTGTACGCTAACCGAAAACGGCAGCGCAAAGCTTGCAACTTCTAACTA
CTAGCAGGGCAGGATAAAGGCAATAGCGGCTGTTTATCGCTTGCTAATTATAGAACTGTTGCCTACTAGACAGCAAAGGC
GGTCTGCTGCTAAGACGTTCTTTTGTTTAATTTTAGACGTTTCTTACCTTGCTATTAAAGCAAGGTTAGGCGAGTTCTTA
AGATGCATTTAAACGTTTAAGAACGCAGCTTCTTTATTACCTTAAAGTATAAAAAAGCAAGTGCATTCTATAATTTAAAA
CGAATTTGTTTGCACTTATAGGACTGCTCTTGCCTTTTTAGCTTTTTTTTCTTTAATCTTACTTACGTAGTAGGTTAATG
CAACGGTTTGCAACTTTGTATAGCAGCTAGCTAACGATCGCTTATAGACAATGTCTAACTAAAGCCGCTTTTAAGTCTTA
ATAAACTTTTTTATAGATGTAAACCTTACAAAACGCTTTTTCTAGGCACATACACTGTCTTCTAAAAGCGTAGGTCTTTG
CTAGCATAGTGTTTGCTAAGCAATAGCTAACTTTATAGTAGGCTTTATGTCTAAACTACGTTCTTAAAGCTTATTTAAAC
TTTTACTATAAATTCTTATATATAGCTATACTAAAAAACCTAGCGTGCTGCGTTAGTTATATAGCTAATAACACGTTGTG
CTTACTAGTAAGTGCGTTAACTTGTGTACGCTAGTAGCCGATTGCTAACTAATAGCTCTTTAAAAAGATTAAAAGCTTAG
CCTAATACATTTAAGAATTTCTAGCTGGCATAAACAAGTTGCTGCTTTAGCGGATAACGGTTAACAATATTATTGTAGCG
CTAGGCGATTACGCGGCAATCGCTTAAAGGTTAATAGCTTTAACGGCAGTGACTAAGGAACTTGGCCGCGCCTTGTAAAA
AGATAAGTTAAAGCCTTTAGCGACCGACTAGCGCTCCTAGCGTAAACGTTTTAAGACGGCATAATGGGCTGCATTGCGCC
TTAGTGTTCTTTACTAGTACTAGCAAAAGCTAGAGCTTACCTTAACGCTTGCGCAGCGGTTAGCAAAGGTGGCCTAGCTC
TTGCTGCTAACGTCTCTAGACGTAGGTACACCGTTGTAAGCGTAGACTTAAGTTGCTACTGCCTTTAAAGCAATAGTAAG
TTCTTTAATCCTTATTGTTAAGTTATTACTAACTTGTTACCTAGGCTAATCCTTATTCTATTATGCTTAGCCTAGCTTAG
CGCGCTGTGGCTGTCTAAGCTAGCTATAGTAGCATGCTTTATTATACTGTAAGTGTAAGGGGCTGGTGTGCAATGCGTGG
TCACGAAGGCTTAACTGGTTTGTACTGTTGTATTAAGACTTCAACTTAACGAACTATAGGAGATTAGTAGGCAAAGGCCT
GCCAGCTAATATATACGTGGCTAGAAGATGCGGTGTAGCGCAAACCCAGTGGGGCGTGGCGCAGCTAAGTGGCTGTGCTA
GTCCCGTGCAACGTGTAAAGATAGTTCGTTAAGTCCGCCGCTTGGTAAGCGACTAGTTGCCGAACCGGTGCGTAGGGACG
CGTGTGTGGAATACCCTTACAGTAAGAGTAAAAAGGCTGCCTAAGTAAATCTTGCAAACTATAGTAGCCTTAGTTAAGCT
AGCCTAGATTAACTAAGTAGTAGTCTTTCTTTAGCTGCTGCCTTTAGCGACGCCCGGCAAGCGATAGTCTTGCGCTAAGT
TGCCGGCCTTAGCTAAGCGCTAGCGTAGCGCTAAGACTATTCTTAGTACTGCAGCTAGCGGTAGTAAAGCGGTTGTAGTA
GCTAGTGGCAGTAGTAAAGCAGCATTTAGTAAAAGTACGCTAGCAAGCAGCTAGTTAGCAGCTAGTAGTAGCTATATGCT
AGCTAGTAAAGGCTTGCTTAGCAGTAAGGAAAAAGACAAGAAGAATAGTGTTAAGAAGAGAGACAAGAGGGTAGAGGGGA
CGTTTGTAGAGAAGGATAGTAATAAGTAGCTAATAGCTAAGCAACAGCCTACTAACAGTATGTTTTAGGTTTGTAGCTCT
AAGAGGCGCCTTTAGAGCTAGAACAAGTAGTTTATAGTGCGCAATTACGCAAGAAATAGCTAGAGTGGTTGATTAACAAT
CGGTTAGTATGCGGCTAGCCGTTGCCTTATAGTCTTTCTATTTCTTATAAGTGTGTTTTATAGTCTTTTAATAAAACTGC
AACTTGCGGCTAGCGTACACTAAGTGCTTTTTAGGTTCTTAGGTATTATACTTAGCTAGCTAGCCTTTTTATTTTACTAG
GAACTAGGTCTGCAAACCCTTGCTAAGGTAAGTAATAATATCTTTAACCTTATACTCTTTTTAGTCTTCTACTATTTCTA
AGAATAGAAGCTTTTTCCTGTCTTTTACTATAGCGGTCTACAGCTTAAAGCAAAAGACGTAAAACACGTTGTGTTAGCGT
GCATACTACAATGGCAAGGCAACCTAATACATAACTAGGCCTAGCTTTTTTATAATGCAAACGCGCAAAAAGGTTAGGTT
TAGCTTCTTTAAGCCGGCTAGGTTTAGGTGCTTTGTTAATAAACTTATAAATTTGCCTTTAATAAAGTTCTTATATAAGC
GTCGCTTGTTATAGCCTTTTTTTTATTAGCGAATCGCTTTTTCCTACAACACTTCTAGCTTTTGCCGGATAGCCTATAGC
CGACCAACACGCTCTTGCACGCCTTTTACCGCAGCCTTAGTAAAAAGGAAGTTGTTTATAAAACAAGAGTAGTATGCGTA
CAACGTATAGAACAAGAAGGTTTTTGTTATAGTGTAGCAGGCGTTGTTGTACGTAAACTCTATTGTACTTAATACTTGCG
TCTACTAGTATTACAAACAACTGCAAAACGTTTATAAAAAGCGCTTTAAGGTCTAGTTAAGGATCTTAGTGCTACCGTCT
GTTTATAAGTAGTACGCTATTAACATTATTAGCTAGACCCTTTAAAGTTGCATTAGTTCCTACTAAAATTAGCTAGTAAA
TAAGCTGTCCTTATTACTAACGATTACTTCTAAGATACTAAACTTAGTCTTTATATAGTTGTAGATAAGTTAAGCAACCT
TAGCAGCTGTAACTATCTTTTAAGTAAGGATAAACATGCTATGCTTTATGTAGTAATCGACTACTACTAGGATAGCGTTG
TATAGACAGCTGTTTAAGCTTAGGCTTAACCTAAGACTAGTTATAAAATCTACACTAATGTGCTAGAATGGCTAAATAGG
CATAGGTAGAGACTAAAGGTATTTGTACAACTTATGCTGTAAAACTTTATTGCTTATACATAACAAATAGTTTGCGATAA
ATGTATAAACGTTAGTAGCTATATCTAGCTAGTAGTACTTTTTAGTAAGAAGTTTTATAGTTTTGTAAACTCTTATATAG
CTTACTATAAAAGAGTTGTACTATAGACTAATTAACCTTGCTTGCAGCTTGTTTGCTAATAAAACAACAATGCAATCTTT
ATAAAACAAGGTATTCTTTTTCTATAGATAATAAGTGTTGTTCTTTTAGCTTTGTCCAGCCTTTACAAACAGGTTGTTTA
GTAATTAGTCTTAGCCTTAAGCGTTGCAAATAATATTGTATAGTTTAGAAGAGCACTAAGGTTGCAATAGCTATTCTTAG
CTAGTAGTAACTTACGTCTTTTATACTAATAACAACAAAGCTTTTAGCATAAAAAGCCTTAATAACTAGTCTGCAATCTA
TAGCTTGCTAAAAAGCAAAAAGAGCACGTTATTATACACAATGTTACCTTTTATATAGTCTAGTTAGCAAAACAGACTGT
TTGCTAAGTTAGTAGACCCTAGGTAGTACTTAATCTTAAAGTTAAACGCTAAAAGGTAGAACACTTATTAGGCAATTTAG
TTTTAAAGATTTTTTGCTAATGCTTTAACAACGTTTTTTAACGCTTAGTAGTTGGTTAAGACTATAAATAAGTCTTTTAA
ACCTTTTAAATAGTAACGCTAGTATTTTAAGCTTTTAATAATAGCTAGAAGCTCTTACTATTTTACTTTTTACTGCATTT
TGCAGGCTGTTAGCTTGCGCAAGTAGTAAGCGACTAGTCGTTACTTACTATTTGTAAGCTAGAAGATAATGCTAAAGATA
GCGTAGCCTAATGCATTTGTTTCTACTTGTATAGGCTTTGTATTATTATAGTAGTAAAGAATTGTTGCTATTATAAATGC
TATCTTTAACAATTTAAAAGTAACTTTTGTCTTTTTAGTTAATATAAACAGTTGTATAGCAATAGCTTTGCGTTTGCGTA
GCAAGCTAAGGCCTGTTTTTATTAACTTTGTTAAGGCTTGTATAATGTAAGAGTAGTAGAAAATAAAGCGTTTATAAAAG
TTTGCAAACCTTAGAAAAGATTGCATGTTTTGTATATACTTAAAGGCCTTTTAATTAGCAATAGCTTTAACTTGCTTAAG
GTTTATAGCTAGCCTTTTTATAATAACAACAAACTTTAAGAAATTTTTTTTTTTTAAAGAATTTATACTTCTTAGGATTT
GCATATAGCTGCGCAGCCTTTAGCCGCTTAAAAACTAATTAAAGGTGCTTCTTATACTTTTTTTTAGTCTAAGAGTAAAT
TAAGATATTATCTAGGTATACCTTATAGACTATGCTTACTAGCCTTACTAGTGCGTAATAAATATATACTTAAAATATAG
CCGGCGCGTTAGTTAGTTTAAAAGGTATAATATAAAACTTAAAAAGCCTATATTTTGTTTAAAAAGTAGTCTTTTATTAA
TTAAAAGCTTTAACCTAGATTTTATAGTACGCTTTCTTTATATCTACCTTAAAAAACACCTTTACGTTATCTAAGCAATC
TAACAGCTTACTAATTAGTAAAAGAGAGTAGTAGTCCTTCTTAGTTACTTAATTTAAACCTTAGTAGTTAATGTATATGC
AAAAAGTACTATCTTTTTTTAAGATAAAGATTACTAAGGCTTTAGCTAGACTATTGCTATAAGCAATCCGCTTATTTGCT
AACAACTTATTAATAAAGCAGCAAAGCTTTTTTTGCTAAGCAAAAGATAGCAAGTATAAAGGGCTATATAGCACCTTTAC
GCTGTCTTTTAGCTTAATTAAGTGCTTTGCGTCTGCTAACAAAAGCAGTTTTTTTACCTTGTTAGTATTAAACACTTTAG
CAAACGGTTATATATAAAACAGTAGTTATTAGCTAAAGTCTAGTAAAGTTAGATTATTGTTTATAGTAAGAATGTCTAGT
TTATAAAGACTTAAATCTAACTATGTTAAGTAGATAGTAAACAACTTTTTGCTATTATATAAGCATTAACTTATTTGCTT
AAAAGTTTTAAAAACTATAATAACAAATAACTAGACTTGTTAAATAGTGTTAATAACAACGCTTAAAAACCTTAGTTTTT
TATAACTTAAAATAATGTTTTTATAGTTAGCGCCTACTTAGTAAACAGCTATAAAGACTTGTATTAATGCGTAAAAAACT
CTATTCTTTATTAGCACAATAGTTAGCTTATATAGGCTATAAGCTTGCAATGCTTTCTTATTAATAAAAACTAGGTTTAA
GTTTAAGTGCTACTAAAGTAGCTTTAAACTAAGCTGTTAAATAACCTTTAAGTTAACTATATTTAAGTTAGTATAAAAAT
CTAGGTTTATAACAATAGTAGCCTAGCAATTACTAAGCGTTTATGCCTTAGCCAAGGTATAGCAGCAAGAAATTACATTC
TTAGTTAGCTACGCTAGTAAGGTTAATAAAAAGCAAAGCTTCTTTATTAACCCTGCTAGTTTTCCTAGTTAGAGTAGGTT
GCCTTTTAGTCGTTAAGCTCTTAAAGACTATCTTCTAGTTTCGCTTAAAGCTTCTTAACCTATACGCAAGTTTTAGGCTT
AAAGCACTTCTAAAAGGTATGCTTGCTTTTGCTACAATTCTAGCACTTTAACGCAACGTTAATGTTGTTTAAACTGCTAA
GGTTAGCAAGTTAGAAAGTAGACTAACCTTAGCCGGCAACCGGTTGTAGGCTTAGGTTGCTCCTTATAAGACTGCAGTTC
CCTATCTTATTATTATCGCGGCGCTATTTCTTTGTTAGCCTGCTAGCTAGCACGCCGTTAACCATAACCGCCTGCTTCTA
ATCGTCCTGTCTTTTCTTTTGTTCCTAGCCCTAGGACTAATACTCTTTGCAAGCATTAGCAATCTTTATTACTATACTAA
AAGACTTGCCGATAGTCTTATTCTAATACCACTTTGCTAAGTAGTCGTTAAGCCCTCGCCAATACCTCTAAGCAATCTCG
CTTGCCTAGTCAGAGGTATTGCCAATCTTTCGTTGCAAGTGGTCCCATTTCCGCCAGTACGCCATCGGCGACTCGCCGCC
CTGCCAAAGCGTCCAGCTTTCCTTGTAGATGCGGTGCATCTAGAATTCAGGGTTTAAGTGTTCCCAACGGATGAACGCGA
CGAAGTGCGTCTATGTGCAGCGTGTAACTAGGGGTTTACTGGCGCGGAGTCGGTCGCAGTGCTTTCGCCAATCAGCCGCC
AGTGCAGTAGTCAGCCGACTACCTGCCTAAATAATCTTTATGTCTTTCAACGCGTCGCTGCGTGCATTAGTGTTGTAGGC
GTCCTCTATCGTCGCCAACCACTCTTCCGTCTTTGTAGCAGAGGCACCAATTTCCAGCCTCTTAATACTATATTGCGGTG
GCTTGTTGTTACGGTAGCGACTGCTAGGCAGTGGCCCCGTAACCCTTGCGGCTATAATGTTGGTCAGTGCCTCTAGCGTC
TGCATAATGCGAGTGTATTCATCGCTTTGCAGCTGCTTTTTGGCCGGCGAGGTGTCGTTGAGCGGCAAGGTGTCGTTAAG
CGGCACGTGTACCGGTCTTGTTTCTGATTCGACGGACGGGGTCGGGGTGCCTGCAGATGCTGCGCGCAAGGTGTGGCTGC
CGTGCATTGGCGTAGGGGGTGTGGCATTGGCACGTCCTCGGCTTCTGACAGTTCGCGTGCTGATCGCGGAGTGGCCGCCC
CATGATCGGACATTGCTCCTCGTGGAAAAGAAGTTGAAGAATGTAAGGGGCTGGTGTGCAATGCGTGGTCACGAAGGCTT
CACTGGTTTGTACTGTTGTGTTAAGACTTTAACTTAACGAACTATAGGAGATTAGTAGGCAAAGGCCTGCCAGCTAATAT
ATACGTGGCTGGAAGATGCGGTGTAGCGCAAACCCAGTGGGGCGTGGCGCAGCTAAGTGGCTGTGCTAGTCCCGTGCAAC
GTGTCAAGATAGTTCGTTAAGTCCGCCGCTTGGTAAGCGACTGGTTGCCGAACCGGTGCGTAGGGACGCGTGTGTGGAAT
ACCCTTACAGCTTAAAAGAAACGCAAATAAACTAGGCTATAAGCTTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNAAAAAGACGAAAAAACCGGAAATATATAAAAGAAGCAAAAAAAGAAGATTTATAAGGCGG
GAGAGAGGTTATATATTAAAACGGGCGTGTATTGGTAAATGGGCGAAACATTTATTTAAGAATTAAGTCACCTTAAATTT
GTATACAGGAAAAAACGCAGGTAGTCAAATTATATAAATTTATCTCATAGAAAAATAATAGATAAAAATTCACAAAGATT
TAGTATATAAAGCCAAGGTAAAAAATTTTTTTTATATTAAAAAGTTAAAAAATGAAGGGAAGGATTAAAAACCAAAAGAT
AATAAATAATTTAATAAGCCAGTTTATTTACTTATATAACTAAAGACCAAAAGACTAATAATAAGACCAAAAATAATAAC
CAAAATTAAATTTTAATAAAAAAAGAATCCTAGAAAATTTTTTTTTTAAAACCGCTTAAACAAAATATTAAAAAAACACG
CTACAAATATATCAAAGACATCTTTTAACCATAAAAAAAAGTTTAGACAAGCTTTAAGTATCAAGTAGAAAACAATAAAG
ACCAATTAACCATTGGCGCTTAATTACCATACAAAACAGTACTAAAAAACCTGTAGTGGCGGGGCATGTTAGAAATCAGA
TACAAAGTTTAACCACTGGAGAACGCGGTAAATGGGGTTTGTTGCTAGCAGTTACTAAAGTTATACCTCCTTGGAATCGT
TCACAGTGCATTCTCCTACCATAAAACAATTCTATAGTCAACAGACAACCTGCTTAAATAATCTTTAAACGATTTACACT
CTTAGAGGAGCGCTATAGGATTGAACGGCTCTCTCTAGTAGGCTAACACTTATCACGTCATTGTAGCAGAGACCTCGAAT
CTCCACCAGTCAAAAATATAATGTTGCAGCGGCTAGCGGTTGCGTTACCGTCCTATAGTCAGCGTTACAAGAAGCCATGA
GGGTATACATTTCGTCAGAGACTTCAGCGTTAGCATAATCAAAGTATAGTCATTGCTTTACAGCTTTTGCTGCGCGAGCA
GAGTGTCGGTGAACGTCAAGGTGTCGATAAGTGGCACGTGAGCCGCTCCTTTTTAAGCGTAGACGTAAGGGGTTGGGGCC
CCTGCAGCAATACTGCGCTCGGTGAGGCTTCCGTTCAATTTAGTAGGGGGTGGCAACGTCGCGTTAATCGGCTTTGTACA
GTTCTTGTCCTAATCGAGCAGTGCTGCGCCTTATTATCCGACATATCTTCTCAAAAAGGGGTNGTTGGTGANTGTAAGGG
GCTGGTGTGCAACCCTAAAACACGAAGGCTTAACTGGTTTGTACTGTTGTATTAAGACTTCAACTTAACGAACTATAGGA
GATTAGTAGGCAAAGGCTTGCCAGCTAATATATACGTGGCTGGAAGATGCGGTGTAGCGCAAACCTAGTGGGGCGTGGCG
CAGCTAAGTGGCTGTGCTAGTCCTGTGCAATGTGTTAAGATAGTTCGTTAAGTCCGCCGCTTAGTAAGCGACTGGTTGCC
GAACCAGTGCGTAGGGACGCGTGTGTAGAATACCCTTATAAAAAAAAGACTAAAGACTTAGTCTTTAAGAAATATACTTA
GCTTAGTTTATTAGTAAATATTTAAAGGCTAGTATAAAACTATAATGTTTATAGTAAGGTAAAGGGTTAAAAAAAAAGAA
AAAAAAGCTTATTAAAGCCTTTACTAGTCCTTAATTAACCTTAAGCTAAATTGTTTATTAACTTTATTACTAAGCTTTTA
CTCTTTTTCTTCTTTTAAGGCATACTATATAAGAACCTTTTAATAGTTATAAACTACCTTTTAAAGTCTATAGTACTAAT
TTTAATAAGGAATATTAAAGCTATTAATATAGTAAAAGCCTTAGCTAGATTTATCTCTATATATTATAGCCTTTTAAATT
CTATTATCTTTAACTAAAAACTTTGGTTTATCTTTATACTTTAAAAAGAAATCTATAAAAAGCTATATATTATACATAAA
CTCTTAATAACTTTCTACCTTTAAACTAATAGTACTATAAAAAAGGCTAATTAAGAAGTAAAAGTATTTTTATATATTTA
TACCTTTTTCTTTTAAAACAATTAAGCTTTCCTTTTACTTAGCGCTATAATAGCTTTAAATTCTTATACTTTCTTAACTA
CTAAACTATCCTTTTTTTTTCCTTTACACAGCTACTACTTTCTTATCCTTTTACTTTCTTTAAACCTTTTTTATAGCTCC
TTTCTCTCCTTAGCTACGTAAGGCTAAGTATAGCTTATAAAATAAAAAGACCTCTTTAACTTTACTTAAGCAGCTAGCTA
ACGCTTAAAAAACCTAAGAATGCTATACTAATAAATTCTATTAAGCTTTTAAATCTTATTAAGTAGGAGACAAAGTCTTC
TTACGCCTATAAAACATAAAGACTACCTACCTCTTAAAAAATCTTAATTAAGTTAGCCTTCTCTTTAAAGTTATTAGCCT
AGTTAAGTCTTATACAGTTAAGCTTAATACCTCTTTAAGGATTTATCCTATATTCTACGTTAACTTACTTTACCGCGCCT
ACTAAAACCTCTTCTTCTTTTAAACTACCCTTAAATTTAGCCCTCTTCTTATCCTACCCTTGAACGCTAACCTAGACTAT
AGCGCAAAAGAATATCTAGTTAAGCTAATCCTCTAATCTAAAAAGCGCAGCCGCGGCTTAAAGTCCTAGTTAAGTAAATA
AGCTACGTAGGCCCTACGTAGAAGCTGCTAACAAACCTTTTTACTACGGCCGCTTATAAGGCATTTAAAAAGGCCCTTCT
TACTCCCCTCTATAAAGAAGGAAGGGGGCTATTATAACAGGTTATAGCCTAATATAAGTCCTTAGCTTTGCTCTCGGCCT
AGAATAACTAGGTTGGCTAAGCTACGTAACTTACCACGCACCCTGTAAGAAACTATGGTAGGATACCTTAATTAAGCATA
AGAACTAAAAGGCACTCTCCTCCTCTCTCTTTAAGCTCCTACCTCTTAACTATAAACCACTCTATACTATGCGCGCCGGT
AACTTACTTAGATAGGAAGCAGGAGCTAGATAGAAGGGACCTAGTAGGGTATGAAGGAAGGGAAGAAACTACTTAAGGAT
AAAGGAGGTAGGCTTGCTTGTGTAAATATCTTTCTTCTTCTCTAGCTTAGTTTTTAACTAGTTTGATTTACTTAATAGTA
ACTTCTCCTATTAGGCTAGACTCTTACAACTAGGCTAATAGTGCTTTAAAATACCTTATTTTAAGCATACTAGCTAGGCA
TTACCTAGCTATTCCTGCTACTTTAGGGGCTATTAAAAGATATTTCTCTATTAGCAATAATGTTATTACTAAGCCTAGAA
ATAAGCTTCTTTCGGATATAGCTAAAAAATATTCTTTTATTAAAAAGTTAGAAGATTAAAGATTTAAATAAGTTTAAGAA
GGACTTAGGGTTAAAGAGTAATAAGGATAGTAAATAAGAACTTATTAGTTAGTTAGCTACTTAGTTAGTTATTCTTACTT
ACTTACTTGCTTATTATTATTTTTTTTTTAATTACTATTACTTACCTTACTATATTATTACTTACTTTCTTAATTTTATT
ATAAGTTAAAAGCTATTGATACTATTAGTAATAATAGTACACTAGTACTGCTAGTACTAGTTTTAAAGAACTAGTCTAGT
ACAAGTACTAGTACTAGTGTACTAGTTTCCTAACCCTAACCGCAGCAAAACACGGGGTTTCAGATTGCGACCTTATTCTT
GATTTCTGCCTTTCTATTACTCCGTACTCCGTACGGAATATGCTTTAATGCACAACCTTGGCTCGGCGATCAGGCAATGA
CGACGTCATGTACCTAAGGGCCGTACTTCGGAGGAGAGACCCCGCACCCATCACATGTCGGCAAATTACACGGGGCATCA
CGGAAAGTCGCAAAGAAAAGAAAGCAAACTCTACCGGAATGCATGCGAAACGGACAAGAGGGTGTGCATCTTCTAGCCGA
CATAGCCGAGAGGACGGTATTTCAACGCCGTCCGTTGACAACCATTTTCATTTGTACGCTCTCCTTTTCAACCCAACAGT
CAGCCATTCACTTCTTTTTATTTCCACCAAGGATCCCCAATCTGCCAATCCAACTCCAAAATCAAACATAGTAGGAGTCC
CCAAGAGAAGCAATGGGTCTTTTCGCGTATCTATCTGTAGATCGAGGTAACTATTGAAGAAAGCAGCCGGGTGTTCGACA
TTTAGTCTTGTGGTCCTGAAGCAGGGTCTGGCTGGCATAGCTGGACAGACCATGTGGACGGCCTCAAAACAGACTGTCGA
TCTGAGAAATACCGGTGAACTTGATCTGGATAATACCAGCGAAAGGACATGCTTCTTGCTCCCCCTTTTCCCTCCAAGCT
GTGTGCCTGTTTAGGCATGGATGGGATGTGTTTTGCTGACTACAAGAAGCTTCTGGTTCGATCTGTCAACATGTCGACTG
ACAAGATCACTTTTCTTACGAATTGGTATGCGATTGACGGTTGTCTTGGTTTCTCTCCAAAATCCAGTCCCTGACACACA
CAGGCACGCCACGCCATACCACGCCCCTTTATTCCTAGCCCAGGCCAGGGGTTACTTTGACGATGAAGGCATTAAAGTTG
CCATTGTCGAACCTAATGACCCGAGTGTGCGTGTTTCTGAACGAATAGCGGCAGGAAGGTTTGAGATCCGCTAGCTAACT
TGCGGGCCATTCAGGACGTGACGGAGATGATCGGCAGTGGCAAAATCGACCTCGGCTTCAAGGCGATGATCCACACGCTT
GCAGCAAAGGCACACGGCTTTCCGGTTGTGTCGATCGGCAGTCTTCTCGATGAGCCATTCACGGGCGTGGTCTACTTCAA
GTCGTCGGGTATCACGACGGACTTCCGCAGTCTCCGGGGCAAGCGTATCGGCTACGTGGGCGAGTTCGGCAAGATCCAGA
TCGACGAACTGACGAGCCACTATGGCATGAGCCCGTTGGACTACACGGCCGTGCGCTGTGGTATGAACGTGTCGCGGGCA
ATCATTGACGGCAGCATCGACGCAGGCATTGGCTTGGAGAACGTACAGATGGTAGAGTTAGAGGAGTGGCTGGCAAGCCA
GGGCCGGGATCGGTCCGAGGTTACGATGCTGCGCATCGACGAGCTGGCCGAGCTGGGCTGCTGCTGTTTCTGCTCCATCC
TGTACATTGGCCATGAGCGGTTTGTGGCTGAGAATCCGGAAAAGGTGCGCGCCTTCTTGCGTGCCGTCAAGCGGGCCACC
GATTTTGTGCTCGCCGAACCCGAGACGGCCTGGAAAGAATACGTGGCCTGCAAGCCACCCATGGACACGGCCCTCAACCG
CAAGATCTTTGAGCGCAGCTACGCCTACCTGTCCAATGATCTCAAGAACGTCCAACGCGACTGGGCCAAGGTTACTGCCT
ACGGCAAGCGTCTTGGCGTGCTCAACGCCGACTTTGCGCCCAACTACACTAATGATTTTCTCGAGTGGACCCTGGCGCCC
GAGTCGGCCGACCCAACTGGCGACCAGAAGCGCATTGCTGTCTTGCAGAAGGACGTCGCCGTCCATGGCGGTTTCCATCG
TGTGGGCGAGCAGGTGGTGTGAAATTTCGTAGAGGAAGCTCATACGATCAGCTGACAGAAACGGCACACGATTCCACCTA
CATTACATTCGACAGTCACTCATTTATAGGCTTTTAGCAGAATTGATGTTTATTAAAGTGGGATATACAGTGTTCTATGC
TGCAGTGAACTAGACGAGGTCAAAGTGAAGGTTCAGCTGCGGCAGCTCAGTGCTGTTTGCCGGCATGATGAAGGTCAGGT
TCCAGAACTCAAAGTTGCTGGCTGGTCAGCAATGTTTGCGAGAGCAGGAGAGCGGCCAAAAAGACTTACTGGATGAGGCT
GCAAGTGCCGCCAACAAGACCGCAGAAAGCGACCTCCGGGACCGGGTTGACGGTGCTGCCGCTGAGAATCGAGACAGACA
CGCCGTCAATGTCAGCCAGGCCGGTCACGTCGCGCTTGGTGCCGAGCGGGTTGCTGGCGACAACAAAGGTGAAGGAGCTG
GATGCGTTGCCGGCCGGGTAGGTCAGGTTGAGGGCGCCCGGGCCGACACGGGCTTGCATGCTGGACTGGGAAGGGTGCAG
CGAGAAGTATCCAACGCTGGCGGCCTGTTGGGCGGTGGCATTGCGGTGCCAGTGCACAATGGCCGGGCTGAAGGAGTTGG
AGTCCTGGCTGGCGCCGCCTACGACGGTCTGGTTATAGGAGTCGGCGCCGATGGTCAGGTCGGCCGACAGCCAGGTGGAG
ATATTGCGGACATCGAGGTCAAAGGGTGGCGTGTAGGCCTGCCGATGGACCGTGTGCTCGCCCGGAAAGACGGTCAAGCT
TTGGATGACGCTGGCCGGCACCAGCGAGCGATGGAAGTCGGACAGGACGGCGATTAGGGGTACGAATTCGCCATCGTCAG
CGTGGGTCAGCAGCCAGGGGTCCTCGGACGTGTCCACGCTGCCGAGACCGAAGACGTGCTGGCGGCCAACGAGCGACCAG
ATGTGCAGCGACATGATGGCGACATACTTGTTCATGTCGTAACCGTACGACCGGTCCCACGGGCCGGCCAGGTTCTGCAG
CTGGGCGTTGTAGAAGTCACCAAAGGCCGTCCAGATGTCGGCCACCATGCGGGGACCGTTCTGGGCCATGACGGACGAGG
ATGGCAGGTATTTGGCCCAGAGCTGGTGGTAATAGCGATTGTCAGCTGTCAGGTCACGTGTCAAACCTCGTATTTCACCC
CCTTTCCCTTACCGTCAAGGCTGTCAGACTGACGCCGTAGTACGTCGGCACATTGAACTCGGACAGGGTGTTGTTGAGGT
TGAACAGGTCGATGATCTCCTGCGCATAGGCCTCGCCGGCAGCGGTCATGTTGCTGTCGTTGCACATGCGTCCGCTCCAG
CCGGTGACCACGGCACGCATCAGAGACGGGTTGCTGTACGACGGGTACAGATTATCGCCGTCGACGCCGCCGACGCGGTA
GCTGTCGCCGATGGAGTTGTTGTACAGCGACTCGACGATGAGCTCTTGAACGTCGCGGCCAATAAGGTGGCCGAACTCCT
CATAAATGACAATCAGGGCGGTGCCGATGAAGCCGCGCCAGTTGGGGTCCCAAGAGTTGTAGATCACGGGATCGTAGCTC
CTGCTGCCTACCGTCGGCTGCTCCGGATAGACGGTGTAGTCGCCATACCACTGGGCCGACACGTTCTTCTCCTGGCCAGC
AATGACGTTGTTGATGATCTTGACGGCATTGGTCCGGTCATCGCCGCTGTTGCGCTGCAACAGGCCGACGGCAAACCACA
CGGACGAGCGAGTCTCATGCGGCCCAGCAGCCAAGGGGTAGTAGAAGTTGTACAGATAGCCGGCCGTCTTGTCATACAGC
CGGTCCAGGAAGCGCATCTCGCCATCGAACATGTCCTGCACAATGGGCGAGAGCTTTGCTGCCTGGACGGAAGCGAGCGT
CAGGGCGACAAGCCCAAGAGAAAACGGACGCATGACTACGGACGATAGTAGACCGACCAGGGAATGCGTCGGATGAGGAT
GGATGGAGACAGAGAAGCCTTGCAGAGAGGAGGTCCAACCAAGACGATCAAATATCCCGAGGATCAGCAAGCTTGCAAAC
GCACGTGGTATCCACAACAGCCCGGCAAATACCGCAGCAGTCTGTGGCCGGTGGCAGCAGCAATTTCCGGAGGCTCGACG
GCATCGGGGACTACGCGCAGCGATATCGACTCGGCAGACCAACTGTCCAGATCGGTGGACCGGGGCAGTAGAAAAAGGAA
AATGCACATGGGTTGCGGCGAGCGCTGCCCGAATCGGACTGGCCAGCGCCGTGACGGCCAACGAGACAGGGGAAGATCAG
GTTAGACGGGACGAAAGACCACGCGACATGCCACGTTCTTATCATCGGCACCTGTGCCGGGGTTTGCCGTGAGGGCGACC
GGGGAAATGGCAGGCTGTGATTGGCCGGATGGCCGGTCAACCCCGGCAATACTGGTCCCGCGCTGCTTCCACTTAGGGCA
AGCGCGACGCAACGGCGGCTGGTAGTGCAGATGCGGTGGGAAAAAGATGGCTGGAAGCCGTCGACTGCAGCAGAGAAACA
GGCGAGCTGTCAACGGGGTTGACACACATATGTATTAAAGAAAGCAGCCGCATCCACACACGATGGGTCGAGGCAGCAGC
GGAATCTCAAGATTACACGTCCGCAGCAGCCATGTCTGAAGGCAACATATCCGCCGAAAAAGGCCCAGAAACCATGATGA
CGGAAAAGGGGCAGCCAATGACGGCGGACGAGCAGCGGCTGGCGCAGATGGGTGAGTGCCGACACGCTGCAGGCAGGTCG
GGCAGACGGCGCTGACACTGGCGCAGGCCACCAGCAGGAGCTGAAGCGCCACTTCACGGTGATGTCGCTGATCGGCCTGG
CCTCGACCACGACGATCTCGTGGACAGGCCTGGGGCTGTCGATCGTGACGGAGATCGAGGCCGGCGGCCCGGGCGCGATC
ATCTACGGCTTCATATTGGTGACCATCCTGCAATGCTTCCTGGGCGCGTCACTGGCCGAGTTTGTGTCCAGCTACCCGAC
CGAGGGCGGCATGTACCACTGGATCGCCGCGATTTCACCGCCTCGACCGCGCAGCTTCCTCAGCTTTATCACCGGCTGGC
TGACCGTCTGTGGCTGGATCTTCACCACGGCCTCGACCAACCTGATCTACGCCGAGACCCTGTCAGCCCTTATCGCCATC
TTTCACCCCCACCTGAACATCCATGTGTGGCAGACGTTTGTCATCTACCAGGGCCTCAACCTGCTCACCGCGGCCGTCGT
GCTCTGGGGAAACCGCGCCATCCCGGCCCTCAACAAGTTCTCGCTCTTCTACCTGCAGATCGGCTGGCTCGTCGTGCTTA
TCACCGTCGTGGCCTGCGCACCCTCGTATCGCGACTCGGCCTTTGTCTTCCGGACCTGGGTCAACGGCACCGGCTGGAAG
AACAATGCGATCTGCTTCATCACCGGCCTCGTCAACCCGCTCTATAGCCTGGGCGGTCTTGATGGCGTCACTCACATCAC
GGAGGAGATGCCGAACGTGAGTCCCTGCTCCCTGCTCCCTGCTCCCTGCTCCCTGCTCCCTGATACCTGATCCCTGACAA
GATAGCCCTCGCGAAATGCCCCCCTGGCTATTGCCATCACCCTGACCATTGCCTTTGTCACCGGCCTGACCTACCTCATC
GCCCTTATGTTTTGTGTGCAGGACTACGCCGCCCTGGGCGACACCAACATGGTCCTGCCGCTGTCCGAGCTCTTCTACCA
GGCCACCAGCTCACGTGGAGGCGCCTTTGGCCTGACCTTTATCCTCTTCATCGCCCTCGGCCCCTGTGTCATCTCGTCCC
AGCTGTCGACCAGCCGGGTCCTCTGGGCCTTTTCCCGCGATCGCGCTATGCCCTACAGCGGCTGGTGGTCCCGCGTGTCT
GTCCGTCACGGCGTCCCCTTCAACGCCCAATTGCTCGTCACTGCCGTCAATGCCGCTCTGGGCTGTATCTATCTTGGCTC
TTCCACCGCCTTTAACAGCATGCTCGGCTCGGCCGTCACCATCAACAACATCGCCTACCTCATCCCCATCCTCACCAATC
TACTCACTGGCCGCCGCAACATGTACCGCGGTGTCTTCTACATGGGCCGCTGGGGCTTCCTCGTCAATGGCATCACTGTT
GCCTGGCTCATTTTCGCCATCGTCTTCTTCAGCTTCCCCTACAGCATGCCCGCCACGACCGAGAACATGAACTACACCTG
TGTCGTCGTGGGCGGGGTTCCCATCCTCATCCTCGCCTGGTGGGTTTTCGGCAGCAAGCAGTACAAAGCCAAGATTGCCG
TCGTTGCCGAACAATAGACGGAGTCGGGCGAACCTGTCTTCTCGACACGTTACATGGTAAGTTACGTGAATATGCAAGGA
AACCAGCATATGCAGCTCTAGGGACAACCAGAAAAAAAGCCAAGGAGCTACGTCGTAGGGACATAGAAGGGCTATGGTTG
GAGTGGGTCCGATTATAATGAAACTGTGGTAGTATCTTAATGAAAGAAGCTGTGTGATTTACGAAGTACGGAGTACCTTG
TTTTTATATCCGTCTTGGCGCATTGTGGCTTGGCCAATCTCTCCTTCTGTGCTCCGTGCACCTGCTCCGATTTCCCATAC
TTGATTGGGTCTTCTCGAATCTGCGTATTTCATAAGATTACCTGTCAAACCCTTGATTTCAGAAAACCAGGGACAATGTG
ACTTACTCCAGCACAAATCCGAATTGAGATAGGCATAATTCTTCCAGCTGAAATGGTACAGCCTGTGGCGATCTTGGGTC
CGTGCCTCGGGGCAGAAATAGGAATTTCCAGCATCTCCACCCGACAGCCGCGGATCACGGCCGAGGATAGAAAGGGGAAA
GAAAAAAGGAGAAGAAGAAACCCAAAAAAAGGAAAAAAAAGGAAAAAAAAGGACAACCGGCAATTTCCGCGAGCACCGTG
CGCTGCAGCTTGGCGACTGAAGACTGAGGCGCAAGAAAAGGCCAGATGTCGCCTTTTTCTTATCGGTGTCCTCCGTTTGG
CCCATTGATGCACCTTTTGGCCCTTTGCATTCGCAGCTTTCTGAACCGGTCTAGTCTCAGCTTCTACTCCGTATGTAACG
CATGTCTCAGGCATCGGGCTCTGTGCGTATCCATCGGGCCGCAAGGCATACCAGTATGGATGAGCATGTATGATACTAGT
AATACCATAGCCGCTATGTTCACCTCACATTCGGCGATCTCCAATCTACTGCATGCAGATCCCGCTACCCGGTGGATCTT
AGCGGCGGTTTTTTACTTGGCATAAAGGATGACTTCCTTAAACAGTCTTCCGCAGGGTCCAGCCAAGAGTGCCGACCTGC
CGTCCTCATTTTCTTATCACCATCGGCCCTCCTACAATGCCCGGATCCAATACAAAGCCAAGCACGGACGGAACTCATCC
GTGGAAACATGGCCCATGGTTCATGCTATCGCAACGGGCAGCCTCATTCTCTGAAACGGTAATTCCATCATCGTCCTCGC
AACTGCATTCCAAATGACGCGAAATCGATACCATCACTGCCCAGACATGTGAACGTCTAAGACAGCCCGCCTGGAAATAA
GAAAGAAGATAACCGGCTCCCTGGTGAAATCTTCACTTCCTCTTGCGAGGACATGCTGCAACGTCACACTGCCCCATAAA
TGAGCAAATCGGATCAGCCATGATTCTTGGTGAGCCAAGGCGTTTCACGTACGAGGCAAAAGAATGTATCCACCTGCTTG
TTCATGCTATGTTCTCACTGTCCCTGTTCCTTGTTTTTGGCGGGTATCTTATATCCGTTTACTTTATAGCGGAAATGCAG
CATACGCCATGTCGAGATTGAGAAACTACTTAAGAGTGACCCTAGACGGACTTGAAACTCTATTTTCTTCCTGAAGTCTG
CGGACACAACTCAGAAACTTACTCCATATGCCGAACTCGATCAAAACTCCTAACACATTTCGCGAAACCCGTCTGCTGCT
CTCTTAAGCTTCCACAAAGCTATCTTCAGGATGGCCCATGACCAGGATGCCATCTCCCGGCTACCCAACAAGGACAGCCT
TGTTGTTCAAATTATAAACAGTGTGGAGCCAGGTAGTTTCCACGAAGATGTGCCGGACACTCTTCGTATCTACGAGGCCG
ATGAAAACAAAGACGGCCATGGCCCTCTAAGAAGTCCTTCCGTAGAGATACGAGATATTACTGCAGGTGTATTGCAAGAC
TCCAAGGATAGCTCGAGTATCACGGATTCGGAAAGCGAGCAGTCCCAGTACAAGTGCGATGCGGAACAGCCATACCATTT
ATTTTCGTTGAAGCAGAAGTGGTCAGTGGTCATCATCATTGGCCTTGCCGGCTTATTCTCGGGCTTGTCTTCAAACATAT
ACTTTCCATCGCTGAATCAAATTTCGCAAGTGAGTACGTCCGCGTCCGTTAACTTGCCCCCGTCGCTAATACAGGAATGA
CAGGAACTGCACGTTAGCTCCAATTCTGTGTCCTTGACCATCACGTCCTATCTTGTTGTCCAGGGAATATCGCCCGTCAT
ATGGGGTGCATTCTCCGACGCACTTGGTCGGCGACCGATCTACATTGCCTCTTTCTCTGTCTACATCGTTGCCAACATTG
CGCTGTCATTCTCACCAAGCTTTGCCATCCTTTTGATTTTCAGAGGCTTGCAGGCCGCTGGCAGCGCTTCTACTGTCAGC
ATCGGTAAGTCTTTGCATCTGGATATATCTCGGCTCTACCAGACTAACATAGTCATCAGGGAATGGCGTTATTCAGGACA
TTTCGCCGCCTGCTGAAAGGGGAGCCTTCATCGGTTTTTACCAAGCCAGTAAGCTTTTCTGCTTCGACCGCTCTTCCGTG
ACATACTGACAACTTTGAACAGTTCGGAACTTCAGCATCGCTGTTGGACCTGTTCTAGGTGGTGTTCTCGGAAACTATCT
TGGGTTCAGGTCAATCTTCATATTTTTGCTGATTTTGTCATCACTTGTCCTCGTTACCATTGTCGGCTTCCTTCCGGAAA
CCATGCGAAGACTAGCAGGTGATGGCCACTTGCGGCAGAAGGGGATCTATCAACCTCTGATGTACAAATTCGTGAAGGAG
CCGAGCTATATTAGCGATCCCGAAGAGGAGGCTGCCAGTGCAAAGAAGAGTATTTCACTTGCGACCTTTGTTGAACCGTT
GAGGCTCCTGACGCAAAAAGAAATCATCCTCAACTTGATATATGGTGGCGTGATCTATGCCATCTGGAGCATGGTCACAT
CAAGCACGACAAGCTTGTTCCAGTCGAACTTCGGCTTGGATGAAACCCTTATTGGCCTCGCATATTTGCCCAATGGTATG
ATTTTAGCGACTGCATATTGAGCAGTATCCTTACTCTTCTACGGCATCGTATTAACCTTCTCCTCAGGCTTAGGAACGAT
TATCGGCTCCGCAATCGTTGGACGGCAGATGACGCAAGACTACAAAGCAGCCGAGGCCGCATATATAGTGGAAAAACAAC
TCCCAGCCGAGTATAAAGTACCAGCAAAAGACTTACCTTTAGACTTTCCTGTCGAGAAAGCACGCCAACGCAGCTTGCCG
CTGTTCACGGTGTTGTTTGTTATTTCCACCGGGTTGTATGGATTTTCGGTGTCATCGCACAGACTCTCGGCCAGGCCTGG
CTGGATTGCCGTGCCGCTTCTGCTACAGTTTTTGATCGCTGCCTCTAGCAATGCCGTCTTCGCGATGAACCAGACTCTAA
TCTCGGATCTGTGTCCCGGCAAAGGTGCAGGAGGAACGGCTGTGAACAACTTGGTGCGATGCGGTCTGGGTGCTATTGGA
GTATCGTTTGTTGAGAGGATGATTGGGGCCATGGGCCCTGGCCCGGCATTCCTGACGCTGGCACTGATCACTGTTGCGTG
CATACCTCTCGCCGTTGTGACCTGGGTCTGGGGGATGGAATGGAGAGCAGCCAGAGCACAGCGGAGAGCGAAGCAGATTG
AGAAGGTGTGAGACGGGATGGTTGATATTCGTCCGTGACCTATCAAAGGCAGGTGGGGTTTCTTGGTGGGATGGTGGGAT
GGTGGGTTCTGGATGGGTTCTGGATGGGTTCTGGATGGGATTCTGGATGAATTCTCTGGAGGGAGTTCATGGTTGGATCT
TGGCTGGATTCCTAGAGGGACTTCTGGTAGGGGGCTCGGTATGTTTCTCGGATGGGAGATTCACAAGCGACATAGATTGC
CTTCGGGTTGTGAACTCTTTGGTTTTTTCTACTACATTTATAGATAGATTATAGACGGCCTGATGAATTATAGACCATAG
ACATGAAAACTATGTAAGTCGGAATTCAAGTGTTCTGGTATATTTGAGAAGGCTTCTTTGTTCAAACGTGGACAAGCATG
ATAAGTTCACCAATAGTGTCAAAGAACTGTTTTGGTTTTGGACCTCACTTTTTAGATAAGACTCATTCACAACTCGGAAA
TACGGAGTAATACGTAGGGCGTAATTACGAATTGTGGTGCCTTGGCACAGACAAAGCAAGGTTCATTTTCTGAAAATGAT
TACTGGCGCTAGACAGGGGCCCGTCTTTTAATGGAAAAAGGCTGTCTTAGATAAGATACCGACGAGCATCTGCAACTCAC
GCGTACTCCGTATAGGTTGCTTGTCCAAATCGGGCGAGAGAAGTATAGTAACCAAATCGCCAAGAAGGTGGCTATTTTAG
GCTCATGTCTCTCCGAACGGATGGTGAGAAATCACTCCGTCGGGATTCCGAAAAACAGCTAACCTATTATCGTTATGCTC
CGTTCTTCTACTCCGTACATCTTACCTTCCAATTCGGGAGTCCACCGACAATTTGCCCGAACCACTCCACTCCTATCTCC
ACTGCCTCGTTCATTTTACGGGCTGGAAGAACCGAGGACAATTCTTATCTACTCGTATCTTACATCGCCATTGACACTTA
GGCAGATGCCAAAACTAGAAGGAGAACTACGACGTAGATCCAGCACGCGCAAACATATGGAGGGTGTGAAGGGCGCTTTC
CTTGGCGGGCGTCTGCGGTGTCTTCCACCTTTGCCTCCAATGTCGTGCCGTCTTCTTCGTGGTCCCAGGCCGGGGTTAAT
GTCGCTGAATACTATCGCTCATGGGTGGCGACATTCTTCAGGAATGCGCTTTTTTATGGCGCGGTGGGACGATCTCGATA
GATGCATACACTTTTACACTCGCATAAACGCATGTATAGCAGATGTAACAAAACAGCTTACGTGGGCTGACCCAAATCCA
GACCGGACTACACCCGGCATAGTTCGGCCAGTCGCTCCGGTTGCTGACTGGCGCACTGGCTAGAGCAATTTTAGGATAAG
GACTCGCTGTGCCTCAAGTCATGTTATCATCTGCCTGCACCTGAGAAGCTGTTACTGTCCAAGCCGTTGCTATTCTTGCT
GCTGCTGCTACCACTGCTTCTCCCGCTTCTATCGTTCTTCTGTTGCGTCTGCGGCTATCCATGCTCCACTGTCAGCCTTC
CAGCTCCACCATTGACCTCCACCATGCGTCTTGTAGTTCGACCTGACTCTGAGGCTGCCTCGCAGTATGTGGCCGAGTAC
ATCATCAGTGGGTCATCTCTCCGTCTTTTGGCCGTCTTAGCCCTGCTTCTGCAAGCTGACCTCCAGACCGCATCACGGCT
TTTGCGCCGTCAGCCGAACGACCGTTTGTGCTCGGCCTACCGACCGGCTCCAGTCCGCTGATTGTGTACCGGCTGCTCGT
GGCAGCCTTCAAGGCCGGCCAGCTGTCGTTTCAGCATGTCGTGACCTTTAACATGGACGAGTATGTTGGTCTGCCGCGCG
AGCATCCCGAGTCGTACCACAGCTTCATGTTTGCCAATCTCTTCCGCCACGTCGACATCCCGGCTGCCAACGTGCACATC
CTGGACGGCAACCCGGCCGACGGCGATTTTGCGGCCGAATGCAGCCGCTACGAGGCGCAGATCCGTGCTGCCGGCGGCAT
CGAGCTCTTCCTCGGCGGTGTTGGCAGCGACGGCCACATCGCCTTCAACGAGCCCGGATCGTCGCTGGCGTCGCGCACTC
GCGTCAAGTCGCTGGCTTTTGAAACACAAGTGGCCAATGCGCGCTTCTTTGGCGGTGACGTCTCTGCTGTGCCGCGCATG
GCCTTGACGGTCGGTGTCGCCACAATTCTCGACGCCCGTGAGGTCGTCATCATCGCCACTGGCCACAGCAAGGCTGCGGC
TATCCAACAGGCCGTCGAGGGCGCCGTCAGCCACATGTGCACGCTCAGCTGCCTACAGATGCATGCCCGCAGCATGGTAG
TCGTTGATGATGCCGCCACTGTCGATTGCAAAGTCAAGACTGTGAATGTGAGTGTGTCGTAGTGGTGTGTTGAGGTATCA
CAATCTTGGCTGTTGTTCTGACCCCCGCAGTACTTCAAAGGCGTCGAGGACACGATCCGGCAAAAAAACGTATTCGAGAT
CCCTCGGCGGAAGAAGCTGCACGCTCTCGACACCAACGTGCCGCCCCGGAATGTCCCCGACGCCGAGGATGGTGAGCTGA
CGCCTGACAGCATGTCGTCGCGCATCCCCGGGATGAGCCCCAAGATTCTCAGCGTGCGTTCGGCCACCATCACTTTTGCC
AGCACTTCTGGTCAGCAGTGAGGCTTCTGGTCACGGCCGACCTGCCCATTCTGCCCGGAAGGAGATCTGCTGCAGGCTGG
CCTGGTCAAAGATCTGCCATGCGCTGTAGTCCATGCTGCCGGGGCTGGGCCCTGTCGTCGTGTCGTCCGGTCCTAGGAAA
GACGGCTGTGGCTGTGGCTGCATGGCCAAGACCGTCATGTCGGGTGTGTTGACGCCCCGAAGGCTCTCCTCCAAACGGCC
GATCAGCCGGTCGCAGAGCTTCGACTTGGGCACGTTCATCTGGTTGAGCATCTCTAGGTGGACGCGGATGTTCCGAAGAT
CTAACAGTCAGTGTTGATATATAATCTCCTCTTGCAGACGACCATATGCTTGCTTACCATCTGCTTCTCCCACACCCCCC
TCAACGCCTTGCACTACAATCAGGGCTGCCCACGTGATCATGACCAGGTCCCAATTGCTCCAGATGCTGTCGTCGTGCAA
GTGCAGCTTCAGCGTGGCCCGCGCACTCAATAGCAGCTCGCGCTGCTCCTGGGGTGTGATGCCGTTGCTCCAGAGGTCGC
AGCCGCGTGCCGGGTGGTAGATGCTCAGCACCACTAGTCGGTGCAGCACATACTGCCGAAACACCACCTGTCGGTCCAGG
GCAGTCGATGCTGAGTCATCAGACATGCTGCTGAACTCGACAAGCCAGCCGTCGAGCTGGTGGGCCCAGTCGCGGATGAC
GGCCGCGTCGACCGCAGTGAAGGCAGGGGTTGCTGTGCTGATGATGCCATTGCCGCTGCCGTTTCCGTTACTGCTATTGC
CCGTGAACACGGACCAGATGGTCGGCAGTCCGCGGCCGGTGAAGTGTGTCAGACCCGTGTGCATCATGCGGCTCAGACGG
TACAGCTGGTCACGGACACCGACACTGAGCGCTGGGAGAGGACACTCGATCGGAATCACGGGACAGCTGAGATGCAGGGA
TGCGTGTTCTAGATCGACAATCTGCACACCGCTGAACAGCTTGCGCCACTCGCGAGCACCGCCGCCGCCGTCGTTGTTGG
CTGCCAGCAGAGCCTGATCGGCTGGACAGTGCTCGAGGATCAGCCGGTAAGCCACCGAGATCCACAGGCCTGTCACCGTC
ACGCTGGCCTCGGCCAGCAGGCCTGCCAGCACGATGCCGAGCACTGTCTGGAAGGCCCACTCCTCGTAGGCATCCGTTGT
GGCTGTGCTGCTCCCGCCACGCGGATACGGCCGGCCCATGCTGCTCTCCGGAACGCTCAATTGTGCGATGGCGTTGCAAA
GCACAGTAAAGTAGTGTGGGGCCAGGTCGGCGGCCATGTCGGGCGGTCCCCGGATGCTCGAGCAGTAGAGGATCGATGCT
ACCAGCAGAGGCTGGGGCACCGAAAATGTCTGCTTGCGTGGCATGAAGTGCAGTCCCGGCATGCGTTCGTGGAAGGCCGA
CCAAAGCTCGCCCACGGTGGCCTTCTTCCAGATCCGTCGCGGCACCGACGTCGGGGCCGACTCGCACAGCACACTCGTCG
CCTCCCACAGCGCACCCAGTGATGCATACGCTGCTGGCACCTCCCCCTCGTCGTCCGAGCCGGTGCCCCCGGTTGCCTGT
CCGTCTTCGTCGTTGTCGTCCAACTCGTCGTCCGAGCCTCCCGACTGTCGCCTCCCATTGGCTGTTGAGAAGCCCAGGTA
CTCTTCAAGAGCCTGTAGTCGCCGCAGAACATCATCTTTGAACGGCCGGTCCACTGATGGCCGCCCAGCTGCCAGGGCCA
GAAGTCCTGACGGTAGGGTGGCTGCGTTCGCACGTGGCACAAAGATGCAGGGCACGCCGGACCGTACGCATCGCCGGCAG
CCCCGTGGGTCCTGGTTGTCCACGCACTTCATCTTCTGCTTGCGGCAGTTCACTGTAACGGCACGCGTCAGACCCGCCAG
CTCTCACGGCCGCTCCGCTTCCACCAACGGTCCACTAACCGCACGCCTTGCCGGCCTTTGGCCGACGGTTGCGACCGTTC
TCGGACGGCCGGCCATCACGTGGCAGCTCCATAACGTGTCGCTGTTCGGCACCAATGCCGTCACGATGTCCGAGAGATGC
CGGGTCGTGGCCAGGACGCGCGTACTGGGGAGGTCTGTCGAGTGCTGCAAAAGACCGTTGTGTTGTGCAAAGGACAGAGT
GCGGGAAACTGCGGCAAATATGGAAAGACCGGATCATATGGGTGACCCCCTGCTAGCCCATTCCAAATCGGGAAACGCCG
CCGACTAGTTATGTCGCATTGCGTCGGCAAATGGCGTCGCGGCAAACACCGGCACAAATGCACCCATCGTCGGGAAAGAA
GAAGCTTCAAGGACCTTTTCGGCGACGCACCCGGTCTGTCTTCCGGCAAAGCACGTGTTCGGGAAGCAGGATCCCCTGAC
CCTCTCTTGCTTACTGTGCTACTGTTTTGCTCCCTTTAACGGCCTTGCCTTCCGGCCTGTCCTTCACAGCCTCCATCCAT
GTTCTTCCAAGCTCTGGGCTCTCGCAGTTGTTGGCGCTCGTCGCCAAGCTTGCTCTCCACGGTCTGCCCGCACGTACAAT
CATGTCTGGCATGGCCGGCCCTGCCGCCGTCGACGACATTATCAGCCAGTTCGACCTGTCCTCGACCGCCCTGCAGACCA
TCACAGACCATTTCGTCTCGCAGCTGAGTAGGTAGGCCACCGTTCCTTTTCCCACCGATATTTTTGCTCTTGGTGGGACG
CCTGCAATCGAGGCTAACTGCGGGTCGTGTCTTGCTGTCTATTTGAATAGAGCTTGGGCTGCTCGACTCTAATTTGCCCT
TTCAGCTTCCCGCCTTCGTCACTGCCATCCCAGATGGCACTGAGACGGGGCGTTTTCTCTCCGTCGATCTCGGCGGCACC
AACTGCCGCATCTGCATGGTCGATCTCCACGGCCATGGCTCCTTCTCCGTAGTGCAGGAGAAGCACACCGTGCCGCGCTA
CGTCATGGTCAATTCGCGATACGATCCGCTCTTCTCCTGGCTGGCAGCACAGATCGGCACGTTTGCCCAGGCCCAGAAAC
TCTTTCCCCAAGCTGGCTCCGATGCCGCTACGAAAGATAGGAAGGTGCCGCTTGGGTTTACCTTCTCCTTCACGTGTGAC
CAGGTCTCACTCGCATCCGGCACGCTGCTGCACTGGGACAAGGGCTGGGATATCCCATCTGCCCTAGGACGCGACCCCTG
CCAGTTGCTCCAGGAAGCTCTCGATTCCGCAAACATCCCTGTCCGTGTGACTGCACTGGCAAACGACAGCGTCGGCACTC
TGTTAGCCCAAGCGTACACGTCAGGGGGCCAGCAAGCGACGACGGCCAAGACGTTGGCCGGCATGATTGTCGGCACCGGC
ACCAATGCTGCGTATGTCGAGCGTCTGCGCCACGTTAAAAGACACGGCGTAGAAGCCGAAAGGGCCAGCCTTGACGATGT
TATGATTATCAATACCGAGTGGGGATGCCTGGACGACAGCTTGATTGTACTCCCGCGAACACGCTTCGACGACGAGTTGG
ATGCCCATTCGACTGACCGAGGCAGCCAGATGCTCGAAAAGCGGGTATCAGGAATGTACCTGGGCGAGCTGTTTCGACTG
GCCGTGGAGGAGTTGTACCGGCTTAATAACGTGTTCGATTTCGTCGTTGCGGACAACTCGACATTGCTCCGGATGGCAGG
CGTCGACTCCTCGCTTCTCTCGTTGCTAGCGGATAGCTCTTTGGATGACGAGGCAAAAACAAAGTTGGTTGCAACAACTC
TCGCTCTCCAGGACACGTCGTCAAAAGATCTTGCAATTCTCCAGCGAATTTCGGCCGCCATCATGACGCGAGCTGCCCGG
CTAGTTGGGGCTGCACTGGCAGCCATCGTCATACAGTCTGGCCACCTCGGAGACGGGGTGCATGTGGACGAATCATCGCC
GTCTCCGTCTCCTAGCTTTCCAAAGACCGTTGCCGACGACAGCAAGTTCTACTTGGGCACTTTGGAGCCTCCAAATTTGG
GGCGAAACAAGGAGCGCAGGTGTGGGATTTTCGGCTTCTTGAAACGTCTCCTCTTCTCTTGCTTGAATAGAAACTCGGCT
TCGCCAGCAGAAGCCGAATCGTCCATTGTACCACCACCTAAATCGACTCATAATTTGCACCTGTCTGCCGTTCAAGGTGA
CGGACGGACACAGACACGCGAGGCGGATACAATTGATATCGGGGTTACTGGGTCCGTGATAGAATATTACCCAACATTCG
AGGCTGAGATGAGGGCCGCGCTGCAAGAGATTTCCGGCATTGGGCCTCAGGGTGAGAAGAGGATTCGAGCGGGCGTCTGC
AAGGATGGCAGTGCTGTCGGCGCAGCACTGATGGCACAGGCAGCCCTGTCGACAAAAGATTAGAATTGCATATGTTTTGC
ATCTTTCATATGGACAACTTCTGCATTCTTCCTTGGTTGGCCATGTGCCGTACAAATTCACATTGGGTATAACAGCATAT
AGATGGTTGCAGAGCCGGCATTTTAGAGATTTTCTTCCACTTAGATTTCGATAGAAACCGTGTCTCTGTTTTTCTGTATC
TCTTAATCAGGTCGTATCCCGTACTACGATGGTTTGTAGCCGTCACGGTGCTTCCGCTCTGTCTTCCTCTGCTCTCGGGC
TGGCGCTAGTGATGAAATCTGTCCATAATGACTCGCCACCTGTGAACGGGTCGGTTTGGTTGTAGTGTTAGTGCCCGCGG
CTGTTGACCGCACAGATGTCAATCTCAATGCCGATTTTCCTTGTCTGCTGGTTTATTCACTGGACGGAGTCATGGCCGTT
GGCTTTGGCAGCATGGTTTTTGCAGCATACCAGCTCTCTTAGGCGGCCGGATACTTGGTGTGTACTTCGAGACACGAGAG
GGTACAGAACTGCCTAGAGTGATCTTTACGCTCACTCATTTCAGCCTGCTTTCCAATGACAGTCAGTAGTCATTAGTGCG
CCATAGGCAAGGCTGAGAACGCAGGCATTGCTGGCGTCAGATACGACGACGAGCTCAGGATCCACGTTCAGGTTATCGGG
AAGCGACTAAAGCTGTAGTCAAGCAAGGCAGATGTTTTCATACTTGTAGGTAGCATATTTCGTCTGGCCCTTACTTCGGC
ATCATATACCTCCAAAGAAAGTACGATCCGATCATCGGTTTAAGTCACGACTCTATCAGTATTGTCAGCGCCTATTCGAG
CTCTGCTTCGGACATCAGCTATGGCGAGATTAAGCGGCCTAGGCCCACGATGCCGGAGATTTGTCTGCCTGTGCAGCAGG
TACAAGGGCAGACCCGGTCTCTCTACGACCTGTCGTCCCTTCTGTGCGGCCTGAGGGGTTGCAAACTGATACATAAATCT
ATTGGCTCAAAGCCAACAACATACAATCTCACCAACTCGGCTGTTCTTAGCCAAACTTTCCACCGTAGCTTCGTCATCTC
CGTTAAAAGTGACACTTAGCCGGCTAAGTGTATGGCAGCGCCATCGCAGCAACTTCTCTATTACATGCTTCTCGTCGATG
ACTCCGAGCGCTTCGCTCACTAGAACACTACCACCGCCACTTTTCAGGGGCTTGTCGACGATAAAGACGGCGATGAGAAT
AGTTGCAGTACTTCCGTACATTTCCAAGCTGGACTTGGACAGGGAAGCCGGAATCAAGCAAAGCTTTTAACCGGACTGAA
AGAGGTTAGTCAGGATACATCTACAGGCAGCTGTCTGTCTACGATTCCGAAGACTTGCCTCTATCTCCACATGATTAAGT
CGAGCTTACGACTCCATACTTCACGTTGGTCTAATCCAACACGCTCTGATCGTCCCCCAGTCTCACTGTCTTGGTTGAGC
TAACGGATAGAATCACGTGACCCAAAGATCTTTGCGGAGAGAAAATATGCCGCCAATTACGGCGTGCATGGTACTCCATA
TTGCGAACCAAAAGGTCTGGCAACGGGAAAACGTGGCGCTGCCAAGATTCAACTAGCCAAGATTCAACTTGCCAGGATCA
TAAACGCCCCACTAGCCAGAAAACCATTTCAGGTGCCACCTCACAGTCCGGTAATCCATATAGAGTGACTCCATACCCGG
ACACGAGAAGCAAGGATATCTTATCAAAAACAAGGCAATATTCACTTTGTCACGTGTCGATGCTTCCAACTCCGGCAGGA
GCCAGAGCCGAGTCAATACGGAGTACTCCGTACTCCGTCTGGTGACGTAGGTGGCTATCGCCATCATGACCCCTGTCATT
CGAGCGCGTATCAATTGCCACGCAATTACTGCGCCGCAAAAGGTGCGCTCTCATCTCCGCTCTGCCGGCACAGTCGGCAT
CCGCACCTACAGAGTATGTATGTCTTCGACCAGCCCTTCTTGGCAGGCTTGGCACTGATATGAGAAAAGGAGGCGCGTAA
CATTAGGGACCGAATCCGTCCATTTAGCAGCCGTTGCCCAGAAGTTGCCAAGAACTCCTAGCCACCTGTTAATGCAGCCA
CCAGAAAAGGTTCAGCCGTCCGGAATTCACTCAATCATCTTGTCCCAGTCCAAGACGCTGACGCGTCGGACAAAGAGAGT
TATGAGTTGCATCCGTCACTCTGTTTCCCCCTTGGCTTCCTACCGTCCAGTTGGTGCTGTTTTTCTCCCTTGATCTAACG
CATCCGACCATGTGGAATCGCCGCTACATCGTCCTCGCCGTAGTCCTCTGCACCGTCGGCATTGTCTTGCTCCAGCCACG
GTCCCAGGGCTTCGAGTACACGGTAAGAAGAGCCCTGGCGCCGGAAATTCGGCCGCGCGTCCCGGAAGCTGATGCGCCCG
ACAGAAAGGCCTGCTGAGCCAGTACGGCCGGAAACGGACGTCCCAGTTCCACCTGCTCGTCCCGGCCAGCGGCCCAAATC
TGCAGCTATGTCGAGCCCTCGTGTCATCTGCCCTACTAGGCTACCCGCCAGCCGTGCTCTCGGGCTGGAACGGCACCGGT
GAGCTTGATGCTGCCGTCACCCACCTGGCAAAGGTGCGCAATGTCGTACGCTACTTCGACAGCCTGCCGCCGACCGCCGA
CGACGACCTCTTCCTCATTATCGACGGCTACGACGTCATCATGCAGCTGCCCCCCGACGTCCTGATCCGCCGCTACTTTG
CCGTCACCGCGGCCGCCAACGTCAAGCTAGCCGCTCGCTTCGGCGACGAGCCTGCTGCCGACGACGTCAACTATCCGCAC
CAGTCCATCCTCTTCGGTGCCGACAAGCTGTGCTGGCCCGTCGACTTCCGGCGCCCCGCCTGCTATGCGGTGCCCGAGAC
CGGCCTGCCAGACGATGCCTTCGGTCTCGGCGACGACATCACGAACAGCCAGCCTCGCTGGCTCAACTCGGGCACCATCA
TCGGGCCAGTCTCGACCATGCGCGCCATGTTCGCTGCCACCATTGAGCGCATCGCCGCTACCTACGACCCCGAGTACATT
TGCCGAGAGTCCGATCAGATGTACATGAGCGACGTTTGGGGGGAACAGGAGTACGCCCGCTCTGTGCGGGAGCTCCGCCT
GAACGCCATAGGCGATATCGACGAGCAGGACCTCGTGCCCGTGGGAATCGACGGCTTCATACCCGAAGGTGCCGATCCCG
AGAGGTGGGGACCCCTTATGCTCCCCGGCCAGAAGACGGAGTTCCAGATCGGCCTCGATTACGAGTCGTCCTTGTTTCAG
GCCTGGGCCGGTTACGAAGACTTCCTAGCCATGCTTTCTCTAAATAGCACGGACGATACCGCCATCGTCGACCACAACGT
CAGCGGGGTCCCCGACTTTGCGCTGCTGGAGGTCCAACTGCCCGATGACTTGGCCTCCCTCACGCGGCTCGTCAGCAGCA
TCTCCGACGTTCACAATGCTGAACCGAAGGACCTCATTAGCACCTTTTTCTTTGGCACCAACCTGGTCACGAACCACGTG
TACTGCATGTTCCACTGCACCGGCGAGAAGGGCTATCTGGAGGAGCTCTGGGTACAGCTGTGGTTCTACCCGTACGCAAA
GGCACTCTTGAAGGCGACCGTCAGCTCAGTCAAGGCCGGCATGAGTATCTCCGACACTGCCATCGATGGCCGCATATGGA
AAGGCGCAAACACCTACCCGTGTTCACCGGCCGACGAGATAGACGACAGAAAGGCGGAGGATAGCGATACGGGCAATGAC
GAGGCTGATGCCAACGAGGTTGTCTACGGCGCGTGGGCCGACTTGGCCAACGAGTGGCTCAGCTGGGAAGACTTATGCGC
CGAGCACGAGGACGTGCTGTTTGGCATAGAGAATTCTGCATAACAGCTTGCATATAGTTTGTCTTGCATCACAAGCGAGG
TTGGGCTTTAATTTGATTAGTACATCTCCCTTTACAAATTGGACCCATTGTCGGCTCTCAGTTTGCGCCGATGTAACAGA
TATTTCATTCATACGACTAGTAAACAACACTAACTAGATGCCGTAGTGCAAGCCCGTTTCTCGTTCCAGGACTGGCTGCT
TGCCGCAATCTCTGGCGAGCTGATAGTGTGTACTCCTTGTCCAGACAGTAGGATCAGAACAAGTGTGTTTAAGGGGGTTG
TGTCTTTCTATGTATTGCTACGGCGCCAGTAAGAGCTGGCTCTGGGACACGTGTTTAGGAAACAAAGGGTTTTGAGAGAG
TTATGCATCATGCGTAGGTAAAAGATCCAGAAGAGAGACTTGTGAACAGAAGAAGGTTGCACATTGTATTTTATGTTAAC
CATTCAGTCTCAAAATCGTTTTGACGGCTGTTCGCTGACAACTCGATGGATTTCCAACTTCAATTCAGATCCGGATATTC
GACATCACGGACTGCAACAGGTTCTTGTCAAAAGCAGTGTCACCTGACTCTTAGAAAATAGCCTTGATTCATTCTGGTCC
CAGAATCAGGTGTTCTTGTGCCTTCACTAACTACATCACTTCTTGTAACCCACACTCAGACACTCCATCAATTCGGCCTT
GTCTCGGACCAGCGCCTGCTCGAGCGACGTCAGTGGAATGCCAAAACGAGCCTCTACGGCCTTAGCCTCGGCGACTACCG
GCTCCAGGTCCTTAGCTCCGGCCCAGATTTGGAAAGCCTGTCCGAAAACAGTCGTCTTGGCAGCCTCAACCTGCTCAGGT
GTGCGGCGACGCAGACCAATTGCACGACCGCTGACACGAGTAAGGATGTTGCGGATGTCATCAACGCTGAGATTCTCGTG
GCCGAGTTCGATCTCCTGGCCGTTGAACGTGGTCGGGTCCTGTAAAGCAGCAGCAGCATAGCGCCCGAGGTCGTTGCCGT
CGGTGTGGGGGATGTGAGTGCCGTCATCGCAGGCGTGGACAATCTCGCCAGCGGAAGGAAGCTCTGGAAAGTTTCCGTAG
ACGTTGGGCAGGAGGTAGTCAAAGTGGATGTAGGACGGCCTGAGGACCGTGTAGGCCCGGAAGCTGCAGTTAGATGCTGC
CACGGCTTCACGCACGAGATCCTCGACAGCTGCCTTGTCGGAAAAGTAGTCATAGAGGTCACACTCTTTGGTAAATTCGT
CATTCCACATGGCACGGTTGCTGACACAGAGTGCCGTTGTGACCACAATGGACTCGACACCAGCCCGCCGACAGCCTTCC
AGAATGCCTTGGGCCTGCTTCATCGGCAGTCCAGGAATCGGGAAGGTGTTTAAAAATACGCCCTTGCACCCCTGGGCAGC
CCGGAAGACAGCATCGACGTCCTGACTGTCACCAGTGAAGACAGTCACGCCAGCACGCGTCAGTTGGGCCGGCAGCGGCG
CCTTGTTGGGATCGCGCACCAGGGCATGCACCTTGGCACCGGAAGCTAGCAGATGATTGATGGTCCAGAGGGCTTGCTTA
CCAGTGGCCATCGTGATGAGGTAGGCGGACATTGTGATGTGGGCAAATTCAGGCAGATATTGATGGGGGCAGGTGATGGG
AAGGATAATAAGAAGATGGATGTCAGGAGAAATGTGGGAGTAGGAATACAACTTTTATACACTTTATGTCTCGGCAGAAG
TTGCATTAGGTGGAGAAGTAAGAGCGTTGGAGGTCTGGCAAAGGCAATTCTGACGAGCAGCTGCAAGGCGGTCACGAGGT
TGGAGCCGACATCCAACGTCCTTCTGGGTGTTTGTGGCCCACCTAGAAGCTCGGGAAAAGTTGCTTTTGGTGGGGTAATC
TCGATGTTGGAAGCTTTACACTACAGTGTATTTCAATGGGATTTTGTGAGCTACTTCATTATCAAGTCACTAATACCTTT
ATTCTTATTCTGGCTCTCACTCTGCAGCAAACTGTACACGCAATGCACAGCCCCTACACATACGATGGAAGCGGTCTGTT
GGCACTGACGACAGCGTCCATCATACGGAAGTAGTTGAGCACCAGATCGCCATCGGCGTGCAGGTCGACCTGTGCCCAGA
CCGCCTGCAGGCCGGCTTTGAGTCGCTGCATGCTGCGGGCCTGCGTCATCCGCTCCGTTCGCTCGACCATGGCGAGGACG
GTGGCTCGCTGCTCATCCGAGCGAGCCTCGCCACCGATGATAAGCAGCGGGAAGAAGTGGTCACAGCTGGGGTGCATCTG
CAGCGGCATGTCATAGATAGTGGCTACTAGAGCGTCTAGGTCGATGGGCGGTGGTGGTGGTGATGGTGATGTTGATGGGA
GGACCGACAGAGACGCCCACGAAGTCCCTGCTCGCACGAGATACACCAACGTGGCGACCCGAAACAGCTCAACAGCCACG
ACCGTCCGGTCAGCCTCAGACCAAGGCGTCACGGAACTCAAAGCCATCAGCGACGTGGCGGCTGGAAAATTCTGCACGCG
AAGCTGAAGCGTCCGCAACCTCTCCCGATATGCCGTCTCGTTGCTGCGCAGATCTCTAGGGTCGATGATGGTGCCGCAAG
CCTCGTCGAGGAAGTTGAGCACAGCCAGTGTCGGTTTCCGGCAAGGTTGTGTCTTTTTGTTAGCTGGAAACAGGAAAATG
ACTACGAAGCGGATAGAAACAATCTCTTACCGGCAAAAAGTACTCTCCCTGGCTGCCATGTCGCCAATGCTGCATCGAGA
AGCGAGACAGAGTTGCGTGGTAGTATGCCCACTCGACCAGCATATTCTCATCGTCACCTACGATATCACTGTCTAGCTGT
TGCTCCAGTTGGGTCTCCCGAACAAGGCCAATGGCCCCTTGCACATGCCACAGCCACTCGCCCGAACTGGCTGACGGAAG
CTCGATTTCGTACGAGCACAAAAGCATCGATGCTGCCACAATAGGTGCCGCGGAGCCCAGTTTTACTCCTCTCCTCTGTT
GTTGTTGCTGCTGCTGCTGTTGTCGGACAGCTGTGCGCAGTGCCTCTAGCGCAGCCACCTTGAGTCGGATGGCCTCTGGC
TGCACTCCGCTGCGGCGCACAGATGCCACAGCTAGCAGCGAATATAGTAGCGCCCTACCTGACATATCGTGTCCACCGCC
ATCAGACAAGGCCATTCGCAGAAGCATGTCCCGGATCTGCTGGGCAGTGCCGCTGAAAGTCACCAGCGAGAGGTAGGCAA
CATTGTGGACTTGGTGCTTAGTCAGCCAATAGCACACCGGAGCCGCCGTTTAATACTCACAATAACCGAGCAGATCAGTG
TTCTGCACTGTCGAAGGAGGAGGTTGTCTTAGCAGTGGCACACTATCCATCAGAAGAGCCGGTCGGATCTCACTCTGCTG
GGAAAGCTGTCTGTACAGCTCGATATCCCAGCCGGTAGTGTTAACAAACAGACGCCGGCCCTTCCAAGTGGACCCAACAT
GTTTCTGTGTCCACAACGGCTCCAAAGAATTAATAGCTCGTTTACTGTCATTCTCGCGTGGCCACGACAGTCTCAGCCCA
TATCCTTGGCACGATTTTTTGGCCCGGACGCAGGTCTGGCACGCCGGCAGGCCTCGGTCGCAGCGCACCTTTCGCTCTGT
AGAAACGTAAGAATCAGACTGCCGACGACACCCACCCTTTGCCACTTACCTTTGCACGTCCAACAGCCTTTGCTCTTCAT
CGTCTGTGTGGTCGACATGGCGTCAGAGTTATCGGATAATGCGATCAAGTCCCGGCCACTCCTTATAGCATTGTATCTGC
TTACCTGGCCCACCAACAGCAACTTTTTGCGAGTTTGGATTTGTCATCTCTAAAAGGCAGGATCTGACGGACCCGGAGTT
TAGCTAGTAAGGTAGGAAGTGATTGCACTAGAGCATATATAGTCACGTGTCAGTGTGTTAATATCGCAACGCAGAAACGA
CTTATGCAATGAGCATATTGCATCGGCAATACGGAGTACTTTACGACCTAAGCTCGGCCGATCACCTTTCTGACCGCAAA
CCGTCCTGATTCGGATGTCTTGCTGACGTTTCTAGGGGCTTCTGGTAGGGCTGACATTACTCGGCACTAAGCGTGCATGC
GCCTTACAGCGGGCTGTGTAAAACAACGCACAAGCAGATACTATTTTGCTAAGTTCTTCGTATGTCTAGCTGTTATAGGT
ACTCCGGTTCCGAACTTCGTAAGTCCAGGTCAAATAAGTCCGTGTTATATACGATCAGCATGCAGCCACTGAACCATGGG
CCGGCAGATGGTCAGATGAATTAAGAACACAAACAGCCGCTGGTGTTTCCGGAATTCTTATACCTTTTTTCGTGTCAACT
TCCCATACTGTACTCCATACTAATCTCCGTGTTTCTTCTTATCCGCCGCTCTTTCCATACCGCTTCTGTAGGCCCAGTTT
AAGCGACAAGAATTATGCCAGAAACATTGGCTTCTGCAGCCGAGGCAGATTCGGGCGCCGATCTCTTAGATGCACTGTCC
GAGAGCCACATGCAAGCTGATGTAAGTAGCAGCCTTGTGTTAAAAGGTGCATTTGTTGACAGAGAATCATCGAAGGAAGG
ATTTGGTGACTCTGCATCCCAAGACTCCTACGTTGATCAAGGGGTCACCTGGGCGAAGATTGTAGCATCAAGAAGCCTTG
ACACTTCATCTCTCATTTAGACCTGGATTCGTGTCGTCCCTTGAGTCTGGCATCTTCAAGTACAAGTACGCTAAACAAAA
ATAAAAAATTGATACAACGCCTACTAACCGCACTAACTAGATACGAGGCTGGACCTTCTTCTTTTAGACCAACAGGAGAT
GATTTGCTCACATATCGCAGGACGCCGCTATCATGCTTTTCATGAAGTTGCTTATCTTGTGATATGGTTCGGTTCCAGTT
CATTCTCTGCCCAATGTAGAAGCGTAATAGCTACCTTGTAAACAGCCTAACGACGACGAAGAGGAAAGCCGCATGGACCT
CGTGCACCAAATTTACCGCCTGCTTCTCGGTGGCAACCTGCGTTTTGCTCCCCTCGGCAACAACGTCCATAGCGTTCTCG
ACTTTAGCACCGGTACTGGTATCTGGGTCTTGAGTTTTGCAGAGTACACATGACCAGCTGGACGAACGTATAATAGAGCG
GCTAGCAACCTTCAATTTGAATAGGATGCATCCATCTTCGGAGGTTCTAGGCACAGATTTGAGTCCCGGTCGGTCTAGGT
GGCATGCAAACAAGCCCTGCTTCAAACAACTGGTAACTTAAAACATCTACTAGGACACCACCCAACTGTGTCTTTGAAGT
CGGCGACTTCGAGTCGGAGTGGACATACGGCCAAATTTTGACTTCATCATCGGCCGTGAGCTTGAGGGCCGCATTGCCGA
CGAAACCTATCTCTAACAGCAGGCATTCAAGCACTTAAACTCTGGCGGCTATATCGAGATGCAGGCTGCATTCCCACAGT
TTTCCTCGGACGACAACACCGCCAAGGAGGCCGTCAATGCCCACAAATGGATGCGCCTCATGTGTGAGAGTGCGGCCAGC
TATGGTAATCCCTGGGACCTGTCCGGCCGCTGGAAGGAGAAAATGGCTGCCTCCGTCTTTGTCGGCGTGCAGCAGACCAT
CCTCAAGGCCAGTTCATGCAGCCCCTTCCTGTGCGTACCTTAGGCAGAGCTGACAAGAACTACCACAGCTGCCCATTGGT
GGTTGGTCCAAGGACCCTAAGCACAAGGAAATTGGCAAGTGCCAATTGTTCCAGGAGCTCCAAGCCCTCGATGCTTACTC
GCCATATCTTCTTTCCCGCGTTCTTGGCTGGACCCAGACTGAGATACAAGCCTTCCTTGTTAAAGTTCGTACCGATATCA
CAGGTCCGGCCATTCATTTATACCTCCCAGTTTATTTTGTCTGGGGTCGGAAGCCTTAAGCTGTCCTAGGATCACGAGCC
ATTTAAAAAATACTGTTTGCTTATTACTACACAAAGCCAGTAAACATGTTAAATCCAGAGGCAAGTGGAATACAGAAGGC
TGAGTTGTGTTCACTGTAATCAGCCCCACAGTTGCCGTCTTCATGACAAGGGGTTATTACATGTTTCTGTTCTCTTTACG
GCCGACATCAAACAAAATCGAGCCCGGCCACATACGCGACTAGCTGCGTATGAAGGGTCTAATATACACTGTCATCAGAA
TTCTTAACTGGCGTTCAAGGCGATGGCGGACTGTCTTGTTTCTGGTCGGACGTTTGCGACGCCCGCAAACCGGCGTCAAC
ACATTCTGAGCAAGCACCCAAGAACATACTGTCTGTGATGTGAGCGGCCTTTCGCGTGCCGTGCTGATTTGCGCCGACAC
GTTTTGGATTCGCCATATCACCACGCCTGTAAGCGTTGCAAACACAATCCGGATTTTGAAACGGCAGCACAGTTGCAAGA
TCACAATGACAAGATGCACTTTTGCTGCGATCTATGTCAGAAGTTTTTCGACCATGCACACAGCCTCATACAACATAATA
TTGCTGTGCATAGCTTCTATCAGGAACCCGAGGGCTTTTGTACTTCTCCCGCAAGTTTTTAGATGGTAAGTATCGCAAGA
CCCCGACACATTTCCATCTGCAGAGGCCTGACGTAATGAGTAGGTGAATTGAAGGTATGACGTTCTGTGATTATTCAGTT
CTCCTGGCGTCCGTAGCTGCTTATCTCAGGCAAATCCTTTAAGGTAACCTGACATTCTGTCGCCTTACAGAGCACGGTTG
CTTCTGAAAATAATTTACAGGATGAAGCCGCAGAATAGCTTATATTTGTCTATGCAAGGATTAGAAGTTTTTATTTCTCA
ATGCCACTATGCTGCTGCTTAAAGCTCGTCTGTCTTCCAGAAAATGACCCATTTCCAGGATTCAACTATCCCCCCTTTTA
ACGCCGCAGAAGAGGCTGTCTAAAGTCAACATGTGCAGCCCGGGCGAGAGGACGGGGTTGTTCGTTGGTGCCGTTAGGGT
CTTGGCCGATAAAGTTGTGGGGAAAGCCAAAATCAAACGGTTTGACGCTCTCCAGAAAGGCAAGCTGCTTGTCGGTGAGG
CTGATCGAGAGCGACTGTATATTGTCATGCAGGTGTTCGATCTTACGGCCGCCAATAATAGGGAAGACGCGTGGGGCCTT
AGTCATAACGTAGGCGAGTGCCACAGCAGTGACGGATGCGATGCCATGTTCAGAAGCAACCTGCTCGAGTGCAGCGCTAA
TACTCTCCTCTTCGACGCTCTGTGCCCCAGCACTACCTCCAGGCACCATGCTTATACGAAGAGTCTCGCCCTGGGCGTGA
CGGGCGGCGATGGCAGCTCTAGACTGGAACTTTCCGCTGCCAAGAGCATCCCAAGGCGCGATGGCCATGCCAAAGTGGCG
ACACAGGGGCAGGATCTCGCGTTCCATATCGCGCACAAGCACGTTCCAGCGACCCTGGTAAATGCTAAAGGGGGTGCGGC
CGTGGTCTTGGGCATACGTGTTGGCAGCTGCAACAATCCAGGCCGGCGTGTCCGATACACCGAGGTAAAGCACCTTGCCC
TCCTGTACGAGTGCGTGCAGCGTGTCCATGACCTCGGGAATCGACGTCGTGTAGTCCCAGAAGTGCAGGTAAAGCACGTC
GACAAAGTCCGTCTGCAGTTTCTCCAGCGATGCTGCTAGGCTGGTACGGATGCTGCGCCGGCTGTTACCTCCGCTGTTGG
CCGCGTTTCCCTTGCCGGCCGTCACGTACTGAAAGTCGTTGCTGAATTTAGTTGCCAGCACAATCCGGTGGCGGTTCTGA
CGCGCCGCCATCCACTCGCCGATCCACATCTCAGACTGTCCGTCTTGGTAGACGTTAGCAGTGTCAATCATATTTCCGCC
CGCTTCGACAAAGGCGTCCAGAAGGGCAAATGAGGCCTTTTTATCCATGACGCCCAGGAAGTCCTTCCAGGCCTCGCCAA
TCGACATGGCGCCCAGCTGCAGAGGAGAGACGCGGATGCCTGCCGTTGTCGACAGGATTCGCAGCCTGCCTAATGGCGTT
GTTGGAGGTGGCGGTGCTTGGTTAAAAAGTGACATGATGATGCGGTTAGTCGAATGTGAGAAAGAAGAAATCGGGGTGAG
CTCGGTTTGCGCAGACCAAAACGTCATTCCACTGATATCAGAAAATCGAGTCGGGGAATAACGGGTTTAACCGTAAGACG
TAGGGCTACTCCCATTCAAGTGTAGAGTAGATGTAAAAGCAGATGTACGTGGCACCACAGAGTACGGGGTACTCACTACC
AACACAGAGTGACTCGTGTAGATCTATCACGCGGCAGCTTGGGCCGAAACATCTGCCTATGAGGTGGTCTGTGTTCCACT
GCGCAACAGTTTACATTCCGATAAACTAAGCCCCTCTGATTGGACGTTGGTCATTGAAAGTATCAACTATGCGTACATAA
TTATTCGGCCTCTCATTCAAATATGCCATGCACTCATTGGGCATAGATAAGGATCGCAATGGCTGCCTCGGAGACTGGCT
ATATTAAGGAGGCCTTTCTTCTCTTTTGTACAAATGGCACACGGGTTTCCACCAGCACATGTGCTTACTCGATTTCTCCA
ATATTTTGCGAAACATAGTTGTCTTGCACTTCAACTTTTTTTAATATCAACATACCATTCTACTCAAGCACACTTCTGGA
CTGTTGTTCAACTTGTATAACCGGTCTTTTTTCTCTCCAAATGAAAGTCACATTCACTCTCGCCACAATAACTGCTGTCT
CTACAGTTGTCATGGCTGGACCTGTGGCATACGCCACTTGCCAGTCTGCGTGTGCCACAAGTCTTGCGGTCGGGCCTGTT
GGTGTCGCTATATACGCGGCATGCCAGTCGTCCTGCGCGGCTCTACTGCTATTTCCGTGCCCCTAGGCATCTAGTACGAT
CTGGTACTAATGGTTTGAGGGATTCTAGAGAGATTAGTTGAAGTTGGCATGCAGTGGCTAAGGTCACTTCTGTTATAGCA
AATTGGGAAATGGTGATAGTTTCAGGTTATTAGGATGGCACCAGATGAAATAAATACAATTCAATTGCTTATTCGGCCAT
TCTGTACAAATTATTTGAAGTACGGAAACTTGAAACTCATGGCAATTATCTTTACGATAGTTCTGGGAACAAGATGGGAG
GCCTTGAAGACTTGCAGGAGCATACTGAAACACCAGATGTCTTCCCGTGATGGAGCAGTGCGTGTACAGTGCCATCACTG
TGTCAGATACCGTAACTGTCAGCCACGCTAAGCCACAATATTACTCGACGAACAGGCAGACATGTGCTTTACCCGTCTCA
CCAAGCCGTCAACTGAGCAGAGAAGGGCCCGGCGCCAGTACCACCTCAAAGAAATCATTCCAGCGTAGATGGAAAGACGT
GGACGGCCCAGCGCATGCTCGGAAGTCGTTTAAAAGTATCGCGTGAGAGCACAGGTACACAAACTCTTGGCACGAGCAGC
AAACAGGGGTGCGAAGCTAGAAGCACCGGCATGGACCAGCGGGCGGCTAAGGTGGGACATCGAAAGTCACGCAAGGGGTG
CAGCAAGTGTAAGATACGGAGAGTGAAGGTGAGTGGATGAGTGAACGTGCAACGTTGTGTTTTGAATTTTAACGGGACAG
TGCGATGAGGTGCGACCAGTGTGCAGCAATTGTTCACGACTGAAGTTGGCCTGCTCGTGGCCGGTGCTGGAGCGAGGGCA
GACGGGAGAGCATGGAGAGAAAGGAGAGGCAGGGCTGAGAGGGAAAAGAGAGACATTGCATCCTTCGCATCCACCACATC
CATCAAATCCAGCACATAAAAACACCAGATCGCCAACCGGCTTCTCGGCCGCGTCCACAGACGTCGAGGGTGCGTCTTCG
AGAGAGTCGGCACCACTCTCAGCGCTGCTGCGGATGTGGACGCCGCAAGAGGGGGACGCAGACGTGTTTTTAGTGCCGGA
GTCGGTGGCGGACGAGTTCTCGCTACCAGAATCGCGGGCGCGGCGGCTGATGGAGCACCGGCTGATGCAGAACTACATCC
TGCACCTGTCGGAGCCACTTCCAATGTCGCCGAGCGCAGAGTGGAACGCGCTGTGGCAGAAGCAGCTACCTCCGCTGGCG
CTGCAGCACGACAACCTGCTCTATGCGCTGCTAGCGATGTCAGCGACGAGTCTATTGGGGGCTGGGGAGGATGAGAGCAG
GAAGGGGGACGAGCATGGAAGTGGTGACTCGAGCGGAAGCTCTAGTGAGACTTCCAGCGGTAACTCTGGTTCCGGCAGCA
ATGTCGAGCGGAAGGAGCTCTTCACAGTCCGGCAGGCGTACTTGATCGCGGCCATGGGCGAGCAGCGACGCATGGTGCAG
TCGCTGACGCTGGCGAGTGCAGACGCGGTCTGTCTCTCGTCGCTGCTGATGCTGATCAACGCGTTTGCGATGCTGGGCGA
GCGCGTGGTCCAGCCGTACACGCCGCCGACCGAGTGGCTGCAGCTGGGTCGTGGCTCAGGTGCCGTTGTCTGGCTCAGCG
TCGAGGCCATCCAGCAGTCGGGCGAGGCCGATCGGTCGGTCATGTGCACGATTGCAAACGCGCCTCCGCAGTTTGGCCTG
GACGAGTCGTACTTTGACGCCAGCAACCGGGAGCAATTCGGGGCTCTTTTGGCGACGGAGGCGACGACAGCCTCGGCTTC
AGAACCGTCCGATCCTGACGACGAGACCACACGCCTGGCCTACGAACAGACGCTCGCATATGTCGGGTCCATCTACAAGG
CCATCCGGCGCCGTGAACCCGTCTATGTGATATCCCGTCGCGTCCAGGGCTTCACCATGGTGGTTCCGCCGCGATTTGTC
GACCTCGTCGCTGCTAGCCGCCCCCGCGCCCTCGTCGTGCTTGCCTATTTCTTCGCCGCCGTCGTGCAGCTGTCGGGTGT
CTGGTGGCTTGGTGAGGGTGCTGGTGCTGGCCGCAACTGCATCGCCAGACGCGAGCTGCGCGGCATCCGCTCTGTCCTGC
CCGACGAGTGGACGGGCCTCATGGTCTGGCCGCTGGACATTGCCGGCCTGATGTGATGTGGACATACTGGGGCTAGGCTT
GGTGTCACCGGTGGGTGGCTGTGGAGAATGGCGTATCTATTGGCGAAGAACTAGCTGGGGTTGCAAATAGACGTATAAAG
GGCAATTTTGGTTGGATGCAGGACAGCCATTCTGAAATTCAGAGATCCATATTCGGGGCCATTTGCTGGGTTTCGATATA
GGGATTTCGATTTTGATCAGTCGCGCTTTGCCGTAATCAGCTTGGCATCGTTGTTCGTTCGTACATTGAACCGTTGTAAT
ATTATATAACAAAAACTACGGAGTACGTGCAGTCAATGCTGTCGAATAAACCAGGCCAGAATGGGTTGGAATTGAGACTT
GTGGCGCAGGATGTAAAGATATACGTACCCTGTGGCCTTGAAGATGCCCAGATTGAGATGAAGATCAATCACCATACACA
TTATCCATGTGAGATGTACCTGTAGTTTATTCGCTTAACCTGGATGCTTACAGGAAATCATGTCGTATGTAATTTATTAT
TCAATATGCTTCGCGCATATTATCCACTACATCTCCAGCAGCCCGCCCTCTGCTGCAAACACGCTCCAGTCCAGCCGCTG
GACAAGTTGCTGCACGGCCTTGCGGGCCACTGGCAAAATGACGTCGTCGACCGTCGGTCTGGTCGAGTCGAGAGCGCCCT
TGACATCGAACAGCGTGCCGCAAATATCTGCCGTGACGGCCGCGAAGCTAGCTCGCACCAGCTGGTCAGCCTGCGTGACC
ACTGGCCTAATCTGGAGGTAGAAGTCGGTGCAGTGCTGGCGGGCGACACGGTCACGTCGCTGTCTGTCCGGCTCAGCGTA
GTTCTCGTAGACGCTGAGCAGGAAGCGAGCACCAGCTGCCAGCTCGTCGGCCGAAGCCGTTGCATTGGCCATGACTGCCA
GCCGTGGCGCGTAGCGCCGGACGATCAGATCGGCCACGTCGCGCCAGTGCGCCGCTGCCTGTGGCATCGAGCCGCGACGG
GTCCCGATCGTCGCCGCAAGGTAGTCCCGCATGGCTGCCCGCTGTGTGGCGCTAGTGTTGACCAGCCGCGGAAGCCGAGA
GCCCTCGGCTGCGTCCGGCACGTCTGGGTTCGTCAGGTCGACCGGGAAGAAAAAGGCCGACACCATGGCCGAAAAGTCCA
GCAACGTCCGTCCTCCGACATCCCGGAAGCTCTCCTCGGGGCTTGATGGCGTCATTCGCCACCCTGGACCTCCAGGGCCT
CCACCAGGACCGCCACCGGGACCACCACCACCAGGCCGACCTCCAGGACCATCCCCTGGACCTCCTCCGGGACCACCAGG
TCCACTCATCCCACCATCCAATCGTCGTACCGATTGCACTTCTTCCAGGCCGTCAAAGAAGTCGCACTTGATGATCTCGA
TGCCCGGGCTCTCGGTGCGGATCACTCCTTGCAGCCCCCACTCCGCACACAGCGCACATAGGTCGAGGGCCCGCTGGTTC
TCGCCGGGAGGACCAGGCCGCCGTGTCGTCTCCGGGACTGCCTCCCTCGTCGTCTCGGTGGCACCCGCGAGCCGCAATAT
CAGGTCCTGCGTGTCAATCACACCCGTGTCGTCCTTGTTCCCGCTCATGCCGTCAATGTACAGGAACTGCAGCGGCCGCG
TAGTGCGGTACGTGTGCAGCCAGCCGTAAGACTTCTTCCTGTCGTCACCACCTAGAGCTGCCTGCAGCCTGTTCTCAGCC
CAGTCATCTCGAGGTGGCTCACCAGGGGGGCCCCTGCCCGGTCCTCCCATCTTGCTCCGGGCAAACATCTCGGCGTGCTC
GATCTCGTACGCCATCCAGTCGAGGCTCGTCGGCGTCGCATTGCGGTCGTTGCCGTGGTGGAAGAGGATGCCCTCGGGCA
CAGTGGCCAGGAAGAACGACATGCCGTTAGGATGCACCGTCTGCCCCCATTTGCGCAGCGAGTCAAAGATCGAATTGAAG
ATCTGGTGTCCGCGCTCGTCCGCTACCTCGACGCTGGGACCAAACTCGGCCGTCGCGAGTGCCGTTGGCGACAACGCAAG
CACCAAGGCCCCGGAGGCCACCAGAGTCCTGAGAACCATCGTGTTTGGTCAGACGTGAACAGAGCACAGACGTAGGAACA
AATGCAGGCACAGGGGCCATATTATATACGCCGCAGCGCCACCGGCGAGCACTGTCCACAATGTGTCGGGAAATGAATGG
ACGCGCGGCGGCGTTGCGCAAGCAGATTTTGGCAAGAGATTATATTGATAAATAGCTCGGATACGTGCACATGCTTTTTG
CTGCATACTGCCCCCGCCTCAAACTGCGGGGCATTGACGTCGACAAGAACTTTTAGTTTGTGTCAAACTATCAAATACTT
ACTCAGACCCTCTCAACGTGTAGTGTACCCGCCATTAGCAAAGATTGTCTGGCCCGTGACCCAGCCTCCTTCGGTGACGA
GGAAGCGCACGATGGGAGCAATGTCCTTAGTGTCGGTGAGACGGCCACCGAGCGCCTGGCTCTTGTGGTAAGCAACGGCC
TCAGGACCCTGGCCGTAGAAGAAGGCTACAAGAGTGGATGTGAGCATAGGAAATTAAAAAGAAAGAAAATGAACTCACGA
GTGTCCATCGGTCCCGGGGCGATGGCGTTGACGCTGCGGTCCGTTAGATCGATGAGAAGAACAGGAAATAGGCTACGAAA
GAAAACACACCTGACTCCGCGCGGCTGCAGCTCCTTGGACACACCGCGGGTGAAGTGTTCCACAGGCGCCTTGGAGCCGG
CGTAGGACGTGTAGTAGCCAGTATAAGCAGCTAGCAGGGCAGTGACAACGGTGACGATCTTGCCGCCATCCCTGACGTGC
TTTGCCCCCTCCTTGAGAATGAAAAAGGCCGACTTCGAGTTGACACTAGTCGGCGGTGGCGGTTAGCTGGTAAGAAGAGG
AGAGGAACCCAAGCTCTGAGAATGGACTCACGCAAACATGCTGTCATATTCCTCTTCGGAGATCTCAGTGATGGGCTTCT
TCAGCACCTTGCCGACCGTGTTAACGACGATGTCGATGCCGCCGAAATCCTTCCCGACCGAGGCGAACAGCTTCTCGACC
GCGGTGGCCGTCGTCAGGTCGCCCTGGTAGAAGCGCACCTTGACATTGGGGAAAGCCTTTTTAAGCGCCGCCTCGGTCTT
GGTCGCGTCCGCCTTGGTCTTGTCCGAGTTGTAGTGCAGCGCCAGGCTGGCCCCGACCGACGCCAGCTCGTGGGCGATAT
CAGCCCCGAGGTTCTTGGCTCCGCCAGTGACGAGAGCAACCTTTCCGTTAAGAGCCATAGCTGCTTTTAGTAGAATAAAT
GTTCAGCTGTGTTATCTGATTGTTGTGTCTGGAGAACGTTGCAGTGCTGATGGACACAAAAGACCGGTCTGGAAGATGCA
GAGGGCCAGACCTTGATATACTTTTTCAGCTATCGCAGATCGCCGGGTCAAGCTGCCGATCCTTGCCAGGCGAGCTGCAT
GTCTTTGCAGGCCAACTGCAGCCAGTCCTCAGCCCTGCTAGTTCTGCCAATATGACTGGCGGTGCTGACAGCAGTGTTGG
CTTGCCGTCTCCACACTAACGCACTTTAAGGATTTAAAGACCATTAGGCATCGGGTTTAGACCGTTGTCTGCAACGGAAG
CCGAAGGAAGAGCTTCTGGCCAAAACCGACAGCTTGTCTACGTACTAGTAACGGCTGTCATTGGCCAGGAAGAGGCGAAC
AGAGACCAATATATGAGAAAAAGCAAACATACTGCAGATCTCGTAGGATGACATCACCAAGATGAGCTAGGCTAGCCTGC
AAGAATCTTAGCAGCGCCGGGTGTGCGGTCGTAGACACAAAGCATTACCGAAAAGAAGATCGATATGATTGCTTAGTAAG
CCAATATATACAAATCATCCGGCACACAAATACGCCATGTCGCATCCGAACCTCTTTTTTTGTCCAACCACATTCAAAAA
TTCAGCTAAGTAAAAACGTAAAGCCCAAGACGTGATTGACCGGCTCAAAAACCCTAGTCCGTATCCGACCTCTATGTCTA
TATGAAACCGTGGGTATCCATCAATTGTCGTAGTCGTCGTCTGTCGTTCTACAGCTTGCCAAACACGGTCGGCACGACCC
CGCTCATCTCGATGAGGGTACTCTTGTTGCGCAGCCAGGCCTCAAGGCCGCGGTGGCCGTTCTCAACGCCGACACCGCTC
TGCTTCCAACCGCCGACTGCCATCTCGGCGGGCGACTCGCCCCAAGTGTTGACCCAGGTGATGCCAGCCTGGAGGGCGTT
GACGACCTGGTGACAATGGTTGATATCGCGACCGAAGACGCCGGCAGCAAGGCCGAGATCGGTGTTGTTGGCACGGCGAA
CAGCCTCCTCGACGGTGGTGTAGGGCAGAATGCACATGACGGGACCAAAGATCTCCTCACGCACAATGGCCATGTCGTCG
GTGCAGTCGGTGAAGACGGTGGGGGCAAGCCAAAAGCCGGTGCTGAGGGCAGGCGGGATACCGGGCGGGACGACAGTGTC
GCCACCGGCGAGCAGGCGGGCACGGTCAACATCGCGGCCAGTGCGCATGTGGCTGAGGACCTTGTCGCGGTGGAGGGCAC
TGCTGACGGGGCCGTAGTTGGTGGCAGGGTCGAAGAGGTCGCCAGCGCGCACGTACTGCAGCTTCTGCAGCAACAGGCGC
TCGAATTCGGGCAGCATGGCGGCCGGAACGAAGACGCGGGTGCCGTTGGTGCAGACCTGGCCGGAGCTATAGAAATTGGC
CATCATGGCGCCGTCGACGGCCTGGCCGACGGGATCGGCGTCGGGCAACACGATCAGCGGGCTCTTGCCGCCGAGCTCCA
TGGTGACATACTTGAGCTGGCCGGCAGCGGCGCCGGCAACGCGACGACCCGTGCTGACCTGGCCGGTGAAGCTGACCTTA
GCCACAGCCTTATGGTCGACGAGACGAGCGCCAACATCGCCGGCACCGTAGACGACGTTGAAAACGCCTTCGGGCAGGCC
GGCATCACGGTAAACGTCGGCCAGCAGCTGGGCGTGCAGTGGGGTGAATTCGCTGGGCTTGTAGACGAGCGTGTTGCCGG
CAGCCAAACACGGAGCCGACTTCCAGAGCGCGATCTGCAGCGGGTAGTTCCAGGCCCCAATGGCGGCACACACGCCCAGA
GGTTCCTTGGCCGTGTGCACCGTTGCTCCGCCCCAGCCCGGTCGTAGCGCAAAGTACTCGCCGTTAAGACCGCCCGAGGC
AATCAAGCCGGCGTAGTATTCCAGGACATCAGCGCCCGTCACCACGTCGACCACGGACGTCTCGCTGAACGGCTTGCCCG
AGTCCAGCGTCTCGATCCGTGCCAGCGCGTCGTTGCGCTCCCGCAGCAGCTCGCTCGCCCGCCGTAAGATCCGTGACCGC
TGCACCGGCAGCGTGTTGGCCCAGCCGGAAAACGCTGCCTGGGCGCTCTCTACGGCCGCATCGACTGCCGCGGCCGATGA
TGTGAAGATACGGGCGAGCGGCTCGGCCGTTGCCGGGTTGATCGTGAAGAAGGACTTGTCGGACGATGCCGCCGGCTGCG
GCTTGCCGCCATAGTACGTGTGTCGATCCAGTTCGGCCATGGATGTGGGGGGTGGGGGGGGAGGAGGGACGGGGGGGGGG
GGGGAGGAAGGAGGAAAGCGAGAGAGAAAAGATAGGCCGGGGGTTATCTCGCAAGCGAGTACTGGTCAGGACAGGGCCGA
TGGGGCGAGGGAACAGGTATTTTGAGACTGAAAAGAGAGATGGGACACGAGAAGTCGCAGAAGAAAGAAGAAGTGGCGTG
AGCGGATAAGGCGAGGGAATCGGTCGGGGAAGTAGTAAAGCGGTGAACGGGGCAGGAGAAGTGAAGCTTCGTGCAGACGT
CACGAAAGCAGCAATACGAGCCGATGGGCTGTGGAGCCGATATACTGCTCAAGAGCTATCTCGACGAACTTGTAGTGCGC
CGGCTGCCGTAGTGGGTATGGGGTCAGGGATGTGAAAATTTGCACAAAAGCGCATTGGTGCGGAAGAGGCCCCCCTCTAA
AACCGGATTTGCACTGATAGCCCCTGATAAAAATCTGCACTTACGTAAGGCCAGCTCCGCTTCTGTGCAGCGACGTCATT
GGGGGGGGACCTGCGTAGGGCGACACCCAGGCGGAGGCCGGCACCAAGTGGCGCCAGGTGGTTCGATGGGGCGGGGCCGC
CATCCGCCGGCAGCCAATGACAGAGCCGCCTTCGGGCCCGCCTGCTTATCGTCAGCATCCGCGCGCCCCCCCCGGCGCGG
CCTTGGCGAAATAAGTCCAGGTCGATCGGAGCGAACGGCGAACAAAGGCAGGCCTGCAAGGGGAAACCGTCGGCAGAATT
TGCTGCAAACGGCGAACTCTCACGGCCGGGACGCGCTGCAGCAGTGGGCGGGTGGCTGGACAAAAGCCTGCGTGTTTTGT
ACGTCGTATCTCATAAAGCATTCATCCAACAGGGTTAGGGTTGTTTGCTTATCTCGGCAGCTGTCCCAGTCATCGCCTTG
CCTTTCTCCGTCTTCTCTTCTCTTTTCTCCAGTCTATCCATCCTTCTTCTGCCCAATTGGCCGTCAATTGCACGCGACAT
TCTCGATCGTCCATACACACGATAGACGACACACGACACACGACATCCACCATGACGACTACTTTCCTTCCACACTCCGA
CGTCGACTCGTTTGACTATGTCATTGTCGGCGGCGGCACCGCTGGCTGTGTCATTGCGTCGCGCCTGGCCGAGTACCTGC
CGTCCAAGAAGATCCTGATGATCGAGGCCGGCCCTAGCGACTTTATGGACAACCGCGTGCTCGACCTGCGTCAGTGGCTC
TCGCTGCTGGGCGGAGAACTGGACTATGATTACGGCACCACAGAGCAGCCAAATGGTGAGTGCGATGGACACGAGGGCGT
GAGAGCCGACAAGCGGAGAGTTGTGTGCTGTCTGCGCAACGAACAGAACTCTGCGATCTGGCGATGATCTGGGATGACTA
AGCGGGCATCTTTCTCCCCTCTATCTGCAGGCTTCCCTCTCTAATCTTGCTCCCAGGCAACTCTAACATCCGCCACTCCC
GCGCAAAGGTCCTCGGTGGCTGCTCCTCGCACAACACGCTGATCAGCTTCCGGCCCTTCGACTTCGACCTCAAGGTTTGG
CAGTCCATGGGCGCCAAGGGCTGGACTTTCCCCGTTTTCATGCGTTCGCTGGACAAGCTGCGCAACACGGTGCAGCCGGT
GCACGCGCGCCACCGCAACCAGCTGACGCGTGACTGGGTCAGCTCGTGCAGCAGCGCGCTCGACATCCCAGTCATCCACG
ACTTCAATCACGAGATCGAGTCGACCGGCCGCCTGCACGAAGGCGTTGGCTTCTTCTCCATCAGCTACAACCCGGACAAC
GGCCACCGCAGCAGCGCCTCGGTCGCCTACATCCACCCTTGGCTGCGCGGCGAGGAGGCCCGGCCGAACCTGACCGTGCT
GACCGAGGCCTGGGTCTCGCACGTGAACGTGTCGGCCAGCGGCGACGAGGTCACCGGCGTCGACCTGCGGCTCAAGGACG
GAACCCTGCGCACCGTGCGGCCGCGCATCGAGACCATTCTGACGGCCGGCGCCGTCGACACGCCGCGCCTGCTGCTGCTG
TCCGGCATCGGCCCACGCGAGCAGCTGCAGCCGCTGGGCATCCCGGTAGTCAAGCATGTCCCCGGTGTGGGCGAGAACCT
GCTGGATCATCCCGAGACCATCATCATGTTTGAGCTCAGCCGACCGGTGCCGCCCAACCAGACGACCATGGACTCGGACG
CTGGCATCTTCCTGCGCCGCGAACCGGCCAACGCCGACACCGGCCGCCGCACCCCCGCCAACCCGGCCGGCCTGCCCGAC
GGCGACATCGCGGACGTCATGATGCACTGCTACCAGATTCCCTTCACGCTCAACACTGAGCGCCTCGGCTACGACGTCCC
CGCCGACGGCTACGCCTTCTGCATGACCCCCAACATTCCCCGTCCCCGCTCGCGAGGCCGGCTCTTCCTCACCAGCGCCG
ACCCCAACGTTAAGCCGGCTTTGGACTTCCGCTACTTCACCGACCCCGAGGGCTACGATGCCGCCACCTTTGTGTACGGT
ATCAAGCAGGCCCGTCGCATCGCCCAGCAGGAGCCGTTCCGCAGCTGGATCAAGCGCGAGGTCGCCCCCGGTCCCAATGT
CAAGACCGACGAGGAGATCAGCGAGTACGCCCGCCGTGCCGCCCACACCGTCTACCACCCTGCCGGTACCACGCGCATGG
GCGATGACGCCCTCGCCGTCGTCGACGAGCGCCTGCGCTTCCGCGGTCTGCGCCGCCTCCGCATCGCCGATGCCGGTGTC
TTCCCCAGCATGACCACCATCAACCCCATGCTGACCGTGCTGGGCGTGGCTGAGCGCTGCGCCGAGATGATTGTCGAGGA
CCTGGGCCGCGCCGAGGCCCGGCTGTAGAGCATTGGTGCGCTACAGCGGCGAAAGACAGACAGCAGAAGCTGGTCAGACT
GCTGGAAATCGGGCACGGCTTTGTACGCTACTAGAAGAGGATGGTCGCTCGAAGAAAATGGCTTGGACTTGGGTACTCGC
TCGGAGGCGTTTGATGAACAAAACTTGGACAAAGATTCAAGGATGTGATGATTAGAGACTGGAATTATACTGTCTTTCCG
TCTTGAGCAGATTGATTTGCAGTGCTTTCATAGCAGTCAGGAATAGCAAGCAAAATAAGTGGCGCGCTGGATTGAATCCG
TACAATGTCGAACTGGCCGAATTGGACATTGGGAACACAGTGTGATGGCAATTATATGTACTGTGTGTTGCAGGGCGTTC
GGGCCCCCTGCGGGATCCGGAGTACGGTGGCGATACTCGTAGATGCACTGATTTTACTGTGCACTGCATCGTTATGGGAA
GGTGCGACGGCGCGCTTGTAATTTGCATATCGGGTCCTGAATTCATCTAAATCATTGTTCTTAGCTTTCTATACCTCCCA
TCCTCCATACTTCGTACTCTTGCAACCGTTCGACCTTATGACCCTATGCTACAACCCTTTGGATACGCTGTACGGCATCA
GTCGCAGCTCCGACCCCCGCGTCTACATTTAGCCGAAACTCGGGGTTCTGCTCGCTCTCCGTTATGATGTTCTCGCTACG
GACAATGTTGAGCGTCTCGGTGATACTCCCCAGGTGTGCCATGGCCATTTCACTAGCGTCCCTTTGCAGACCATCTGCCA
AGTCGTTGAAACACTTCTTAAAGTCCCTTAGCAGCTTGTCAAACGTGGACTGCTGTGTTATGGTGCCGTTGATGATATCG
ACTCGCACACGATGGCTTCCTCTTCCTATTTTTATCGTCAGTTGTAACTGCTATTGGATGTCGAAAAAGGCATCTTACCA
GAGGTATTTGCGGAAGCCCGATAAACCTCCTCCATGGCTTTCCCAATCAGTGACGACCGGATGCCAGTAAGAGCGTCTGT
CTCGAGCGATCTGGTGAGTCACGCCTGTTAGTTTGGTCAAGCACGGTCTGGACAGCTGCACTTACGAGAGGTCATCCTCA
AACTCCTCGCAGCGGCCCTCAATTTCTGCAAGAAAAATGTTCTCTCGATACAGCAGAGTTTGGACGAGGGTGGCTGGAGA
CTGTGGAAGATCTTCAAACCTATTTTCTGATTCCGTAGCCAACGGGCATCAGCAAGATACACTCTCAATCGGGACCTATA
CTACTCCATACTTACCGAGATGTTCGACTTCTTGTCCCAGGGTGTCCTTTAAATGGGCTGAGATATGCTTTTGTTGTCTG
ACGACAGAATCGAGACGCAGTGCTGCCCACCGCGGACGCAAATCAATGGTCATGCCTTCAATAGCTTCCTGATTCCAATT
ATGCGTGCCAGCCACCGGAGTGCTATGGTTGCCGTAATTGCGACAGAATGCAGAATAGGAAGCTTCAGCGGTTAGAACGC
GTACACGGCCCACAGGATGCTACTACGGCACTTACAAGAATGCCACTGTGAACGAGAAACAGATATGTGTCAGCTATCTT
GGACCCGAGCCAGGTTAAATTGGAATGGAAGTCTCACAGAAGTCCAATTAGAAGCCGCTCTTGTTGCTTCTCGGCTCCAT
GCACCAGTGCTATGACCTAAAAAGTCAGCTGGTACGAGACTAGAAGATGCATAGGAGAAAGGCGAGCCCACCGCTGTACA
CCTGCGTCTGGAACTCGTTTTTCAATTCTTTGGCTAGGTTCGAGATTGGGGAGTTACGTCCTGTTAGTCCCTGAAGCCGT
CAGTGGTGTGCTCCTCGAGTGTTGGTGGTCTTTCCCAAATCTCACCGTCTTCAGCCGACGCTCGAGCGCGTCTAGGGCAT
CGCGGATGGCCGTTTTCTGCTCGGCGACCAGACAGCCGGCACCGGACTGGACCCAGAGGCCGATGTCACCGAGGAGGGCT
GGGATGTCGTCACGGACAAATTTGGCGGCTATGCGGAGGTTGCTATCGGCAACCATGGCCAAACAGTGCTTTCGAACGGC
CGGGATTCCGCTCACGTTCAGCAGGCGCACGACAACATCAGTCTTTGGCTGCGCGCGAATCTCCCAGTAGTCCTTGCTGC
TGACACAGAACACTTGCAGCCGATGACCGCCGGGCACAAAGCGGCTGTAGAGGCCCCAAAGCTTCGTGTCGATGCCAGCC
GTCAGCGTGTTGACCAGATGTATCTTGAGCCTAGAGATGCGATGTCAGCCGAGATAGCCGGTAAGCAGTGGGGCAGTCTC
TTTGCCAACTCACTCTATCTTTTGGCTCTCCAGCACCGTTCTGTCACAATGTCAGACTCGTTCCGATGTACAAACCGACT
CCGACTCAGTGCTCACCTGATATTTCTAGACCGCCGCAACAAATCCGCCAGCTCTTTTTCCTCTTCCGGAAGCAGGTCAT
CTTCTCTCTGTAGCTGCTCTAGCTCACGGATGTCATACTCAATGGCGTTGGCATTTTTCTGGCTGCCTTCGACCGCTCTC
TGGAGTTGCTGGGTCGTCCTGTCGGTGGCTTCTGCCGCTTCGACCTCCTGGAAGACACAGTCAGCCGCTGATATGCGACG
AAGAGCAGCACATTACTATCGACATCGCTCACATCAGACTTAGTACAGATAATGCCAATATTTGACAGTCCGGCCTTCTG
TCCGAGCTCAAACACGTCCTTAACCCCGGCATCAGCTGCTGCTCGGTTAGTGCAGGTGACTGCAAAGATATCGTCACACT
CCCGGAGGTAGAGCTCGGTGATGACCTGTCGGGCCAGGTTGACGTCGCGCAAACCTGCACATTGTTAGGAAGGCATATCT
TTGTCGCCTTTCAGCGGTCGGAGCGACCACGTACCTGGGAGGTCGACAAGCACAAGTCCTTTGCTCAGGATATGGGCGTT
CAGGAATACTCTGCAATTGTCGGTTGTCAGATGTCAAACTTTGTCCCTGCCTTGGACTATCTTAGGCCACATACTTGATC
TTTCGTATATACGGCCATACCGCCGGCTGCGGCTCTGCATTCGTCTCAGACGTCAATTGCATCAGAACCCTGGAACATGC
TGCCAGGCTGTCCAGCGTCTGTCTCCCACCAATATGTCTTGGCATCAAGTCGTCCGTCCAGGCACACAAAGTTGCCAGTA
TGCTTTCTTCAGACCCGTCCAAGAGGTACTGCTCGTCTTCCATCCGGCTGCGAAACATGGCCTGGAAGGTGTCGGAGGCA
ATCTTGGCCCTGCTCTCAATGTCTTCCTGCTCGTCCTTGTCGGTAAATTTATAGTGGGTACGGAGACAATTGTGATACTG
CCGGAGAGACTTCAGCAAGTCTCCTATCTGCTCGACGACCTCATCCATGGCGAACATCTCCACGTCAAGGACAAAGTCAT
TCCGGTCATGGTAATGGTATTCGGTGACGACAGAAGTGCAGGCGTCACCATTACCATTTGCCCTAGCCAGTCCTCGCGTG
TCCAGGAGGGCGTTGAGGAGGCTGCTCTTTCCGACTCCCGAGGCACCGACAAAGCCGACGGTGCGGCTGGACAGACACTC
GAAGCAGGCCAGTGCCTCGGTCCGTTTGTGAAGCCGTCCGATGGTGGAGTCCGAGTCCAAGTGCAGACTATCGCTCGCTA
GAACGTCACGCAGGTTCTCCATGGCCGTCTTCGCATCGCTCAGAGCGCCCTGCACGGCTGCATTGTGGAAGCGGTGGGGC
GGCGGCTCATCCTCTCGGACATTGTATGTCTGCAGTCCTGCTCCAGAAAGCCACCCCGCGATCTCCTGGCAGAGCGTGGA
CGAGCCGCAGGACTGTGCTCGATGGATGGCTCAGGCTCGAGCAGGGAGGGTGATCTTCTGTCGGGCTCGGACTCGCGGGC
TACATTTGCAATGGCGGCCGAGACATCGGCCATGTCCAGGATCCGACATGCCAGAGAGCTCGCGGAGCTGAGAGAAGTCA
TCGAAGATGCAGCAGGCGTAGTCAACCGTGATGACTCGCTGTCGGAGACATCGTCGTATGGGGGGTTGACAATCAAAGGT
GTATCAGGCGAAGGAGCAGCAGAAAGACTGATTGAAATGCTGCTTCTTGGAGTCGAGGGCCGAGAGGACGCGGCTGTAGA
TGCGGACTCTACAAGCGTATTGTCTGAAGGCCCGACAATGAACTGCTCGACGTCAGATGGCACGACGAAGAATTGAGTCG
AGACATACTTACTTTAGTCATGTTGAAGTTGGTCTGGATAAATACTGAAAGCAGACGACGTCAATGTACCAGTGTAACGG
GAAGTCACTCGTGTACATATATCTTCCTATTGAGCATTTACGGAGTAGACGGCCAGACACAGGTCTTTAATAGGTGTGGC
AGCTGGGTCAATCTGTCAGGCTGTGACCAATGGGCTCGACCGTTTAGCGCTTTGGGGTGGCCGCCGCGGCAGTGTGCACG
ACGACAAGCGCCCTCTCTGCTAAATCAGGATACCACCTTCCCGTGAAGGGAAAGCCATCACTCAAAAGGATTCCGAGTTG
AAACGGACAGTGGCTGCTGGTAACTCATTTCGGTATGGCCATCTTTGCCACACAGCCTCACATCCGAGCGCTCGATCTTT
TTCTGGTGCTTGTGAATCGTCGATGAGACAGGGGGTACCCACCCTCTAAGCAAGAGTTCCATCGGCCGCAGCACAGGCCT
CCCAGACGGGAACAATCCGGACGATGCAAACGGCAACAGTAGGGCTGTGTGGATAGTCACGTGATTCGGAACGGCTTCTA
CATCTACAGGCAGCTGTGCGCAGATCGAATACTTTGCTTGTCCAGATGCTTATCGATGCTTTGCATGCTATATTGACTGC
TCTCTCTGCAGAGGTCTGGCCGTCAGGACTGGCGTCGGGACTGGCTGAGCACGGCTCCGGTTCCGATGGGCAAGCACGCC
ATCGCATGTCGCAACCGCTTCTCCGCAAGAGCAGGAACGGTGCCCACTATCTCCAGATCCTCTTACGCTAACAGCCGCGG
TATATTGTTGCTGCTTCGTTCGTTAGTTTAAGTCCAACCATGATTCTGGCCATTCGCTGTTGGACAGTGGCTGCATGTCG
CCATGGGCCTGATGGAAGACGACCTTGGCACATGTGTTTCTAACGAGCACAGCTCATCAAGCCCAAAAAGTGAACTGTGA
TGCACATATAAGCTGCGCATGACTTCCCCTTCCTATGTAAGAAGCAAAAACACGTGTTTCCAGTCGGCAGCCATGGAAAA
GGTAAACGAAAAGGTCACTGAGACTACGCTCGCCCACGATAGCACAGGAGATGCTGGGCTTGCCGAGAGCGGACCAGACA
ATCGAGAGTCCAAGCGAACGTGGCGAACATATCTGTGGCCCAGTAAGGCGAGACTCGTCCAATCGTGAGAGAGCCTGCCG
TTCTGACGTCCCAGGCCTTGATCTTCCACGCGACGAGGCTTATTTTCTCACCAAGCTGGACCTTACCCTCATCTCGGCAT
CTGCTCTTGGCGTCATGTGTCGTTATCTCGACCAGGTCAACATTACTAATGCCTTCAGTGCGTAGCCCTTCTCTCTCGAA
GCAGAGGCTGGCCGAGAATGCATATTGACCGTCCTGTAGACAGCGGCATGAAAGAAGACCTCGGACTCTACGGTAACGAG
CTCAACTACGCCAATGCCGTGTGGAGTGCAGCCTACGTCTTCGGCCAGATCCCGTCCAACCTGTTGCTGGCCCGAGTCAA
CGCCCCGCTCTACATTGCCTTTCTCGAGCTGTCTTGGAGTGTCTTCACCTTTGCCCACGCCGGAATCCACAGCATCCGCC
AGCTCTATGTCTTTCGATTCTTGTGAGCTTGTCCAACCGAATCTTTCAACCGAATCTTTTCGCTACTTGAAAAGGTGTCT
GACCCTCCCTCCCAGCGTCGGCTTGTTTGAAGCCGGCCACTTCCCTGCTGTCATGTACATCTGCTCCAGCTACTACAAGC
CACACGAGCTCGCCCGCCGAAACACCATCATTCAGGTCTTCACCTCTGTCGGCCCGCTCTTCTCTGGCTTATTCATGGCT
GCCGTGTACAGCGGCCTCGATGGGACTAACGGTCTGGCTGGCTGGCGATGGATGTACATGTGAGTGCCGCAATGTAATCA
AGTAGCATTCTCCCATGTTCGCTGACTTAATAAGCATTTGCGGTTGCATCTCTGTGCTCTGTGCCATATGGACCGCCTTC
GCCATGCCCCAGCTTCCCAACCGAGCAAAGGCCAACTGGTACGTTTTCATGGTTGGCCCCAATCCCCTTTTCCCCCGCTG
ACATTGATGCTCCTAGGATCTTCACCGAGGCTAACATCAGATTGGCTCGTGCCCGCATGCCCTCCGAGGCCAAGATGCTT
ACCGGCCTCTTCAAATGGAAGGACATCAAACGGTGGCACACAACGTGGCACGTGTATTTATGTAAGCCATCGACAGTCTC
GTAATCTGTCAGCCCTGTTAGGTACCAAATCTTACTACTCGTCTACCAGTCCCCCTGCTGTTCACCATTATAACTCAGTT
TGGCCAGGCTGGTGGTTCAAGTAAGCAGCCATTTCCGTTTTCGCACTTGCCGTCCTCTCTCTGCTAACCAGCACAGTGAT
ATTCTGGGTCAAGAGCTACAATGTAAAGGGAGAGCCGGTCGTTTTTTCGGTTGCCGATATCAACATAATTCCTCTCGGGG
TATGTAAGCATGAAAAACAGTAGCATGTGCGTACCATCTAACCAAGGGACTGACAATCCCACCAGATCAACTTCCTCGCC
ATCTTCTGCGCCCTCATTAACGCCTGGGTATCCGACAATCTTCCTGGCTCTGCCCGCTGGCCCGGCATACTTTTCTCCTG
TATCATGGCTATCATCTTCCCTGTCGCCCTCGCATCCACGCCGGTCCATCCACCGAACAAAGGTACCCGTTGGGCGCTGT
ACTGTATGTCTCTCTATCTCACTCTGTGTGTTTGCTCTTACTAACCACCGACCCAATATACTCTTCTATCAGACCTGACA
GCGCTCATCAGTACTGGTGCAGGAATCACCTGGACGTATGTCAACGGGATCAACAGGCACGATCAGGAAAAGCGGGCATA
TGTATCAGCGATGGTAAGTCCCCAGGATTTACTCGATATCCGCCACCCATCTCCAAATTTATGTCTGACCACATACCTGC
CCATTAAGATGAACGCGTTCGCCTATATATTCACTGCTTGGGTACCTATCTTCACCTTTCCGACTAACAAGCAGCCGTAC
ATTGTCGCCGGAAACTACATCACAGCTGGCTTTGGCGCGGCAGCTGGGCTGGTGGTGCTGGCCATCCGCCACTTTGACCT
TCGGGATCGCAGACGACAGCAGAGGCAATAGCTGCAGGTGTCGTCTGAGAAAAACCTCGGTCAAATTGTAGGATGATTTT
TGGCGAGTCAGGTCTGGAAGTTGACCAGAGTAGAAGATACTTAAATCACGCATATTTCTGAGTCGGCATCCTCAATCTGA
GAGTAGCCGCATAAGCCCCTCTGTGTTTAATACGGGGTTTTAAGACGGGAATTTGCTTCTTCCGTTAAGGAAAACCTGCC
GGACATGCAAGATCCTATTATCCGAAAGCACATATGCGCGAGAGATCTGCCGTGGCTGATCGGTGGCTGCGCACACTAGC
GGTAGTCTATAAATATCGGGTCACATGACGTGAGGCTGGCACACATCTCGCAACCCCCAACAACGACTACTATACGGAGT
ACAATCTCTGTTCGGAGACCAGCCGTGAAACTGGGAATACAGAAGCCCTGATTTATTTTCGATATAGTGCGTGCATGCAA
CTTGCTGCTGTTTCTTTCACGAGTAGCCCGTCTTCTAACTTCTACCCATGTCAACTGCTCGCGCGTCACCTTGCCAACGA
ACTTATTAAAGCAACGCGGTGGCGTCCTGTTCATGGCAGGCGGTGATAACGACACAGGACTGATCCACACGTCTCTGATT
GCGCCTTGTACTCAGTACTTATGTATATGTACGGTGCTCTTAGGACTCCAATTTAGCTTAGCGCTCCATAACCCCTGCCT
TCGTTACCAGTTTCTTGGGGGTGCTTCTTTCTTACTGCTTTTATCTGTTCTTCTTCTTTTAAAAAATGCTTGCGCTACGT
AGTGGAAAACCTGTAACGTGCCAGACTCGAATAGACGCCGCAATTGGCTTTTTTTCAACGTCAGTTGCACAGTAGCCGAT
TTTCCGTGTAAGATACAAAGAATATTGCCTCCTCTCCCAACGGCGGAAATTAAGAAAAAATGGAGGAGTCAGCTGTGGGT
CGTAATCCCTGTTCAATGTTTTCTCACGCTCGTTGTTTTCACATACTGGTCTTGCGTTAACACACTTTCTTACCAGAGCA
ATTGAGCTCGTGGTCTCCAAGATTCAACGGAAGAAGCGGTGAGTCCACTACAACGTAGGAAGCAAGGCGAACAGGAGCCG
TCATATTTCAGTTTTTAGATAGTGTTAAAATTAATTGTACTTGGTTTTGGTGCTCATTAGCATCACGCGCAATTGCGCTG
CTGTGTCAAGATCAAGCCCCCGTTTTGTTGCGTCACGAGTATGAACAAACGCAACCTCAACAGGTTCTTCGCCTCGGTCG
GCAGAGCCTCATCCACAGACGCACCCAGGACATGTAAAATACACTTGTTTTAAGAAAGCTAAGCGAGAAACGAGCCCGTC
TACCTCCTGATCCGTTCTAAATTCCCAACAACGGCGTGCACTCACTCCCCCAGATCCTGTTTTCTGGTCAGATAACGGCC
TCTAGGGTCCACACGAAGGTGTTGCCCGGCATGCCACTATCGTTTGTACGTAGTATGGCAGCAAAGTAAGCAGTGAAAGA
AAGTGGCTGTGGTGTCAATCTCTACGCCCTTCTCGTCCATTGTGGGACCAACGTTGGGATGCCACCATGTAAGGCGTGTA
CAAATTGTCGAGGTCTCGAATTTGGCCGCGACAGGGGAGTAAAGATGGATTGATTGCGCACGGATTTGCAGTACTGTTCA
ACAAAGATATTCTGCTATCTTGTCCTGAGTGTCTGCCTGGCCGCCCTGTGCCGTGAATACATATATGTCCACCGTCCCAA
GATTTAAGCTTCTTCATCTTACAAGAAGCGAGAGACAGAAAAAGAGGCAGCAGCCTTAAACATTTCAGATCTCGCTTATA
ATTATAATCTGCTGTCTCTGACGTCTGGTCCTGTGTGAAACGTCATCTAGTGATAGATGCTCAAAATGGCACACATGAAC
CCAGTTTTGTATCGCTGCCATAAGGCCTTTATTGCAAAACAGGTAGCTTTGGCAAGCCCTCTCTCTTTCCGTGTTGAGCC
TCTCCAATGAAAGGATTAATCCGCTAACTTTGCGTAGGGCGCCTTTTCCGACCCGAGCGAGACGTTGGATGAGAATGTCT
ACCTACGCGCGATCATTGTACCAGAGGGCAAGAGACTGACGGATGGAACGTTTTTGTGGAAGTGCGACACGGCGTTCTTT
CTCCCGCTGGGAGCGACTCAGTGGAGTCCCATACGGTCTACCGGACAGTGCACGGTGCCGCATGGCAGTGAACTCTTCTG
CTGTGGAGGCAACGTCCGAATGATGGTTCTGTTTTGATCTACGGGACTTGCTGCTACATGGTGCACTGTTAGTGCTTAGC
TATGGTACTCCGTACTTGTACGGAGTACTGTGCCTTAAACTAATACAAGCTTATCGGCTTTAAAACTGTGTTGTGGATCG
GAAATGCTTCTGCAAAAACTAGCTTCTAATGACCTGTAATACAGCTCGTCTCTAGCGCTGAAATACACAGTACGATGCCC
AAATTAAACAACCAAAACCTCCTCAATCGCCAGGAAACAACCTGGCCCGGACCTCGAGCATCTGTGCAAATCCCAAGACG
ATCTTGAGGCGGCCCGGGCTGTCCTCTCGACCGGATATGTCCAAGGAAACCAGATCGGTCGCCTCCAAGCTGCCGTTCTC
AATGTCAAGTAGCCGCAATCGGCCCTCACCAAGCTTCTTGCTGATGAAACAGCCCAGATGCGCCCTAATGCTCTCGATGG
GGGACAGCTTCAATGTGCCGCAATTCTTGATCTCCATATACGAACCTGCCCCCGACACAGGGACGCTCACAGCCATGGCA
CTGGTATTGATTTTAGCACCGTACAGCAGAGCGGCGAGAGTCGGGACTGCTTTTGGTACGATGTCGATGGCCATTTCGCA
ATAGTCCGGAATCGTATTTGAGATCGTCAGCGCTGCCCGTCGGTCTCCTTTGCTGCAGATGTCATCGAGCAATGCAGGCG
GGAAGACCTTAGGGAGGTTCTTCTTTAGCGGGAAGGAGGAAAACCCCCGCCGTGTTCCCGGCTCGCCCTCGCACTGCGTG
GCTCTGATGCTCTCCGCATTGCCACTCTGTCTGGTACGCTGCTGCGGTGGGTGTGGAGATATGTGAGAGTATAAGGTGGC
AGGCTGGCTGTGGTTGGCTGGAGGCTGTGTTCGAGAAGGCCGGGGCTTGTATCTGTACTCATACTCGTGCTCGTACCTTG
CTGGAGGCAAGTCGACTCCGATAGACTTCAAGACCCCTGCCAAGATGGGTTAGCCTGTGATTCAGTTGGTTGTGCAGACA
GTCTGTACCACTTTTATACAGACTTATACTTGTATTGCCCGAGACACTTTGGCATCCCCAAAAGTTCCATCCACATGCCA
GACGTCCCCCGTGATTTCATGCGATGCTACCCAACAGACTTACCAACTCGCCATTCCCAATGGTCCAACACACGGAACAG
ACGGCTGGCAAACAAGGCCACGGACTCGTCCACTCGGGCCCACGCCTCGATCATGCTTGCCATCGTTGCCAGGCCATACA
GCGACAGTCTGGATGCTGCGGCGCGGACCATGTTCCCGGTCCCGGTCTGCGTCGCCATGTGGTACGCCAGCCAAGTACGA
AAGCCGTTTTGGAGCAGAACATTCTCGACAGGATTATCGGGTGCCCGAGCGAGCGCGTCGTCGAGCCCAGCCGGAACCAC
GTCTGGCACCTCCCGCTCCTGTGCCAGGTATGCAAATAGCGCACCTGCCACGATGCTGGCGTCTCTGAACTCTGCAGAGC
CTGTGGGGGTATTGTTGATCGGCGCCATGGTCTTTTGCTGGCTCTTGCAGGGGTTGTAGAATATGCGTGCCTTATGGATA
CGCAAGTATTTTGCCCTAGCAAATTCTATACTTTAAGCGTGGCTTGGCCGGCACTACGCCGTACTTTACGCCCCACATTC
CACGGCGTAAGGTGTGCTTATCGCAAGGTATTGTCGACAGGTGTGTACCCACACCCTGGCCAAAATACACTGATACATTT
GCCAAGATTTCTGGGAGGCTCGATTCTTTAAGTTTCACTTGCAATTGAATAATATCGGGAAGATATCGGTAGAAAGCCCC
CATGTGTATTCAGCATGCACCTTCTGGTTGATTACGGAGTACCTAGCGGACAAATTTCAGTTTAGAGCTAGCGACACCCG
CTAAGAATGCTACACAATGGCGCGCGTGCCCTATAGAGCATCTTGCCGTCATATCGTACAGCTTCCGAAGGTTTATACGG
AGTACTTCGTATCTTGCATACCTAATCGATTTTACTCTCGATTGGCAACATGTTACCTCTCCGCCTCTAAAACAAGGCTT
CTCTCCATACTCCGCATTGACAATAAATGGCCAAGGTGGCTAGTGATTCGCCATACATCAAGGTGGCCCAGATTGAGTCT
ATCAACAACTCTCACCGACAATTCGCCTCACCTGAACCGACGGAGTACTCCGTAAAAAATCCTACGACGTACGCGGTCTA
CAATTGGGTAAAGTTACGGTTACTCATTCGCGCGCTATAAGTGGGTCTAAGACCAATCGGATACTAAGCGATGCCCTGCC
GGGCGTAATGCACACTTATTTACGGAGTACGAGTATGGAGTACAACTGGCGTAATGTCATTGGCTTACATAGTAAAATGC
CTCCAGTGAGGACTCCGCCTTCAAGCCCGGAACCAGGACATTACTACTCCGTATGTAGGATACGATGCGAAGCGGCTGAT
TTTAAGGCCGAGCACCCTGGCATCTTACTGCAAGCATACATTACTATGTACTCCGTAAATACTATGTAGGAGCAAGATGA
TCAGTACGGAGTACAGAGTACGTCGGGACATATCCGTCACTACTCCGTAATCTCTGCCTGTGGATAAGGGTACTTGTGTG
CAATCCTTCAGGTACTCGTAAGGCAGGCCACTATCCGATTACCCTGGGCAGACACGGTTAGGCTACGGTACGAAATGCGG
CTAGAAAATGGTACTCGTACACTCGCCTCACTTTCACTATAACGGCCATCCCAAGTACGGAGTAGTTGTACCCAAGATCT
AGCCAATAAGTGCCGTGCAGGATTGTCCACGAACCCTTCATCTCCTCAAACAGGTCACAAGACCCACGGAACCGCCAAAC
TCTTGACTGGCTGCAGCAACACGGGTGAAAACAGCCCCTCTGAAGCATTGGCTAGCTTGATTCTATTCCAGGGTGTATGT
GTTAATCATAGGAAACTCGGTGTCCCAAGTCTTTGTTTGTAGGGTAAGGACAGGTTAGTCGTCCTACTGTCAACGGCAGG
GGGAAAGCCTCACTCACCGTTCTGTCAGGCAGATTGGGGATGTCAAAGAGAGTGTCCGGTTGCGAGTCGGCGGCCGTCTC
TGGAGACGGCTCGAGGGGTGAGACCACGGTAGTGAATTTCTCCGTCTCCCGGCGAAGCTCTTCGGCAACATCCATGGCAC
CAGCAAGCTCAAACAATTTTGAGGCCTGATTAAGAGCCACGTAGCTGGACTCATCCATTTGGTCAGGCAGGATGTGCATG
ACTTTGAGGAGGAAGCGGCTGGCGTGGAAGGTAGTTATGCCGTTGTAGTCCTAGAATGCAAGTGTCAGAGCAACTAGCAG
CAAGTAATATTGAATGGGCAATCAACCCACGATCGTGTAGCGGAATGCGCGGCGAAACGAGCGGGACTCCCACTGCGTCT
GGAGAAGCAGGCAAGCACTTGCCAATGCTGTCTTGACGAAGCTCAGCCTCACAGGATCCACGTCGCCCTTGATCAGTTCA
ACGCCGTGAAGGGCCAGACCGTTGACGTAACTTCAGACACGGTCGGTGGTTAGCACGCTTTTAACAAATGCAAAAAAAGA
ACGGTTAAACTCACAGTTTTACCAGCGCGTAGGGAACCATGAACCTGTTCCGGTCTTGGGTCGCTTCGAACGTCTGGAAG
AGCGGATCGATGGTGTTGTTGATCCTGTGAAACCAGGCGTTCACTTGCTGATCATAGGAGGTCAGCAGCTTCGACACAAA
GTCTGGCAATGGGGTCGCCTGCAGATGGGCGCTCTGCAAGCGGGCCTTGGCATCGCCTGGTACGTCAGCAGATCATCGCC
TAGACATTCCTTTCCGTCCCGGGAGACACGAACCTGTGATTATAAAGCCTTCGATGTATGCGCAAATCCGGTGGTCGACA
GGCCGGCAATACGGTGAAGCCAGCAGCTTCTTGGCATGCGGGAGATATTCCTGCATCTTGTTGATGGCGTACGGGCGGTT
CAGGTTGATTCTGTGAGACGTGGCAGTCAGCTAAAGGCCCCGCCTTGCCTCTCAGCCATGCCTCGCTCCCACGCACATCA
AGTCAAAGCCGCATAGCGTGAACCAGGCGCGAGCGCGTTCCACCACCGATTCTGTGCTCTCCGCTGCTTCGTCCCGGAAC
TGTAGGGCGGACAGGTGCAGCTGCATGTCATAAGCTAGCGAGGCAGCGTAGCCCCACAGCCGAGCCCGGCCGGTCCAGGC
GGTGAGCAGCATGATGGCATAGAAGCCGAGCAGATCCATGTCCACGCCCTGGAACGTCTTGCAGATCAGAGCATCACCCT
CGTCGACGAAAGAGCGGTAGCGCCCGGGGATCAGCGACCTTCCTGCAATCACGCAGATGGTAGTGGACAGCAGCGGATGC
CGCCGGATGACGGATGCAGGTGGATAAATCTGGTCATCCACGAGGGCGATGACCTCCCTGCACTTTGTTTGATAGCTGCA
ATCGTTAATTCGGATGACCAGGGAGGGCAGGAAGGCTTGAACGAACAATGAGTACAAATCATTCCATTCAGACTCAGTCA
CGAGTCCCCGAGCGACAACGTCCTGTTGCAGTAGTAGTGTATCCTCTACAGAGCCGGTTGAGACGTCGCTGGTTGCCGCT
GCTTTCTGTTTGGCCTCTGAGTCTGCCTTTGGGTTGGCTGACAGCCTATCAACAGCCTCTTGCAGCTCGCGTATTTCACC
CCGTAGCTGGTCTTCCATTGAGCTCAAGCGCTGCTCGAGACGCGTCAGCCGGCTGTCATCCTGAGCCACCGGAGACGCAG
CCTTGGCATGAGCAGCTCGGGGTGCCACAAAAACGCATTCTGCCCGGTTTGCGCGACAGCGATCACACGGTACGCGGTCT
GGCCCGCCGCACTTAAGCTTTTGTTTGCGGCAGCGCAAACACGCAGATAAGGACCTGTCCTTTTCAGTATCCCTTTTCAG
TGTCCGGAAGTGACCGTCGTTGTCAGAGATTTTCTCACCTGTTTGCTTCATTCATCGGACATGCGGGCAAATCTACAGAG
CAGAGGGACAGCGTGGGTGAGAATACTATTGTTCGCAAAGATGGCCTCCGGAACCGAGACCTTATCTGGTTGCGGTCACG
TGGGTCGTCAAGCTGGGAGGGGCTGTCGGCAAAAACTGACAGATATGCCGCAGCTGCAATGCGACCCATGCGCCTAGACA
GTCCCAGGCGGCTTCATGCGTAAAGAAAGGAGCTGTCATTTCGAGCAGCAACTGGACTTTGTTTCTTGTGCTGATGCCTG
ATCCGGAGCAGTAAACATGGACAGACAAAGGGGTAGACAGGGAGCGCTGCCAATTGCACGCTGTTTATGTGGAGGAAACG
GCGAGATGGGAGTGACGGGGGAATTATGCGTACAAATTTTCAACAGTATTCAATGAACTGAAGAAGAGAAAATGAAATAA
GCTAGCAGCATGATTGAAAATGCCTGCTAGATATAGAGCAGAATGATACTTTATAAACAAAAAGGAAATTAGTAGAAAGA
GCGAACGAGCGCTGGATTAGTAGATGTTTTACAGTATGGGAAGGAGTAACGGCAAACAAGCGGAAAAAAAGGCACATCGC
TTCTCTCCCCCTCCCCCTTTTTTTTACAGCCCTCTTCACTTCTCCGGCGTTTCGGCCACAGGCAGCATGACTTCTGTGAC
AATCACCAGCCTGCCTCCTGAATTATACAACGACCAAATTACCGGCACTGGACCTGCTGTCCCGCATTACCCACATCTTC
AACACCTGCTTTCGCTCCCAAACATACCACTTGGGTCTGTTCGAGATGGATGATAACCTGAGCTTGGATCCCAATTCATT
TCTGCAGGACGTCTGGCAGGATACCGACAGCATCTACTATATGTAAGTTCTTGATAATGCCGATGCCGGCAGAGATGTCT
CCAACGACGACACAAGTGCAGATCCGCAGCAAATCATTGGAAGAAGCAGCGATACATAATCGTTAGGTTTTGATGTCTGT
CGGGACCTAAACGAGGTGCTCTGCCGTATGTATCGGCTTCCTGGATCCAAGACTATTGGTCAGACATGGGATTTCCATTC
AACTATGCACAAGGAGGCTCACGATCCGGTGTTGTATAACTTGATAAGTCTGTTTGTCTCTCTCTACAAAAGGGGACTCG
ATTTTGGACGCGTCTGTTGTCGTAGGCTACGCACACACAGAGATGAAAGGCATGGTAGTGAGAGGGACCGCCCATTTTTG
CTAGAAGCACACTAAGGAGCCTATATGGAAAGTAAAGACCAAATTATCATCGCCTTTAAGGAAGAGAACCGGCCTATTTA
TATCCCAGAAATCACATCGCCAGCGACTGGCACAGACGAAATGTCACCTAGGCCGTCCTGGACAAAAGGACTGCTATGGA
TTCGAAGGAAAAGCCAAGCAGTGCTACTGCTAACACTTCTGACGTTACTAAGGATTATCCTTTGGCCTTCCTTAAAAGTC
TATCTTGGGAACTACACAGTTGATCCTGATGCTGAATACGGGCTGCCCTACATTCAACAGGTAATAGTTTCAGTGGCTGA
TTCATCCTGAGAAATATCACCTCATCATAGGCACGATGAGAGTGTTCTATGGCCAATTCTGCTTTCTTGCTAAGTGCCGC
AGGTATGAAACGGCTAGGCGTGAGAGCGAAACCCGGATATACCACAATTCCCGCTGCCACACTATACAAAGGAACATATA
CAATGAGTTTCGGAGCATGTTACTCAGGGACTGGCCGGTGCTGTATAACGAAGTTCTCGATGGAAAATTGTCAAATCATG
CCACCAAGCCGACTTTTTTACGTGCACATATGCGAGAGCGGCTGTCTGCCATGTGGGACTACTTTGTACCGGACGCCAAC
ACAGCGGCATTGATTCCTCCTAGCGAGGGGAACATAGACTTTTTTTTAGGTAATGCCACCTGCACCGTATTCAAAAGTAA
TTATCACAAATCTTCCATCGTGGTAGGCAAGGCTATATATGACTAATTCATGTCTTTTCAACTGTCCTAATTTGATGATC
GTCATTATGTTATCTTCTACCCGAGAGAGCTCATGGGGGAGATCATGAATTTGCGGCTACTCCGGTACTCCCTCTAAACA
AAGCTTTCTGCGCAGATGCTGTCAGGTATCGCTGTGGGAGTCATGACACAGCCGGCCAACGGCAGCAGGAACAGTAGCAT
CTGCAGCAGCTTTGGGGGTATGAACAGAGGCTGTGCCCTGGACAACATGCCGCCTCCACTGTACCTGAAGAGATTTGGAG
ACCACCTAGATTCGCCTACAACGTCTTGCCGCACGGAAAAGCCGGTTTAAACGTCAAGTCATCTTCAGAAAAAGAGAGAT
GTACATCTATGGGATGCAACCGCTGTCGCTCCCTTTGTTCTGAGCCATTTGGCAGAACTCATCTAGCCTCTGAAAATTTC
CACCCTGCAGCCATGAGATCCTACGTGTATCGGGTGTCCTGATCTGGTAAGCCTTTTTGTGCCTGGCTGTCTGTGCCATA
GCATCGGCACGAGCAGCCTTCAAGGTGAGATGCAGTTTGTGGCACCAGAGGCGGGAGACCAATAAGATAGCGAAATTTGA
CTATATTTTACGGGTGGAGTAAAGGGGTCCCAGCGCCCAACACTTCGGTTAGTATATTCCCCAGTTTCCCACCAGATTAT
CCCGTCTCTTCTTAATCTATGTAGCCAGCTCGCTTTCTTATTTGCTTGCTGAAATCTGTCGGCGTCTTTATTCTTACTCA
TTTGCCGCCCCATTTTTTAGTGCGTACTAAGTGTAATATTCGCTTCCAGCCAGTGCTAGCAGGAAAGACAGATCCATCGG
CCACGACCAGATTCTGGTAGGATGCATCAGCAAAAAGTCGAGCGAGATTATGTGATTTCGGGATAAGAACTCGCTGGCTG
GAGAAGGCGATGAGTACTCCGTATTCCGTATAAGCAATGTAGCGGGGCATTCTTGATTTAGTGCATAATATGCATATATA
TGGTGCGGGGCAGCCCGCTTTTCTGCAACGGGAGCAAAGTCGACTTCAGCCTTGCGCTAGGCAGCAGCACGTTGACGCAC
GTGACAGTTTCCGTATATATTAGCTAAACGGAGCAGGCCTTAGTCAAACGGGTGGAGTCAAGTGGTCTAGTTCGAAAAGT
CTTACTGGTTTTGACGCGGACGAACGGCCAGCGACTCAGCGACGATGGACAAGCTCAGCGTAGAGATAGTGGAGCATATT
GCGTCGTATATGGATGCGGGCTCGGTGATGGCACTGATGGCGACGTGCCGAGCGATGCGCAAGCCGTGCGTATCACGGCT
GAGCCCGGAGCGCTACCTGCAAAAGACGTTCCGCCAGGCGTCGTCACTGCTGGCGGCAATGGCAGACCACGGCTGCGTGC
TGTCGGGCTCGCGGGCACTGGATTACTTTGTGCCGGGATCGACTGGGGAGGCGAGCAAGTCGGACGAGGGCGAGGAGCTA
TCGGACTGGGACTTTCTGGTTCCGTGCGTGGAAGGTAGCGTATTGGGGATGATGGAGGCGTTGGCAGCGTGCGGAGTGGA
CTGGGGCGACCACCGACTGTCGGAGCTGATGGCGCTGCCCACTCGGCGCCTGGGAACGACGGCAGTGGTGTCGGCGACCA
CGGCGCAGCGGCTGCTGAACCAGCCGTACAGCGAGCAGATGCGGTCGATGGACGAGATCGTGGAGCGACTGCGGCAGTGC
GGAACGCTGGGAGAGACGGAAGAGCTGCCGGCCGAGGCAGAGCGGATGCTGCGAGGACTGCACGCGTTTGTGAATGAGAT
GATTCACGCCGAGTTTGCGGGGGTGACGGTGCAACAGACGCTGGCAGAAACGACGGGCGGCCAGACGCGGTTCCGGTTCG
ACAAGGTGCAGCGCAAGAGCAGCAACAGCAGCCTGGGCCTTCTCGGCGAGTACGGCGGCTACGACATGAACTCGTACGGG
TCCATGTACGGGATGCCGGGGGCCAACGCGAACCAGCCAAACGCGATACACCTGGTCAACTGCAGCATAATGACGAGTCG
GACGGGACGACGGGCCAAGGTGCAGCTGTTTCAGTGCCACAACATCGCCTCGGCCTCGACGTCACAGTACAGCAGCAGTC
TGCGGCATTTCCGGGCGACGACGCCGCTGACCTACGTGCTGGACGGCTACTATGCATCCCACGTGCAGTGCTTCATCGGC
GGCTTCTGTGCCGGCCACTTCTACTACACGCTGGCCCGCGAGCTAACCAGGCGGTTGTGTGGCCCTTTTCCGAGGCGCAG
GCGCCGGCCGTCACCAAGGCCGTGGCCAAGTACCGCCAGCGCGGCTTCCACTTCCGCCATAGCGGCCTGCTGGACCTCGA
GGTCAACAGCCGCATGTCAACGGCGTTTTCGCCCGAAGCCTCGGACTCGGCTGTCGGTCGTGTCGTCCTCGAGCTCGTCG
CCGAGGCCAAGGCCGCCCATCATCTCGGCCAGCCCGGCACGCTGCTCGTGCGCTTCCGCCGTCTCGAAGACCGCCTCGCC
CAGCAGGTGCGCGCGCCGCCTGACGTCCTGTCGGCCGGTCGCCTCGTCCATGGCCTCTATCGCCATCTGCGCGATGCGGT
TCTTCGCTTCCGCTTCGACTTTATCTCTGGTCGTCCCGTCGCCGCCGAGCCCGTCATGCCGCTGTTCTCCGACAGCTATG
GCACCAGCCACATCAGCTCCGCTCACAGCCGCTTCCTCGTCCACAGCGACCCGCCCTTATCACCCTACTCGCCATCAGCC
GGTTTCGTCCGCCCCATTAGCGCCTCGCGGCTGCTGCCGGCTCTCGCTGTCGCCGACGCTGTTCCCCCGGCCATCCCGCC
CGTCGGCGTGCTCACGCCCGGCGACCCCGACTGGACCCGCTGGAAGTCCATCCTGTCACTCGCCCCCATGTCCTGCCACT
TGACTAGCTGCGAGCGCCATCTCAAGCACAAGCCGCCGCAGATTTGACGACGAAAATGGTTCATGAAACTATGCCATATT
TTGGGCTTTGCGCCCGCATCTAGCGCCAAACGCTAGCCAGAAAATCCAGCTCGCTTTGCTACATACTCGTACTTTATTTT
TACTCCCCGTATCTATTCTTGTCGCTCAGCCAACAACCCCACAACTTTAGCGCCTAAACTGACTATTATCCCACTCCCGA
AGCCATCGCGCCTTCTTGTCTTGGCCCGCGTTCCTGCCACAGCCCGCGAGTCCCTCATGCTTGCCGTGCCTGAAATTGGC
CGTAGTCCTTCGTATTTCGTATCATCATTCTCACATCATACACATCGATCTTCTTTCTTGACTTCTCTCTCGCATTCTCG
CGCTATCCGCCTTTATCTGCCTGTCTGACTTCTTTTTTTGGGCTGCACTGCCTCCCGTCCTACCTGCAACGGCGGCGGCC
CAGTCTGCCCAGCCGCACGACAGGGGTCCCTGACTGACTGCCAATCCGTTTCCTGGGGCAACACAACAGAATTGAACAAG
ATGTGTCTCTTTGTTCGCTCTCGCCTCGACTCCTAACCAATGCTCGAGCCTCTTCGCTGTTTTACTTTTGCATTCCGCGA
CTTTTTCGCTCCTTTCTCAGTCTCCTGGTCTTTGTCCCCCCTGGTTCAGTGACCAGCCAACACGAGAAGTCCAATACGAG
AAGGCCCAGCATTCCCGCTGCTCAGCCTAGTTCCACCATTCCTCCCACTCACTGCATCTGCGACATTCCTCTTTTCTTTT
TCCTCTTCGCTAGCCCCTTTCCTCTGCGTCGTACAAATCCTCCCAGCGGTCGACCTGTCAAATCCGCCGCATTTTCTTGG
CGTCAACTATTCGTAAGCATCCTTCTCCCCAAATGAAGTTTCGCAGCATCCTGACACGAAGTGCAGCTTGCGATCCAGCC
CATCTGCCTCTGCACCGTCACCTGTCTTCGACAAACGTGAGCCGCCACGGAAACCGGTCTTCTTCCCTCCACATCTTTCA
CAATGCTACACAGATACTCTTTCGAGTCCAACACGGACGAACAGCAGCCTCTCGACATCATCTACAGCTCTCCCCAGCAT
ACCGCTGACCGACGACAACCACCACAGCGCCGCCAGAGCTCATTTTACGACGACGACCCCAATGGATCTTACTACGATCC
GCCTTCTCCACCACCACCGGCCCGCGGCCATAACGCAAACTCCGGGCAACAACGCTCATGGCTTCCGGCCGGCGCTGCCA
TGACTGCGGCTCCACCGCCTCTTACGACGACAATTCAGCACGCAGGCGACGACCAGGTGTACCAGGTGTCGCCCATGTCC
CCGCCACGGCCTCCACCGCACCGCCGCTCGACCCGGGACCCGCAGTACTCCTACCCCCCGTCCGCGTCTGCCACCGGTCA
GCTGGCGCCGTCTATTGTCACACCGGGCGCTGACAACTTTGGCGACTCTGCCGCCGGCGGCATGGCTGCCATCGCATACA
CGGTGGCCGAGCAGAACGCCCGCGATAGCGGACTGCAGGCCATGCGGGGCATCTCGCAGCCACAGCAGCAGAGCCCAGCC
TATGGGGAGGAGCGCTACGACGATCCGGACTTCCAGTACCAGCAGAGACCAGCGCCCCTGCGACCCCGATCGTTTGCCGC
AGCAGGGCAGAGCTCCAACAGGAGCTCGGGGTCAAGCCAGCAAGGACTGGGCACGGCAGCACTGGTCCCTGGAGGTGCGA
CGTCCAGATCCGGAGCACCGTCACGACGCCCGCCTAGCTACGCCACAGACGTGTACGCAGATGACCCGTACCAAGGCTAT
TCGGGACATGACCCGAACCTGGGCGTCCTCGACCCGAGCGAGATCGAAGACGATGGGGACGAAGGGCTGGAGTACGGCCG
ACGCAGAAGCACCCGTATGTCGGTGATGAATCGCGTGGGCCACAGCCGACGGCGCGACGGTCGCAGCAAAGCCGTGCCCG
CAGTGGCAGCAGTCGGTGCCGTGGCAGCCGGAGGAGCAGCAGTGGCGGCGGCTGTGGGCAATCGCCTCAGCTCGGGAGTG
CACTACAGCGCAGTGCAAACTGAGGGGCACGGTGGTCGAGGCGACAGCGGCAGCGGTGTTATTGGTATTGGTAATGGTGG
CGGTGGTGGCAGTGGTACTACCGCTGTTGCCGTCGGCTCTCATGCATATGACGACGGCGGCAGCGCCGAAAAATCAGAGT
GGCTGGCAGGCCAGAGCACCAGCTCGAAGCGGTGGCGCTGGGCGGCAGCGATTGGGCTGGGAGTGGCGATCGTGGCGGGC
ATTGTATGCGGCGTCGTGTTTGGCGTGGTGCTCAAGAACAAAAACAACGGCAGCAGCAGTGGCAGCAGCAGCTCCAGCAG
CTCTAGCAGCGAGCTGTCGATTAAGAGCCCGGAGATCCAGAAGCTGCTCAACAATACGAAGCTGCACAAGGTGTTTCCGG
GCATCGACTACACGCCTATCAACACGCAGTACCCCGACTGCCTGACACACCGGCCGTCACAGAACAACGTGACGCGCGAC
GTGGCGGTGCTGTCGCAGCTGACGAACACGATCCGGCTGTACGGGACGGACTGCAACCAGACGGAAATGACAATCGAGGC
GATCAACCGGCTGGAGATGCAGGACACAGTCAAGATCTGGATGGGCGTGTGGCAGGATGGCAACGCGACGACGAACGCGC
GGCAGCTGGAGCAGATGTGGGACGTGCTGGATGCCAGCGGATCGGAGCCGTTTGTGGGCATCATCGTGGCGAACGAGATC
CTGTTCCGCAAGCAGATGACCACGACGGAGCTGAGCAGTCTGCTGTCGGAGGTGCGCAGCAACCTGTCGGCGCACGGGGC
CGAGGGGCTGCCGGTGGCGACGTCAGACCTGGGGACGGTATGGGACGCTGCGCTGGCCGAGGCGTCGGACTACGTGATGG
CCAACATCCACCCGTTCTTCGGCGGTGTCAACGCGACGGACGCGGCGGCCTGGACATACGACTTTTGGGAGACAGACGTG
GGGGCGGCCTTCAAGACGAACACGAGCCGCAACATCATCAGCGAGACCGGCTGGCCGTCTCAGGGCGGCGAGGATTGTGG
CACGGGATCGACAGAGACGAGCTGTCCAGATGCGGCGGTGGCCGGCATTGGCGAGCTCAATCGGTTCATGGAGGACTGGG
TGTGCCAGGCCTTGGCCAACGGGACGCAGTACTTTTGGTTTGAGGCGTTTGACGAGCCGTGGAAGATCTCGTACGATACA
GACGGCGAGGCCTGGGAGGACCATTGGGGCCTGATGGACGTGAACCGGAATCTGAAGACAGGCGTGACGATTCCGGATTG
TGGCGGGCTGACAGTGTAGGAGGCGTCATGTGTGTGGGCAGACTGATTTACAGCATTGGCATTTCAGCGATTGCTGACTA
GGATGATATCGTAATGGTTGACTTGGAAGAACGCAGTTTCGTTTCTCACGTGAACTAGACACCATGCTATTATATTCGGA
TACATTGTTGTACAAACGCTGTCCATCACGTGAGTGTCATGTGACGGGAGTATTAGCAGACTTGACCACGAGTTGCCTCT
CCTGAGAAGGATAACGAGCGCATTATGCAACTGCGTCACGGCTTCACGGCTTCCCGGGCTCCCGGCTTCCCGGCTTCACA
GCTTCACAGCTTCACAGCTTCACCGGCTCGACTTCCACATCCCTGCCACAGCGCACTCACCCACTACCTCGCCGTCAGAT
GCTGGATGGCTGCCAGCCACTTTTGCTCGTCGGCACTAAATCTGTTAGCGTGCATTTCCTAAATCCAATATATCCAACAC
ATCCAACACACACACGTACCGATCAAAGCGCAGCAGCTTGCCCAGCACCGGCACCAGCTGTGCACGCAGCCGGTTGTCCT
TCTGCTCAAGGAACTGCAGCATGATTGTCTTGATGTAGACGGCATCGGGAGCCGCTGGCGTGGCCGCCGAAGAGGACGGC
CGGCTGCTGTTGCTGTCGATCGACTTGCGGACGGGTGTTGTCGAAGATGTGTCAGCCGTCGTCGGCCGTCCTCTGCCTGC
GCTTCCACCACCACTCGCCCGCGCCTTTTCAAACCGCTGTCGCTGCTCGTCCAGCACCCGCCGCAGGTCCGCCCGCTGTC
GCTCGGCATCCCGCACCGCCTGCTCGGCCCCGTCGAGTGCTGCTCGCAGACTGGCCACCGTCGTTGTCAGTGCGGCCGTC
TGCTCGGCTGCAGCCGCTGTTTCCGACTCCTGTGCCGATAATTGCTGTGCCAGCTCCGCTGCCCGCGCCTGCAGCCCGTC
GCGCTCAGCCACTGCCGCTTCAGCTCGCCGCTCCAGCTCGCGCGCCCGCGTGCGCAGCTCCTCGGCCTCGCGGCTGCGAC
GTCGTGCTGCCACGCCTGCTTCATCTTCCAGCCGCTCGCGTTCGGCCACGGCCGCGTCTAGCTGTGCCTGCATCGCCCGC
ACCTTTCCGTCTGCCCGGCCGTCCACGTCGGCCAGCAGTCGTCGCATCGTCTCGGCTTCCCGCGTCCGCTCGCCCAGCAG
CCGCCGACACTCGGCCAGCTCCTCGTCCAGTGCCTCGGTCGCTGCCTGTGCCTCTCGCAGCTGCACCCCCACCTCGGCTG
TCTGGTCTCGCATGCTTGCCAGCAGCTTCTGCGCGTTCGCGTACTGTGCCGTCTTGCGTACCACCTCTTCGCGCTGTGCC
GCCTCCTCGCGTCGCAACCGGCTCGCCTCTTCTTCCAGTTGTGCTGTTCGCCGTCGCTGCTGGCCTGCCTCTTCCTGCTG
CCGTGTCGCCTGCTGCTCGGCCTTTTCGGCCCGTACCTGCTGCTCGGCCTTCTCGCCTTCTGCCCGCCGCAGATCGCGTC
CCATCGTTCGCTTCTCATCCTCAAGCCGTGCTCGCTGCCCCGTCTCGCCCGTCAGCTTCTCCCGCAGCCCCTTCGCCTCT
GCCTCGCGCTCGCTCGCCAGTCGTGTCGCCCGCGCCGCCTCCAGCTTGGCCTCCTTCTCCCGCTTCTCCGCCGCCGTCGC
CTCGGCCGTCTTTGCTGCCAGCTCTGACCGCACCGTCTTCAGCTGTGCTGCCTCTTGTCGCAGACTCTTCAGCTCAGGCT
GTGCCTTCTGCAGCACCTCCCGCAGCTCTGTCGCGTCCTTAAACCGGCTTGCCGCCAGCTGCTGTGCCGCGCCCACCTCC
GACTGCAGTCCAGCGCGCTCCTGCTCCAGTGAGGCCACCGTCTTCGTCAGCGCCTCTCTCTCCTTCTGTAGTGTTGTCAC
CGTTTGCGTCAGCGTCTCCCGCTCCTGCTCCAGCGAGGCCACCCGTTCTTGCAGCTGTGTCGTCTCTGCCCCCGCCGCCT
GCAGCTCCTTGATCCTCTCCTTGGCCTCCACGTGGTCCTGCCCGATGGCCAACAGATTCTCCTGCAGCGTCTCAATCTCC
TCCCGCAGGTCCTCCTCTGTTTTCCGCTGGCGTCCTAGTCGCTCGATCTGCGCGTCTTTACTGGCTGCCTCTGCCTGCAG
TCGGGTCACCTCCGCCTGCAACTCTGCCTGCAGCTCTGCCATTGCTGCTGCATCGGGAGCTGCCTCGCTCTCGGCCTCCA
CTTCGCCATCTGCAGCTCCTACCAGCGTCAATTCGGATGCTTCTGACGGCGCCGGTTCCATCGCTGCGGCTGCTGCTGCC
GTTGCTGCTGCTGCCGCCACCCCACCACCACCGTTGTTCTTCTTCTTCTTCTTGTTCTTCTTTTTTGCTCCGCCGCTCGT
GCCTGTCGGTGTCTGTGTCGTTGTCGTCGGTGCTGCCGCCGCAGCTGCAGGTACCACTGCTGGCCGTGGTGCCGCTGCCG
CCTTCAGCAGCTGCTCGATCAAAGTGTCCCGCTCCTTCTTCTCCTTCGCCAGCTTTTCCTTCTCAGTCTTTGTCGCCGCC
ACTGTCTTGTCGAGCTGCTTAGTCAGTGCCTGAGCCTCGCCCTCCAACTCTCCGTTCTTGGCTGCTGTCGTCGTCAACTG
TGCGTTGAGTGCGGCCACCTCCGTCTTTGTCTGAATCGCCGCCGAAAGGTCTGTCTGCAGCTGCTCTACTTCCTTCTCGA
GCCTCTCGATTTGCTCTGTCTTTGCTGTCGCATCCTGCTGAAGCTTCTCGATCTGCTGTGTCTTCACTGCCGACTCTGTC
GTCTTCGCCGCAACCTCATCGCGCAGCTTCCCGATCTGCTCCGTCTGCTCGGCCGCCTGCAGCCGTGGCAGCTCGCTGTC
GGCTGAGAAGAACTCCTCGCTGCCGTCCTCTGGCTTCTTGACGTGCTTCCTCGCCTCCGCCACCTCGGCCTCCGCCTCGT
CCAGCTTCTTCCGCAGCCCGTCGCGCTCGCCTGACACTCGCTTTAGCTCCTCTAGCACCATGTCGCTCTTGAGACTCAGC
TGTCCGAGGTACTCCACCAACGCCTCTGGGTCACGGATCGACCCCAATGGCGTGTTCTCGCGCAACACCCTCTCAAACGG
TTCGATCGACGTCGCCCTCCCGTGCGCCACCCGGTACGACCGCAGCAGCTCCGGATATGTCGCCTCCAGCTTCTCCAGCT
TGCGCAGCCGCGCCCGGATCTCTGGGGGCAGCTCCGTTTTGTCTGGCCGCGTCGTCATCGTCTTTGCCGTCCTGTCGGCT
GTCTCGCCAGCCTCGTCCTTGTTTCTGCCGTCGGTGCCATCTTGTCTGGCTAGCGATACCTCGTCTCTCGTCTCTTTCTC
CTCGCTCCCTCTCGCACCCTCCTTCTCCTCGCTGCCGTTCCCAGCTTCTGCCGGCATCGGTGTCGACGTCCGCGACGGCT
CCTCGCTGTCGTCGATCACAAAGGCCGCCTCGAATACAGACGGGTCCGTGTTCGCCGTACCCTCGCTGCCCTTGTTGCCG
TTGTCCTGGCTCGGTCGCGTTGATCGCGCCCGTCGTCCGGCTGCCGTACCCTCGCCCTTGACGCTTCCTGTTCGTGACAC
CGATGTCGACGATCTTCTGCTCGGCGACGATCCGCCCGATGATCCGGCGTGCTCGCCTGTCCTCTGCTGACGTGCCTGCT
CTTCGGCAATCGTCCGATCTATCGCGCCTCTGATTCTCTGTACACTAGTTAGCATCATCATTGGCAGCTGCTCGAAGCAC
AAAAAGAGATGCAAGCAAGAGAGCACCCGAAATGAATCTCAAAACTCACTTGAAACATAGCACCTCTTCTAGGTCACTCG
CCAATTTGTAACTGACAGCTTCTGTTGCTTCCTTCTTCTTCGGCGCCTGATACAGCTCCGCCCGTCCTGTCAGTCTATCG
CAGGCTCTCGTTGTCTGGGAAATGCTCCTCTTGTTCAAACCTGTCGTTGTTCTTGTTTTGGACAGCTTGGCGCTAAGTTT
CAGGGCGTCATTTGAGCACAGGCTTTTGGCGCCACTATCTGTGGCTTAGTCAGTGTTGTATGGTGCTTTTTGGGTCTACT
GTGTAAGATCGTAAAGATGTATCTTAGGATTAGTCAGAGAACCGACTGCACAGGGAGATCCTACAGAGGAATGGGGAAAG
TACCGTGTCGAGGCCCGACGTCGATTCTTCACATCGTCGAGCAAAAGCAGAAGGGCCTCGAGAACGAGACAGCAGCGTCA
ATGGAGAACAAAATGGTATTAAAAGAGAGAGCTCTCAAGACGAAGGCGAGACACAGATAGACCGAATGTGTATCCGAAAT
TTGCTTCCTTATACTGAAAAGCTTCAACTAATCGCTCCTGGACGTCAATTTCATCCACATATTTTTTTACAACCGGCCTG
CGCTCATTTGGCTTCTGTCTTTGATAATTCGTCCAGTCCATGGCACTGTCGATGACTGGAGCGGACATGGATCTCGGCAG
CGATGCCAGCCTGCTTAGTCTCGCAGACTACCTCCCAGACAAGTTCCTCCAGCCTCGTCCGTTTTTGAGCCTGCCGGCTC
TCCTTGAACTGTGCTGGTGGTCTTCATTTGCTTCAACGTTGGATCGGCTGGCTGCCCTGCGTGGTGGCGCCTGTCGCTCA
GGCCCAGAGGCGCTATGTGATAGATCGCTAAGGTGCCAAAGATGACGATGGCACTCTCTTGCGCCCAGAAACCAAGACCG
CCAAACTCCATATTGCCCACATCCCGCCGCACGTTCGCCGAGTTCTTTGGAAACAAGTTCCCGGTCACCCGTGCACTCTA
TTGGCGAGATCCTGCGAGACTTGAAGACACCGCCGTGTAGACGGCTCGACCGAGAGTCGGAGAGAGACGAACATTGTCGC
TGTTATGCATCCATACCTTATTGCCTAAAAAGGCGAAATTGGCAGCCCACTGCCAAGGTCGTATTCGCATTCGCGTTGCC
CACGAATTGACGTAGCTGTGATCGGCGCCCGCGCTTAGTCAGCCAAGCTTGCATCGGCCACCATAAGCTTGTACGATACT
CGCAGCATATGTCTCTATTTCTTCACGATAACGTGGCCGACAGCAGCCCAACGCCTGGACAAGGTCATCCGCCGTGTCCA
TCCGCTCCTTTCCTTCTTCTTCTAGTCTCTCTCTGTCCCCCGTCCTTTTTTTCTCATTGCCCCCCGCCTTTTCGCTTCGC
TTCGCTCCCTGTCGCATCGTTTCCCAATTTTCGGGCTGCTGCTGTTCTATTGCTGCCAACGGTCGAGTCCGAACAGAGCC
CGGTTTTGTCCTTATCCCGCTGCCACCGATGGTCCTCTTCTGGCCATGGAAGGTACGTGATGTGCACACGCCAGCCTGCG
GGCATCGTGCTGCCCCCATGTGCCTGACGGTCGCTGACCAGTCGTCAGGGGGTCGATGCCTCGCCGGCGTCGTTTGAGAA
GGCGCTCGCAGGACTGGCCGCCAAGATCTCCGACACCCAGGCCAAGCTCGACCACACCCGGTCAGCCGCGAGACGGGTCC
GTGTGCTCGCGACGCTGTACCTCTCGTTTGCCTACGTGGTGTACGCCATCGTACTCGTCCTGGTCGTCGGCTATCGAAAC
TTGGGCGCGCTGGAGTGGTCGGGCATCGCTGGAGGTCCGCTCGCGTGAGTGTGCTGCCCTACTGCCCCTGTGCTCTGTCT
GCTGCTAACCGGATCTCTGTCGACAGCATTTACACCGTCCGCACGGTCCTCGACGCCTACTTCAACTTCCGCATCGATAT
GCTCACTGCTCGACTCAAGGACTTCAAGGCCGAGCGCGAAAAGACGATCCTGAAGCTCAAGGCTGCCACCAAGTACGACT
CCACCCTCGAGCTGTTGGAGAAGTACGGCGGCGTCGAGACCAAGCAGGGCGACCACAAGAACAAGGGCAGGCCGCGGCTG
GCCCATGTCGACGACAGCCATGCCCACCCGTCTTCGTCGATCCGCACCGGCTTAAAGCCCCCAGCAACTGCCAACATCGC
CCGCGGCACACCGCCGCCGCCGCCAGTCATCTCCATCCGTCCGAGTCCCGATGCTCCCGATGCAGCTTCTGGTTCCGATC
TGGACGTGTCGGCTGAATTTGCGCCCAACGCCTTTGGGCCCGATACCGAAGACCATATGCTGCTGCTGCAGCAGCTGGGG
TCCCGTCCGGCCTCGGCCATTTCCAGGCCGGCTACTGCCAACACCAGGCCGGGCACGGCCACGTCGGTTGCCACCACCGC
TCTCGCGCCGCCTGCCACCATGACCGTTGCCGCCGCCGCCCATCCGCACTGGTATGACCGGCTGCTGGACCTCCTGATGG
GCGAGGACGAGATGGCCGCCAAGAACCGTATCGTGCTCGTCTGTGGCCGCTGCCGGCTGGTCAACGGACAGGCGCCGCCG
GGCACGCGCAGCCTGGCTGAACTGGGCAAGTGGCGGTGCATGGGCTGCGGCGCTGCAAATGGCGAGGTGGCCGAGACGAA
GCCGTCTCTCGGCGACGTATTGGAAAAGCGACAGCGCCTCCGACCCCAGCGGGCGTCCAGCAGGCCACCGGAACTCTCGG
ACTGTGGAAGCGAGCTGGAACCAGACGAGGCCGAGGACACCGACTCCGAGGCCGACAGAAAAACGCATTCATAAGCCATT
TGCCATACCACATGGTCACGTGACTGTGCACGAGCGGTCCTCGAGGCTGTGGTTTCTCATTCGCAATGGACCACAAAGGC
AGGTGCGTCTGAAGGAGAAGAAGCAGACCTGGGCAAAGTTCTTTCGTGGACGATCGAGCAGCTCTGCTGAACACTGTGTT
GGGCACTCTGCCGTTGTAGTGACCAGGCATGCACTTTATATTTTCTAGCGTCATTTAGATGTTTTTGCGATATCTGTCTG
CTGCACGTCGTGGTGATGAATGGGCCTCGCTCTTTCGACTTGTCCGTGAAAGGCCTTTCAAGTCGTTCAGAGATTGTGTC
CAGAACGCGGCCATGTTCAAGAACAATGCAGCCAGCCTTTGTAGACAGCCGGCTGGCCACGAACAAAGCGAACAACATCT
TTGTCCCAACAGACGGACGGTCTGTATAAAACAGCAGCCGCCATCGTGTCCCAAAGTGCCTGCCCTCTTCTTCTCACCAT
CCACAACAGCAATCACAGCTCTTTCTACTCGCCAAACACTCTCAAGCCAATTTTTCAACAGACTCATCATCATGTGGGTT
TACTGCGAGAAGTGCCGTCGTGCTTGTCCCCGCGAATGCATGAACAGCCACCAGCACCAGTTTCTGTGCCACTTTCGAGG
CTGTCCGCAGAACCGCCGGCGGTATGCTGTCATTCCCGTGGCTGTCCAGGTTGACGAGAACGGGGAGCCGCCGGCCGGGT
TTTATGCGCCGGGCAATTATCCGGCACCGGAGGGTATGTATTTTTCTGCAAGCCCGCCCCGAAGTCGGCCGCTGAATCGC
CCAGGCCCGTTCCATCCGATGCCTGGTCCGATGCCTGGCCCAGCTGGCCCAATTCCCGACCATATGCCGAGGCCAATGCC
CGGACCAATGCCGAGGCCAATGCCTCCGAACTTCAACGGCTTCGCTAACACGGCCCCAGGTCCCAGACCAGGATCGGGCC
CTCGTCCGACTCCTCACAACCACAACGGCTCTCGCAACCGTAACGGTCCTCGAAACTTCAACGGTTCCCGTGAAAACATC
CCCCGTCCGCACTCGTCCTCTCGCTCGTCCGCACCGCCACCCCTACCGCGTAGCCCGATCTCGCGGGCTCGCCCAACCCC
TTGGCGCCCCCCACACGGGTACGCAGAGACGATTGTGTCTCAGGAGAACGTTGCCGGTGAAAGCCGTCCCCTCTCTCCCC
GTCTGTCTGATCCGTCTGATCCGTTTGATCCGTCTGGCAACCAGGGAAACCCCTGCCGCGACATTATACGGGCCCGCGAC
ATCGTCCGGGCATCCGGGCCAGACGACGACGACGACGATGATGATGATGGCAGCGAGACCGAAGAGGAGCTCTATGTCCA
GGACAAGAACGGTAAGTGGGTGCTCGAGAACGACCGCCCGCGCGAGTGTGGGCGTGCAGGCAGACATGAATGCGGACAGA
CATTTGAGATGCCCATCCGCGGCGGTGTTCATCACGAGGTCCCGCCGCCGGCCCCGTCGCCACCGCTCGATAATCCTTGG
GAGGGGCATCGTTCTCGGGGAAATCGTCCTCGGGGAAATCGTCCTCGGGAGGATAAAAGTCCTCGGGAGGAATATCGTCC
TCGGGAGAATCACCCTCGGGAAGAGTATCGCCCTCAGGAGCATCGTTCTCGGGGTTATCGTCCTCGAGAGGAGCGTCCTC
GGGAGGAATACCGTTCTCGGGAACACCGACCCCGAGAGTGTGTGAGTGAGACCGAGCCGCGATGGACAGCCCGGTATCCT
CCCAACAGCAGCCGCAACGCCACCGTCGATTTTGAGAGCCGCCCGGCAGCACCTCGTCCACGAGAGCGCCGTCCCAGCGA
GCCCCGCGAGGAGAGTCGTCGCAGTGAAGATCGTCGTGGGCCGCATATCGAGCGACAAAGCGAAGGCCGTCGTCGGCGCA
GCGTCAGCCGTCCTCCAAGTGAGTACAATCCCCCCGGCACTCCCCGTGACGATGTCGAGAGCGGCTACAGCCATGTTGAC
AGCGGCTTCCGCCATGTCGACAGCGGCTTCCAGCAGCATCGCCGCTCGAGCCGTTCGGACTCCCAGCCTCCACCGCCGCC
GGCGCCATCGCCTCCGCCCACGTACACGACCCCTTGCCACCCACACAGCCACTCGTCGTATGGCCGTGGCTATGGCACGT
ATCGACGCTGATTGCACCACTCTGGTGCACGGCACTGAGGCAACAGAAGCGGCCGCCCAGAGCCCAGACCGCCGACGAGC
AGGCTTGTTGAATTGCGGTCGGACGACAAACGAACGACGGGCCGAACAGGTGAAACGACAAACAGGGTGACTCATTACGA
CAACAACAGGTGAGCAAAAATCGGGGATCGGCTGAGAAGAGTAGGTGAGCAACAGGAGTCGCGCAGTTATGACAGGACCC
GAGCAAAACATTCGAGTCGCAACAGCTGCTTGTCCCGGGTAAATTCAAAAGCGAATGTGCAAGATGCAGGAAAACGTAGG
CTGGAGCTCGGAGCACCTGGGGACTCAGAGTGCCCGACTCAAGCAGTAAAACAGCAAACAATAAACACACAAAAACACTT
GAAAACTCAAACACATTGATCAGACACTTCACGTATAAGTAAATAAACGAGGCTGGCTGGACAAATCCAATGCCACATCC
TCTATGAATATTATGTGTGACTGGAGATGGGGGCCAAAATAGAGCCCAAAGCCATCGGAACAGGCGCCATTCGCCAATCC
GTTTAATGGCCAAGACACGGCCAGCTATGAACGCCAGTTTTCCCTTCCAAAATGCAGGCCTGAGAACGGACAGACCGCTC
AAGGGCGGGCTCCGCCTGTAGCCCATGACCCAAGAATATCCAAAATAGTGTAAGAATGTGTACAGGTAGAAGAGAAGATG
AGGCGAAGGCAGAAGGGAAGACAGAAGAGGCAGAAGAGAGAAAATGACAACAGCTACATGCGCCGGCTCATGACAAACAT
CTCGTAGTCGCCGACCTTGCCGCGCAGGCTCTCGTTCTCGCGCGCCAGCATCTCGTTGCGCCGCTCCAGATGGGCAATGT
ACTCGGTAGCCTTGCCCAGAATGGTGGCCTTGTTGAGCTTGTGGGCCGGGGCCAGGCCGCCAAGGTCCTCGCCAATGACT
GCGCCAGAGATGCCGGAATACCGCGCCAGCTGCTGCTGATGCTGCTGCTCCTCGTCGTCATCCTCGGACCCGGCATCGGC
CTGACGAGCAACCACGCGCAGAGCCGGCACGGCGTCACGCAGTGCCAGGATCTTGTCGTTGAGGTTGGTGCGGTAGCGCT
TCTCAATCAGGTTGTGAGCCGTCTTCTTAGGCGGCTCGTACGTCGACACGCTCGACTGTTGTTGCTGCTGCTGCTGCTGC
ATCGACGAGGCCGACGACGGCGACAGCGGCGCGGCCGGGCCGCTAATAGACTTGCGCTTCAGTGACGCACTGCTGCTACT
GCTGCCCGAAGAGCCCTTGCGCTGGGCGCCGGCTGACGATGACTTGCGCACCGAATAGCTGCGGCGTTCACGTGGCGACG
GCATGGCGGCGTGATTGCTGCGGGTGTTGGTGAGACTGCGGCTGTGTGCGTGTGTGTGACTGCTGCTGCTGCTTCTGGGC
GCGGCTGCAATGGCAAAGAGATCCTCGTCCGGGCTGCCCGAAAGCTGGATCGGGTCAATGGCCGAGGGAAAGGCAGCAAA
GGTCAGCGGGCTGTCGGCAGGTTCAGGCTTGATGAAGGCCAGGTCGTCGATGTCAGGCTGCTCGAGAGCGGCCCAGGTGT
TGTCAAAGCCGAGCACGGTCGTGTTGGGGTTGATGCAGCTGGTTGTGGGAGAGACAGGAGAACCAAGCGACAGCGGGGAG
TCGGCACTGAAGTCGGTGTTGTAGCTGTTGTTGGCAAAGTTGGTGTATTCCTCGAGAGAATAGCTGTAGAGAGAGTCGGG
GGAGAGGCTGCTAAAGGACTCCTCCAGCGGCAGCTTGAGCGAGATGTCAAAGGGCGGGACGGTGGGGTGATCGATCTCCA
TAATCAGATGGTGGATGGGGGTCGAAAGGAAGGATGAGGCTTGAGGGGGGGTTCAGGTTGAGATGGTGGTCAGAGAAGCT
CCAGAGCTAACGTGGCGAGAATACGGTGGCCAGGGATGTCTGGGGAGAGAGACGGGGAGGGGAGAAGAGGTTGTGTTAAA
AACGGACGTCGTCGGCGGCGTTGTGGGCGATGATGGCTGATGATGGCTGATGATACTCAGGGGCAGATGTTATTGCTTGA
AGCTGATTCAGTTGGGCTCGATGATGGTGGTGAGCCTTCTCTGCGGGTGGAACGACTTGCGACCGGACCTGTCTGTATAT
AAGTAGCTTCCCTCCTCCGCGGTCTGAGCCCCTTGGTCCCATGGCCGGCCGGCACGGCCATCGAGATGCACCGTCGACTT
TTGCCGGCTTCGTTTGTCGATGTTCGCGATGCACAACTAAACGGAAGCCCCGCCCATGGGAAAGAATGGCCCTATGTCCA
GAAACCGAACCACTGCTGTCGGCCGTCTTACGACCATAGGTCGGACGAGTGTCTAGAGCGGTACAAAGCTGCAGGTATCC
TATAGCAGCGGCCCACCTGTTCTGGGCCGCCTGCTGCTACTGAAATACGCGCATACGTGTACTGCGGCGGGGCCCGGGCT
TGGCCCATGGGCTGCTTTGTGGGCGGCTCGGGGCCTGGAGCCACCGACTGGGAAAGTGGGATGGAAAGCCACATCATGGG
TTCTTGCCTCTTTCTCGTGCACGGTGAGGGCATTTCCGACGCCTGCTACGAGATGATGCTGTACGAGTACGAATCTCCCG
TCAATAGCCTTTGTGGCACCTTCCCGACCGCTTCCTCTCTGCTCCTTCCCTCCGCGACATTTTCCGTAGCCCTTCCTTCG
TCTGCATGAAGCAGGCCCTTGCAGGTGCCAAACAGTCATACAGTAGGGGCCAACGCACATCGCATGTACGAGTACGAGAA
CGAGGACTATGCCATGTCCCGCGAAATCGTATCGCAGTCCGTCCTCCGTATGGATAGATATCTGATGAGATTGCCGTCAC
TGAAGCATGCCGAATTTCTTCCATCAATCCGGACCCCAGCCGCAGCCAATCAGAGTATGGCTGAGCCAAAATGGCCTGAT
CGCCTGTCGTCCTCCTCTCTTTCCCGAATGGGCCGTTTCATCGGGAGCGTCCGGCTCAGACGCGCCATATGTGTGCTGGG
AAGCAGGCGCGACGGTTATACTTTCCGTTCGCAGTGGGCGAATTTCCGATATGGGCCGGATGAAACATTCACGTGCAGCA
AAAATTGCTGCTCATCGAGATCGCGAGTTATTACGTACTTTTCGCGATTTCCCGGAACCCCTTCTGCACTGTAGCACCAG
CCACCATTCCCAGAACGCATACGTCGTTAATACCTCAATGAAGCCACACCTAAGCCACAAGAGGTCTCGGGCGTGGCTAA
ATTGCTGTGGATGGACGACAAACTGCCTCAACCCTCACTCACCCTTTCGAAGTATCACGAAACACGTCAGTTACGTCGTT
GCCAACATCGTCTACCTCAAAAGCCGTTATTAGCCGTACATTTACGGAGTACCAGCACAAACTTGAAATACATGCTCGTT
CTCACTCCCTCATAATCATCGCCAGAAGTCTCTCAAGCATTGTTGGCTGCATCGTCGGCATTGAGACGTCATAGCATATC
TTCGTCTAGTGAAGCTGTTCAAACAAAGTGACGAGTTTGCCTACATGCCGCATCTACCACGCATAAGGTCCTCCAACCAG
TGTGTCCTAAGCGCCTTCCACACCGATGAGGCTGAACAGGCCTGCAGAAATGTGCCCAATGTTAAAGCCGCGGACTTCTC
TACTTCTGACAGCTCTCCTCGTCTCCGGTTGACGATCCTCTTTTGGCCTGGCTCACAAGGGCTTGCTGGCAAGCGGCAAT
ACCAGCCACTAGCCACCAGCTAGAAATAGCATGACAGCAAGAAATGGCATTGATCAATACAAGTAGCTGCCGCGACTGGA
AACTACCGCTAATAAAGGAGGTAGGGTGACAGCTTAGCAAGTGCTTCTCCTACAAGTAACTGTCCTTGTGCAGCATGAAA
TTCATCCCGCAATATGCCCAGTGTCATATCGTTAGGTCTCATGTTTTCTACCAGAAAGAGCGTAGGACAGAACCAGACTA
CGAGTACGAGTATGCGTTTGCATTCGATTCTACCCTCCTTCTGTCAAGCCCCGACAATGATAACCTCTTTTCAGGTGTGG
TGATGTCGTCATCAGGACAACCCACGTTCCTTCTCCGCGTAGTTTTCCTGGCCCCTGGCAGTAATGTCGGGTGATGGACG
CCATGGTTATACACAACCAGCAGCAGCTTCGGATGGGGTGGCACGCTGCACTCTCTGACCGATCGGACGCAACCCTGTCT
GCATGAAGCATCACATTAGCTTGAATTACCCGCTAATAGCCGGTTCCGAGATCTGTTCTCACTAGTGTACCGTTCTAGCT
TTGCTCGTTGCTCTTCTGTGGCTGGGCCGGTCAAGTAAGGGCTCGGCTTGTCTCCCAAAGTAGTCAGTACCGAGTACCTC
ACTTCGTCCATCCTTGTTTATGCTCCATATGCAGCCAGATATGGCTTAGGCTGTTCTAGGAAGATTCAGCGTCGTGCTTT
TAGCTGGCCATATTAACAAGGCACACGAGGCACACATACCAGCCCAATGGGTGACAATTTCAGTCATCTTTTCATGGACG
TCTCATTATGCAGGCGTCCGGTCGCCACGCAGTCGTGCGCCCTTCCGCTCCGTATCAGCTTGGAGAACAAGGGTGAAGAA
GGTGGAATTTGGTAAAAGCCCAGACGACGAGACATATGCCAGTAAGAGAACCGCGATGTTACCGCCGAAGCCGTGTCCCC
GGCATACATCGTCTTCTGCATGATTCCGCCAACTTAGTCGGCAATCGCTACAAGCAGCTGTTCTCGGCCAATAGCTGCAG
CTGAGAGAACACCCACAGCTGTAACATCCTTGCTGTCGGTGGTGCCGTACGTCTGTAGATGAGCTGGAACCGGTACCCTT
GACAACGTATCATAGTAAGCACCGAGGTTCAGGATGAGGTCTGCACGACGCCAAGGGAAACCAGCCCCCATCTATAGGAA
GATTAGTCACGGTCACGAACCCCTCATTGATAATGGCGAAATTAGGAAGTATGAGACTGGCGGTGATAAGCTTTCACTAG
AGTTCAGGTTCTTCCAACAAGACTCAGAAACAAGCGGTTGATGACAATGGTTCAGGCCTAGTAGAGTCTCAGAAGAAGAA
ACTATCACAATTAGAAACCAGAGATAAAAAAGCGTGTAAGCAGCACTTACACGGCAGCAAGGCGAACTTTGATGTAGTAT
TTAATTCAACTCGTATTTTCGCTCTCTGTACGTCTTTCTGCTCCATTATTTCCTTGTCATAGCTCATTCCATAGACCGCA
ATTCTCGCCATCCATTTACGGTAGTCAGCAATATCTGAATCACTAGGCATGAGAGAATTGTAGGATTGTCAACAAAAGAA
CGGATAGAGCTGAAGTCCTTGTCTCGGTAACTGTGAGTGAAGTTGTGGTCCATGCTTGGCTTGAGAGTAAAATTTTGGCA
ATCACTGCGCCAGGAAGTGAGAAGCCTCAACTCACTCATTTGCACTCCCTCCTCCCTTGCCACAACGCAAACAGCATCAT
CGGTCTTAACTCTTTAGCGTTTGTTTGTAGGCACGGCTGGTTATCTTACTGCTGGTCGATAATTCTTCTCAGCTTTTGTC
GTGAGGCATCACAGCTGGGAAAAAATCTCCTGTCGTGTGAAGAAGTTGCCTCAACGGGCGCATACGATGTACTCCGTGCA
TCGTTAAGCCCCGGGCCCGGAAACACATTTCCGTCCAATTCCGGGTACCGAGAGCTCTGCAATGGCTAAGCGTTCCTTCT
GGAAGCTCTCCTTCTAAAAGCTCGACCGGCTTGTGCAGATTAAGATCCCCCCCGGGGTGATTGCACCTCATCTCCGGGGG
TAGGAAGACTTCGAATAGCATTTGCGGGGTGCAAAGAGAATGTTACATTTCTTTGGGACAGACACAGCCACGGCACTGGG
TCTTCGCAGTGGATTGGTCAATTTGCGAGGAGAGCCAGAAAAAGGGGGAGAATAGGAGAAGGGGGAATTCCACAAAGTCA
GTCTAAGATCCCAGCTCGGCGCAGAAGAATTGGCCAAAGTCAAACAAGTGCAAGCGAGATCGGCTCGCTTCCGAGAACTG
TCTACGAAACGGAGTCTCGTATACGACGCAATATATCTTGCATGGTGCGCCGGCAGTAAGCGAAATGATAAATGGCCGGA
GTCGGTTTGTGATTGCGAAGCAGTCGCTTAATGCCATGCTGTTTGTCTTGGCCGTAAGCGTATTCTCAATGCGCTTCTTA
AAGCATAGCCAAAATGGTATTACGGAGAATATTTTACAGAGCCTCTTTCAAGTAAAATGATTATAGAGAGTATCGCTGTC
TGCTCTTCTTGCACCTCGTGCCGGCTCAGCCTTCGCCTTAAAATGCAACAAAACGGTGCGCCCACACTCGTTCACTGTGG
GGTGTCAGCGGCTCGGCACGGCTAGGCTAAAGACGAATTGGAGTCCCGCTTAATCGCATAGGGACGTTTCACTGTCATTT
TTGCACGGTCCAAGGCGTAAGCCTTGTCTGCGACAGCCCTGTGTCGCCTCTAGACGACTGCTGTCGTCGAGGTCTCCCAT
ACTTGTGCATGGGGCGCAACGAAGAGATGCACCAATATGAACTCAGATAAGCAGTTTCTTCTGGCAGCATAAAATACTTT
ACAACGTACGAGATGCAGATCGCCAGAACTTCCCTACGATGTAAAGGTCTGTACTCCGTAGAATACGGAGGATTCACATG
CGCTTCAAGCACAGCCACCGACTGAGCTCATTGTGCCCCCACACAGTCATCCAAGTCCGGCTTTGCCCATCGACGATCTG
ATACGGAGTAAACATTTCAACTTCATCAGGGCAGGGCGGTCATGTGTGGCAAGAAGGGCGGCACGTGGAAGCAAGCGCAG
CATACGACAGATAAGCCAGTACATAGTAATGGGCTGGCAGGTCTCTGCTAGTGGTGTCTCAGGCCTCTGGCCAAGGATGG
TGGTCAACATCTGTCATGCCAGAAGTGCACAAAGGACGAGAAGAGAGGAAGAATGAGCTATATACAGGCGTTGAAGTTTC
GTTCCTTGCATTGGTGTTTGGCTGCTTCACGGCTGTACTCTGTACAAAGAGTCACAATCACCTGCAGCTTGCCCCAGTGT
GGTCTGGGCCTGGTTCGCGCCCAGAAGGCGGTAGCGGCAAATGCGGCTGTGATCTGCAGCGATTGGGCGACTGAGGGGAA
AAGGGGCAGCTAGTTCTGGATCCGTCGAGCACACCGACTTCAATTGGGAGGGGGGAGTTGCAGCCCATTGGGTCTGCTCG
TATCCATTGGCAGTCACGAAACGGGCGAAACGGGCGGAAATCAGCAAAACCAGCAGAAACAGCAAAATCAGGTTCGTTGT
TAGAACTGTTGTCTCAGAAGACACACCGACGAGCAACCGGCAGCGCCGGACGATAGCAGATAAGGGTCATGCGTCGCAAT
GGATGATACGAGGTAAAGGTGGTGTGGTGTTCCAATCTGCCCATGGGATTGGGAGGGAGGGGGGTGTCCAATTGGGAGGG
CTCGAGAAGAGGGATTAATAGAGAACGCGCAGGACGTCATTGCAGGGGGGAGGGAGACGCATTGGAAGACGTTGTGGGAT
GGAAAGGATTAAATTGGATTTCCAACCAGAACAGGGCGATGGAATAATTGATAGCGCTCGTAATAATGGGCAGCTCTTTG
TCCGGAAAAGCCGATGAGAGGCAAATGAAGGGCAAATGAAGGCCAGGGGTGATCGGAAGCGGAAAGCCGAACCTGGGCTC
TGGGTCCGGCAGCGCAGGTGGAAATGGGAGTGTATTCAAGTCCGGACGCGGTGAGTGCTGGAGTTTGCATTGCCTTTGCA
TCGTCTTTTCCAGCTGGCAGGCAGCATGGAGATTACAGACCGGAGTCCGACGGGAGAGTTCTCCCATGATTTATAAGTAG
ACCCGCCGCTATCGATAAAAAAAGAGCGGAGAGATCCAGGCTAGGCCGCAAGGAGCGGTGGCTTTCGATTTTATATTAAT
AGCCAAATGACAGGCTTGGAAGGTGGTCGAGTCTGGAAGCTGCTGAAAATTGTACTCAGGACCTTCTAGGAACAGGCTAT
GCACCTGTCAGGAACTGCTAGGAGAGCGCTGGCCGGCCTTATGAGTCACCCTGCTCATCGCGCCATCGCAGTTCGACCCA
GACAGCGCATTGGGCAGGCGGGTGCTGATTGGCCAATTGGGCGGCAGCGCTGACAAGTGGCAAGCAGGGAAGGAGTGATG
GAGGGACGGAGAGGGAAAAGGGAGGGCAGCCCCTCTGGTCAATTGACGTGTTCACGGAGGGTCTCTTGTTCGACGTGGCC
GTCCAGAGCGACAACAGAGACGGCCACGTTTCTGGCTGCTGCAGCACGATCTCCATTTCCCGCCTCGTTCCAGTGACTCA
AATGGCCGTATGTTCTCCGTTTTGGCCCCACAGCGCGAGTTATCTTGCACTTTGCAGCCTTGTCAGTGCGCTGGTCCCGG
CATCGGTGTCTTTTGCGCGCGCTCGTATGTGCTAGAGATACGAGTACGGAATTGCATGTCCATCAGGATCTTGCCGTGAT
ATATCTTAAGATGTTGGCTCGGATGTGACAGCAGGCCGTGCGTCCGTTTTCGTGTTGTTGTGTCGTGTTGTTTGGTGATA
TTCGGATATTTGGTGATGTTTAGTGTTGTTTGGAGTCCGTAGTTGTGCAGCTGTGCAGCTGTGCAGCATGTGCATGTGCA
ATGTGCCGTTCTTCTTCTGCTGTTGCTGCCGATGCTTACTCGCAATGCCTGTTTGCCGTTGTTCACCTCTTCGGTTGTGT
TGTGATGCCTGTCCCCACCGTTTGCATTGACCGTTGCACTAGCCACTAACACCGCCTCCGTTCCAGCATTGTTGTTGGGC
GGAAGGGCTGACCACGCCGGATGACCCAGTCAGACGCCGAGCTACGATATGGTGTGAGACTAGTGCCACCTCAATTCCAC
ACCCCCCCTTTTTCGTCTCAGAGAAGCCAATGTCGTCTGCTACAGAAGGCCACAGAAGACCACTCCCGTACGAGGCCACG
CCGGACATACTGCGACATCCAGTTGCATGTCCCTCTGTTGGGCTCCTTACGCAGTAACCGTTGCCACGCGTACTTTACAT
CCTTACGGGATATCTTATCTTGTCTGTCTGATGTGTCTTATACTACACACGTATGGCGTCAGAAACTCCAGCCCCTCACT
GGGAGGCTAAAGGCATTGGGCCAACCTGCCTGCAAACCTGGCATGAGGGGTGTGTCTCTATAACCGGCATATCTTCCGTC
CTGTCTAGTCGCCGAACGCGAACGAAACATGGCCAGAACTGCTCCCACCACTCACTTCCCGGATCAGCCTCAGAAGCCTG
CCTTGCCTCCTCTCTGCCTTCTCCCCTTTCACTCCCTTGCCTTTCTCATTCCATTTCCAGGGACATTCCTCTTTCTATCT
CCTCCTTCCTCCACCTCTCCATCCGTCTCACTTCTCTTTCTTCGCACCTCCTTCCTCGCCCGTGCTTTCCCTGTCGTATC
TTACCCGTACTCGTATGCTCCTGTCCGCTAGTGCCCCATAACCCATATTACGTACACCCCCTTTCTATTTATTCCACCGC
CCACCGACAACTGCCCCCCCTGGGTCTCCAGCCGCGCCAAACCCCGCGCTAGTAGGAACGTTCTCTCCCGTCAACTCTAT
TATCAATATAGAACAGGCAACAACCGCTACTCTGTCATGCGACGCCCTGTTTATTAGCAATTGCCCAACATCAGCACTTT
GACTATTCAATTCTCACAATTCTGCGATACATTCACTCCCAATCTTATTCTCGCATCCTGTTCTCTCCCTGCCGTCTTCG
CACCTATAAAATCTACTCGCACCCAATTCTTGCCGCCTAGTGCCATCTCGTTCTTTCCTCTTCTGCAACCCCACACACTT
TGCCACGCTCCGCAACCTGCCTTCCCAACTCGGCAATTTTGCCTCCTGCAGTCAAATCGCACCTGCCAGTCCGCACGTCC
CAATCGACATCTGCCAGATCCTGCCAGAATAGGAGAAGGCAGAAAATCACCAGCTTCACCGTCTGCATCCCGTTACAGAC
AGAGCCAATTCGACTTGGCCTGCTGCAATTGCCTCCCGTGTTAACGACGGCGCTGCTGCTTCTTAGTGTTATCACCGCAT
TCGGCTTTACTGCCTCTCTGGTTGCGCAGACACTGCCTTCGCCTTTGCCAACAAATCCGCCTTCCGTCGTGCTGCTGCTG
CCTGGCGCTTCGCCACGCTTTGCTGGCAGTCAATTCTGGTGACGAGCCATCCGTCGCCTTTCCAGCTGTTCACCCATAGG
CATTGCCCCCCTCACCTTTTCCGCTCAGAAACAATTCACATCACCTCGCCTTAGCGCCCTTCTACCGATGGCTCAGTCGC
CCTTCATCATGCCCTTTCCACCCAATCACGGCAGTGTTCCAATGGAGCCTTCAGTCTCTTCATCATCCATTTCTTCCTCC
GTTTCTTCCTCTCTCACTTCTGTTTCGTCTTCTATTTCTACCGCCCTCTCACCGCTTGCTCCGTTTTCATCCTACCACCC
GACGACACCCAAGCGCCACCTGCAACTAGACGACATTAATCGCACGACAGAATCCGCAAAAGACGCATCCGTTTTCTTAA
TGGCATCGGCTTTTAAAAAGCCGCTGGATATCAGCAACCTCATGTCACCACCGGAGCCCGACCAGCTCGACAGCTTCAGC
GTCAATGATGAGTGCAGCCGCAGTTGCAGCCCGGTAGTAACTCACACACAGGTTCCCGCGAACAAGAGCACTGCCCTTCC
TGGGAATGGCCCATTGTCTCCCCCGATCTCGCCGCGGGACAAGAAGACAGACTCTCCCTCGCCTCCTGATGTTACGTCGT
CTGCTTCTGCTTCCGCCTCCCAGGCGACTGCTTGCGACCCCATTCTGTACCCTGCCACGAACGAAGCTCCATCAGCAGCT
CTGTCGCGGCCCCTTTTTGCCTCCACTGTTCCGTCTACAACTGTCAGCAACGCTGCTTCAGACGTGGTGAACGAACATGT
TGCAGCCCGTTCGCCGGCATTATTCTATCACACGGCACCCCCCAAAGGCGAAGACTATGAATTAGCGCTTTACATGAGGG
TGGAGATGATGAACACCATCGAGAAAAATCGCAATTCATGGCTGAAGAAGGAGCGTGAGCAGTTGGTGGCTGACCGCACG
GCTGCAGCCGACCGGAGCAGGCGTCTGCATCACATCCTACCTGCTGCAAAGTCGACGCCGCCTGCACCACGGGCCTCTAC
ACCACGTCTCATGAGGCTCCAGTTCTCCGCGCAACAGGCGCAGCAGGCACAACAGGCACAGCAGTCGCACCCGTCACACC
AGTTGCCGCAGGCATCCCAGCCACAGCCACAGTATCAATTTCCACAGGGCCCGCAGACACGGCTAGTTTCCGAATCGCAC
ATTATGCAACTTCAGCAACGGTCATCTGCGGCTCTGCATCCTGTGGTGGACGCAAACAATCGGGTCACAAAACGTTCGAG
AGCTGCTCCGACACGCATTGCCCCTCAGGTGCACAACGCATTCCAGACGTCTGGCAGTGGTGGCAGCGGAAGCAACATGC
GCGCGCCCGGGACGTCGCCGGAACCGCGCGTGCGCACAACTGCACCCAATCGCGAGGACAAGGATTTTGCTTCTCTGCCA
GACTACTGTCCACCCCTCAGCACACTGCCTGAGCGGACTAACAACCTCAAGGTGGACTGGAAGGGCAACGCACTGGACCT
CTCGCGGGATGCACACCTGCACCTGTTGCATCGCGATGAGGTCGGACTGGCGGCGAGCCTGCGGCTGGACTGTGCGACCT
ATCTCACGAGCAAGCGACGCATCTTTATGCGGCGGCTAGAGTGTGCCCGCATCGGCAAGGAGTTCCGCAAGACGGATGCT
CAGCAGGCATGCAAGATTGACGTCAACAAAGCGTCGAAGCTGTGGACGGCTTACGAGAAGGTGGGCTGGCTGCGAATCGA
CCACATGAAGCGGTTCCTCTGAGCGCTTTCGCCTATCTGTCCCGGTGTCTTCTATTCCGCTCATCCTCTCGCACATGGCC
ACCCCAGGTTTCAGGCTGTCTACAGTTGGCGCACCGCATAGCTTGGTTTTGGCCGCTCTTTTTGTTGCTTTTTTGCTCCA
TCTTCTTCGAACTACCGCTGGCTTTTTCTCGACGGCTTTTAGCCTCTCTTCTTTTTCCTCTTTCTCTTCTTCAATACCAT
TCCCCATCTTCTCATTTCCTTTGTCTTTTACGAACACTCGACGGCTTCACATCAGGATGGATTAGGATTCACAACGGTGG
CAGGCATCATATCACGGTCCTTGGGAAGACCGATGTTGGTCGACTGTTACTCGACGCATTACTAGGGATAGGAGGATGTT
CATTTGATACCCCCGAGACTTCACACGATGGTTCACAACAGATCGATACCCCCCTCCAGTCAGATTTTGTGTATTGACTT
GGCTTTTGTTTACTCTGTAATTGTTTGTTTAATTTGGCTTTTGCTATCTGCTTGTCTCTGTGACGCTGTACTTGGCTGCG
TATTTTGGCACCGCGTGCTATGTTCTGCATCTCCTATCCAGGTTCTATTTTTTTATTTAACTTATATCAACAGATTGAAG
CAACAGATTGAACCATGCTGATTATATCCTGGTCTTCTATTCTCGTCTAACAGGTGTCGCGACGGGAGCCTGCCTCGTAT
GTGAGGATGCTTGCGGTTCGAATTTCCTTTTGATTCAAGATGCCGGCTTGAATAACAGAAGCGAGCTGTGGTGGGACGGT
GCAGAAGCGCAGAGGGTGTGCACTACAGGCAGCCGACAGCGGGTAGCTCTTATTCCATTGTGAAAAGCTGTCGGTTTAAG
ATGGTTGAGGCTTAAGCATGCAGCACGTGATATCGGCAGACCGTGCAGAATAGGAAGGAATAGAATATGCACCAGCCCCG
ATTGCAGAGGAGCGGTCACGTGAAATCATAAACCATGAGGCTCTCGCGGCCGCCACGTGACTCTTTGAGGACAATGACCA
TCTCGTCGTCGAAACCTACCCAGTTGCGGCGGTCATGCCAGTCGTAGGAAACGGCAGGGGGGCGGATGGCGACGCTGCGA
CCACGCTCGGCGGCAGGACGACCCTCGAGTTCCCAGACGCGCATCTCATCGCCACGGACGCTGACGCTGACGGCCTTTCC
GCGGGCGGTGATCTCGGCGTCGCTGATGCCGGAGGTGTGGCCCCAGAGGCGGAAGCCGGGTGAGACGGCGAGTGAGGAGG
CGCTGGAGGTGCAGAGGTGGAGGACGAGCGTGTTGTCGGGCAGGGTGGCGAGGAGGTAGGGGTGGGAGTAGCAGAGCCTA
GTTGGGCCGTCGTCGATGGGTAACGAGGGGAGAGGGGAAGAGGTGGAGGGGACGGAGGATGTGGAGGGGTAGGAGGAGTG
GAAGGCAGTCGGATTGGCTGACGGAGGAGAGGACCGGCGGCTGCCAGCGGTGGGGGAAGAAAAGGCCAGACGGGTGGTGA
CGACACGGGGAAGACTGTCGTGGCTGTTGCTATTGTAGCCGGCAGAGGCGTCAGGACTCTGGACGTGGAGGTCTTGGAGG
CCGATGGCCCAGCCCTGGCGGGTGGAGAATGTGTAGGCGATAGAGGCGATGGTGACGGCGGGCAGGCGGCGGATAGAAAG
GGCCAAAGGGGGGGTGGACGTGTGAGAGCGCAAGGAGTTGATGAGGGTGGGAGGAGGGAGGAGGCTGGAGGAAGAGGAGG
TAGTTGCCGTAGAGGCAGGCCATGCGTATAGTGAGACCAGGACGGACTGCGTGGCCGTGAGGACGAGCGGGTGAGCGTAG
GCGATAGCGACGAGGGACCCGCTGCTGGAGGCGGCATGGACGAAGCGACGATGGAGGGCGCGAACAGCCAGATTGAGGCG
CCAGATGTCGAAGCCGCCGTCGAGACGGCCAACGGCGATGTCGAGGCCGCCAGGGGAAGCGTTGACGGAGAGAGCGGTGG
GGGTTGGGGAGGAGGCGATGGGAGGAGTGCATGGAGGAGTAGCAGAAGCAGCAGAGTTCAAATCAGGGCCAAGACTGAAG
CTGTCAGGACAGTCTGTGGCAATTCCGTCCAACAGCGCGGCCACGAGCAGACTCCTCGTCTTCAGCTCCCACACCTGCAA
TCCTCGTCGGCTGTCGGCTGTGACGGCAATGCCGTCAACCACTTTGACGAGCATCCTCGGCCGCTCCTCTTCATCGTCCT
CGTCTGCGACCCTGCCCCCCATCTCGCTGCCTAGTTGCAGCTCCTCCACGGCACACTGTCCGCGATCCCAATTGTGACGT
AGCTTGTACTGTCGCTTCCAGTCCGTCGGCCTTGGCTGTGGCCTTGTCTGTGGTCTTGCTTGCAGTCGGCCTATCGGGCC
TGCAGTCGACTCCCGTCCACCACCCCGGACTCCCCGGACACGCAACGCTCGCGGCAGTACGAAGCGCACATAGTAGAGCG
CCCTCCACAGCTGCGAGTCGTCGGCCAGCCGGAGAAACCGCCGCGACACCGGCGCCACTGCCAGCAGCCCCGACAGCGTC
AGGTAGCCCAGGATGCGCACAAGCAGCTCGTCCGACAACCGCGAGAGACGGTCGCCCGAACCCCTTGTCCTCGTGCGCTT
CGCTGGCCGCACATCCGTGTTGTTGTCGGCGTCGTCGTCGTCGGCCGTTGCGCCGTTGTCGGTCTCGTGTTTGCGCTTCA
TTCTGTGAGGCGGTCCCGTCTCTGAGACCAAAAAGAATAGGGAAAAAAGACAGGACGCGACCGTGCGATTGCTGCGCTCA
ACGGCGGCGACTTGTGCTCGTTACAAGCCACTGGGTCATGGCCTATTCTTTGGCTGGGCTGGTCGGCGGGGAAATTGGTA
GTGGCTACTTTGGTCTGCTAGTAATTTGCCGCCCCAAACTGGTAGGTAAGCCCCAGGTACATATATTCTAGACGCGATAC
TACTAGATTGCGAATACAGCCAGACCATCTGTCCGAGCAAATCTGCTGAAGAACACCCACGCGAATCTGTCTGCTTCTAT
TCCTCTGTCTCTGCATCACTATCTCCTACTTCGCCTTTTCGCCCGCCAGCTCCCGCTCCGCCTGCTGGTAGTACTTGGCC
GTGTCCACGCCGTGCTGTCCATGGTTGACAAAGTTAAACCACGGCACCACCTGGAAGAACAGCGCCGAGTAGCGTGACTG
CCGCGCCGCCACGCCCTGCATGTGCGGCGTCAGTCGGCTCTCGCCGTAGAGCGTCTCGCCCGCCTTGACCTTGGCCACCA
TTTCGTTCATGTCCATCTCCACCTCGCGGGCGTTCTCCGACATGCCATAGAAGCGCACTGTATGTTAGCATCCAACCGTC
TCGCTCCGTCTATCATTCCTTCTTCCGCTCCGCCTCCCCAAACTTACAGCATGATCGTTGGTAAAAGTAGAGGAAGCCGC
CGGCCAGACCGAGGAAGCCGCCTAGCCGCATGGCCTGGGCAAAGCCGCCCTTGCCGACGTACGACGGTGCAAGCCGCTCC
ATCAGCAGGAGCGTTGTTGGGCCAGCCGCCGCTGCCACTGCGCCGTGCGCGTAGTCGGACGGCCGGGCATATCGGATCAC
CCGCTTGTAGTGTCTGGACAGCTGTCAGAAGGCGGAATACGCAAATCGGAGCCAGGAAGCTTGGGGAGGTCGCCGCGAGG
GCTTTCCGCGGAAGTTCTCTCCGAATCGTGGTGTGCGCTTACGGGTCATTGTCGATGAGCTATATATAGGCAACATTGTC
AGCTAAAACTTCGCTCCAAACAGGTGCACAGATGCAGGCGGCTCGTCCGGTCGGCCTGGTTGCCAATTGGCTGTGGCAAA
CTCACAGGATAGTCGGTCTGGACCACCCGGCTGGGGATGTACGTCGGTGCTGTGGGATTCGCCATGTTGTGTGCCCGAGG
AAAGGAAAGCCGCTGGTGCAGAGTCGATCGACGCTGGTGTGTCGAGATCTTCCGAGGATGAAGAGCCGCGCTTCTGCCTC
AGGCCGCCCTAGGAAAAAACCACCAATCGCAGCCCCAGCAAATGTCAGTGCTTTAATTGCTTAGTCATCATTTTAGTAAC
TACGGAGTACAGGCGCGTCAACGCGTCCCACTTCACAAGGCTGTTCTAGATCGTAGGTGCAAAGCGTCGCTTTCAGTCTC
CAGCACTATCTACTACCAGCTCCCCCATGGCTTCTGACGTGCGTCGACCACAAGCCCCGCCGTCTGCGGGCGGCTTCGAG
GACTACCTTCCTGACGACCTGGCCGACTATGGCAGCCTGTTTGGCGACGAGCAAGACGGGGCCGACAAGTCTGGCAAGTC
CAAAAAGGCGGGCGGCGATGTAACTGCCGGCCTGGGCATCGACGAGGAGGTCGACGTAAAGAAGCGCGCCCGAGAACCGC
GCGTGAAGCTGGACGAGACTCGGTGTGTATCTGCGGTAACTCTCGCCACCCTTGCGCCTTTATGCTGACGGCACAAGGAT
CCTTTCTGCCAAAGGCATCCCGGCTCTGCGACAGCGTGCGAGGAACCTCAAACTGAAGGGCAAGGGCCACGAGGTGGGTT
TTTCTTCCCGACTACTCTGCGCCTATATCGGCTGACAAGCGGACCTGCAGTTCGCCGACGCCTCTCGACTGCTGTCCATG
TACCAGCTGTGGTTGGACGACCTGTTTCCCAAGGCACGCTTTGGGGATGCCCTTGCCATGGTCGAAAAGGAAGGCCACAA
AGCGAGCATGCACAAGATGAGAATGGAGTGGATAAACGAGTCGAAGCCGCGCGACCATGGTGACTCTGACGCGGAGGGGC
AGCCTGGCGAGCACGAAGATGCGCAGCCAGCACAGCAGAGCGGACCACGGCCCAGTGTCCCAAGTCAGGGAGAGAAGGAA
CCGTTACAGCCACAAACACAAACACAAACACAACCACAACCACAGGCAGCACCACAGCCACAACCGCAACCACGACCACG
GCAGACCGGTACAAGCAGCGGCGACCCAATGGAAGAAGATTTGCTAGACGAGGACCTATACGGAGCCTCTCCTGTGCGGC
CTTCACGGAGGCATGAAGCAGACGAGGTGCCTGATGAGGACGAGCTGGACGCCCTCATGGCCGAGGCGGCTGAGGCGCAC
GAGCAACCACCTGCTCAGCCACCTGTACCCACCCAAACGGCCATGGACGACATGGGCGACATGGACGAGCTAGATGCCCT
CATGGCGGAAGCAGAAGCAGCATCATGACATGTTGAACGTGGAATTGCAGGCAATGAAGGGCTACAGCACCGGTGTTTGT
GTGTACAAGTAATTCGTCATAGAAAGCGTTTTGATTTATGCGATTATGCAGTTATCCAATATTTGGTGCCCAACCCCGCG
AAGCAGGACCGAAGAGCTGTACTAGTTTCTTAGAAGCTGCTGCTGTGTAGGAAGGTACCACCCCAGAAAGGAAGCTGTCG
TCCTGCCATCTTCTCGCATTCTCCTAATTTTCTTACGTCTGCTAGTCCAGACTGCTTCAACATGGAGGCAATACATGCGC
GTGCCGAGGATGCCTCGTTCAGCAACATCGACTCGCTACTGTTTGCGCGCCGGCCACGGAAACGCAGGCCGCCGGCAGCA
ACAGAGGTGAAGGCGCGGCTGGAGAAGACACTGCTGCAACCACCGCAAGCGCTTCCGCTCAAGATTGTCGAGCGTGTTCA
ACAGTGCGTACTTTTGTGTTTTGAACCAGCGTCCGTGTTTTACGCATATGTACTGACCTTTGCAGGCGCTGGGATATTCA
GGTGGACAAGACGCTTCTGTTTGAGATTGACCCGCCAGACATTGGCACGCAGACCATCTTCTATCGCGGAGGACGGAACT
TCCAGATTGTCGACTATGAGGAAATAGCAGCACCTCGAGAAGTTGGCGGTGCAGACGCACAGATGGGCCTCGGAGGTGGT
GACGGCAGCAGCATTGTGGCGTCTCTGCCCCTTTCCGGGGTAGGTAATGTGGCAGAGTCAGCAGCCGATGCAGAGGAGCA
GTGGCTTCAGCAGACGGTTTTTGCGAGCGACGCAGCAGCAAAGGCCAAGGAGCGAGCGGCGGCAGCCAGCGCAGCCAATC
TGCAGCGAGTGGTTCAGCCGGCGACCGGAGGACTGTTGGCGGCGGCGCCAGGGTTCGAGCGGGGGATCCAGTTTCAAAAG
AAGAAGCGAGCTGGCAAAGAGGGCAAGAAGAAGACAGGATCACGGCTGTCAGGCGAGACGGGCGAGGAGGAGGACGCGGT
GCAAGAAGAGGCCCGGAGAGTGCGAGAAGATCTGGCCGCAGATGAGGAGTCGGAAGCAGACAACGACGACGAGAAGGTGA
AAGTCGGAGATGGGAACCGAGAGGAGGAGGAGGAGCGTACGGGCGAAGACGACGACGACGCAGACGAAGACGAAGACGAG
CACGGTGACATGGCGGTGGACGAGCTGCTGCCAGTGGAATTTCCGTCGCTGCAGCCAAGCGGAGCAGCTCTCGGGCCCAA
GAAGGAGCGGCGCGAATGGGCACACATGGTGGACCTGTCGAAAGGGTCGGTCAATTTTGCCAGCCTGGCCGGAGGTGCAG
ACATGGCGCGAACGTGGCCGTTTGAGCTGGACGCTTTCCAGAAGGAGGCAATCTACCACCTGGAGTGCGGAGACTCGGTG
TTCGTGGCGGCACACACGTCGGCAGGCAAGACGGTAGTGGCCGAGTACGCGATCGCGCTGGCGCAGAAGCATCAGACAAA
GGCAATCTACACGTCACCGATCAAGGCGCTGAGCAATCAGAAGTTCCGGGACTTCAAGCACGAGTTTGAGGACGTGGGGA
TCCTGACGGGCGACGTGCAAATCAACCCGGAGGCCAAGTGCCTGATCATGACGACAGAGATCCTGCGTAGCAAGCTGTAC
GGCCAGGCAGACTTGCTGCGCGAGGTAGAATTTGTGATTTTCGACGAGGTGCACTACGTCAGCGACACGGAGCGCGGCGT
GGTGTGGGAAGAGGTGATCATCATGCTGCCGGAGCATGTGTCGCTGATCCTGTTGTCGGCGACGGTGCCCAACACGTATG
AGTTTGCATCGTGGGTGGGCCGGACGAAGCGGCGGGATGTGTACGTGATTTCGACGCCGAAACGGCCGGTGCCGCTGGAG
CACTTCCTGTGGAGCGGCAAGGGGGTGCAGAAGATTGTAAGCGCAGACCGCAAGTGGCAGGAGACGGGATACCGGGAGGC
GGTGGTGGCGAGCAGTCCGAAGACGGTGGCGGCTAGCACAGGTGGTGGCAGAGGAGGAGTAGCCGTCCGGGGAGGTCCTG
GAGGTCGAGGAGGGCCAGGTGGCCGGGGAGGACCGGGTGGCCGAGGAGGAGGAGCCGGTGGCCGAGGAGGCACAGGCCGT
GGTGGCGGTGGCCGAGTTGGACCGCCCCGAGCTTCGCATATGCCCGGACACATGGGCCGGACTAGCGGAACAGCATCGCT
GGCACAGGACAAGACGCTCTGGGCGGACGTGGTGCGGTACCTGCGCAAGGCAACGCTGCTGCCGGCGTGCATCTTTGTGT
TCTCGCGGGCGCGATGCGAGGAGTTTGCACAGTCGCTGGGGACGCTGGACTTTTGCGACGCGGGCGAGAAGACACGGATC
CACGCACTCTACTCACGCAGCATTGCGCGGCTGGCACGCGAGGATCAGGAGCTGCCGCAGATTGCACGGCTACGCGACCT
GGCAACACGCGGCATCGCGGTACATCACGGCGGGCTGCTGCCGATCGCCAAGGAGATCGTGGAGCTGCTGTTTGCGCAGT
CGCTGGTCAAGGTGCTCTTTGCGACGGAAACGTTTGCTGTGGGACTCAACCTGCCGACACGAACGGTTGTCTTTTCGGAC
CACCGGAAATTTGACGGGACGCGGCGGCGGGTGCTGTCGCCGGGTGAATACACGCAGATGGCCGGTCGGGCTGGCCGTCG
CGGGCTCGACAGCGTGGGCACGGCGATCCTGGTGCCGGCCGGCGAAGCACGCGAGATTCCGCCGGCCGAGACGCTGCGCA
GCCTGATCCTGGGGCAGCCCACACGGCTGACGTCACAGTTCCGGCTAACATACAACATGATCCTCAGTCTACACCGCGTC
GAGACGCTGCGAGTCGAGGACATGATGAAGCGGTCCTTTTCCGAGAACGCAGTGCAGAGCCGGCGGCCAGAGCATGAAGA
GCAGGTGCGGACTCTCGAGGCCGAGCTGGCCGGGCTGATACGGAAAAGGCCGGCATGCGACGTTTGTGACGGCAGCAGCA
GCGACGGCAGCACGGCCAAGCGACCGATGACGACGTGTCACCAGGCGGCCCAGACGTTCCGGCAGGACTCAGCCCAGATG
TACGACAAGCTGGCCCGGCTGTCTCACGGCAATCCCTCCGTCTTTGGCCGCGGCCGGTTGGTGGTCTTTTCGAATGAGAC
CGGTGTGCGGGCTGTTGGCGTGCTCGCCGAAGATCTGCGCATCCCGACCGACGCTGCGGCGGCTGCCACGCCCTCTGTGC
GCATCGTCGAGCTGCGGCCTCCGCGAGCGACGCCCGACGGCAGCGACTCCCTCGCGTTTGTGCCAGCTCTGCGCTGCTTC
CTACCGCCAGCACTTCCTACAGCAGCGCTTGTACGCATGGCCACAGTGCCGCTGGCCCGGATCGAGCATGTGGCCAACAT
GGTGCTACCGCTGGATGACGAGCCCGAGACAGCAGTGGCACGCCAGCTGGCAAGCGGCAAGGTCGACCTGTCGTGGGACT
CGGATGTGTGGGACGACGTGAACCTGGACCGCGTCCGTGACGTGGATATTGTCTGGTACCTGGACGATCGAAGAGCCAAG
GCGCAGATTGTGGCCGGCTCGGACGCGCTGGCATGTTCCGAGTTTGTAGAGCATGTGAGTGTGGTGCTGCTTGTTTGCTT
GTGTGTCGTTCTGTCGGTAACGTCTCTAACATGTTCAGTACGCTCTCCGTCACGAGGAATGGACGGTACAGGACCACTTG
GCAACGCTGCGCCGGTCGATGGACGACTCGACGCTGGCGCTGCTGCCGGAATACCAGAACCGACTGGCCGTGCTCAAGCA
CCTTGGCTTTGTCAACAGCAGCGCGGTAGTGCTGCTCAAGGGCCGGGTGGCATGCGAGGTGCGCACGGCAGACTCGCTGG
TGCTGACCGAGACGATCCTCAACAACCTGCTGGCCGAGCTGGAGCCGGCGTCGATCGCAGCGCTACTGTCAGTATTTGTG
TACCAGGGCAAGGACGACACGGACCTAGAGGCGGCGCCAGTGATCAGCGCGGAGCTGACACGCGGATTGACGGAGGTGTA
CCGGATTCGCAAAGAGGTGGTGCGGACACAGGAGCAGTTCCACGTGTTGTCGGCGGGCGACGAGGTCGAGTCGGCATCGC
GGCTGCACTTTGGGCTGATGGAAGTGGTGTACGAGTGGGCCAGCGGCAGCCCGTTCAAGACGATTGCCGGCATGACGACG
GAGCAGGAGGGCACGATTGTGCGAACGATTACCCGGCTAGAGGAGACGTGTCGGGAAGTGCGCAACATTGGGCGGATCAT
CGGCGACACGACGTTGGAGACAAAGATGAACGGGGTCAAGGAAGCGATCATGCGGAATATTACGACAGTACCAAGTTTGT
ATTTGTAGGGGGGGATCAGAACGAGCAGATGGGCGACAATGACAAGCAGGACAATGAACGGCAGACAAGCACAGATGGAC
AACAAAACCAGTCAACAGAACACCGCCCAATCAGCTCGAAATGATCTAACGAGGCACAAGAACACCATTCGCCAACGCCG
TGACTTGAACACTCACCGCAGCACTGCAGCACTGCAACACGCCAATACTTCACGCCCTCAATGCCCTCAACCGCTGCTGC
AAGGCATCCTCCTCCTCGGCCGTCGGCTCGGCAGCGGCCGGCTCGCGCACCGGCTCCGTCTTGCTGACCTGGGCTGAGTT
GAGCTCCTGCGACAGCTCAACGCCGGCATCGTCGGCCAGCTTGCCCAGAAGCTCGTGGACGGCGTCGTCGGACACCTGGA
CAGACGTGTTCTGAGTCATGGCGTCGGTGTAGATGCTGTTGGACATGGCGTAGTCCTCGTTCTGCGTCCGGTACTGCTCC
AAGGCCACCAACGTGCGCTCCGGGTTGACGCTGCGCTGCGCCCGGCTCATCGTGCGCGACGACTGCTGCATCATGGCCGT
CATCCGGTTCATCGCGTTGTTGGCTTGGATCTGTGCCACCGATAACTCGGCCATGTCGGCCGCCTGGTCCATCTGCGTGG
CGATGGCTTGCTTGGCTAGCAGCATCCGTGCCTTCTGGGCTGCCTGCTGGGTTTCCCCTTTTTTGAGGAGCTGGCACGTC
AGCACAAACATGAAGCTATTTCGACTTTCAGCATGAGGCAGCCACCCAAGACACCCACATTCTGGATCTGTTTCCGCAGC
TCGCCGTCCTGCTTGGCTGCCTTCTGTGACTCGCGACGGGCCTGCTTGGCGTGAAACTATATCCAGGTCAGTATTCGAGC
TCTCTGGATAGAGTGCTCAGCTTGTCCAGCGTGATCCGATCAGCCTACCCGAGCCTGGAACTCCGTCTGCATGTCGCGGG
CGAGCTGTTTTTGCGACATTGTGACGGCGAAATGAATGTCGTCCGCGTATCGATGGGAATCTCGCTCGCTCTCGCAGGTC
GCTCTTCGGTCGCTCTTCCAAGTCGCTGGTCGCAAGTCCTACAATTCAAGATACAATCTGTCACTGGTCTCTGTCACTCG
TCATACATAGCCCGAAGCCCCGCCTCGCCACCACCACGTGACTATCCCACGTGCTTCTGCCTCAGGCATTCCCGAGGCAC
TAATTCCCCCCTAAATTACTTGCCGCTCGTCGTCTCCTCTTTCCAGCCTCCTATCATTGACAGAGCGCGTCTGGCGCGCA
AACATCCGCTTCTTCTCTGCTTCTTCTGCACGCCATCGCGACCGAGCCCGTCCCGCAGCCCATTTTGTCTGCTGATCTGG
CGATGGGTGCTCCGGCCAAGGCCGCCCGGACGGGCGTTTCACCTGCTCAGAATCTCTCTTTTTCCCCCCCGTCGTCATCG
TCGTCATCACCCAGCGTTTTCTCGCAGCCGAGCCGGTGGCTGCGGTCCTACGATGACTTCATTGCCCGCAATCTCGGCCA
GGTGTCGCAGATCGAGTCGGCTTTGCGGTCGTTGACATATATTATTCCCGGCCGCTTTCGCGATGCCGAGATCGCGTCCG
AGACCATCCACACGGGCGTCCAGCTTCTGTCGCTCTACCACGACATGTTGCTGCTGCGGACGCCGTCTAACAAAGCTGCC
GTGTCGTCATCCACGGCAGCCTCGCAGCCTCCGGGTCCTTCGCCGCCGCCTCCCTCCCAGCACACGCGTTATACGCGCTA
CTGGATTGAGAAGAGCCCGTTTTACCGCCGTGTGGCAGTCGTGTTGCGCATTGTCCGCTACACCGAGCTGCTGTGCGAGA
TGGCCGCCAAGCGGCGCGGTGAGCGTCTGCGCTGGCGGGTCGTCGTGCTAATCGAGGCCATCAAGGCCATCTGCCGCCTG
CTGCTGCTGCGTGTCACGCGAGGACGCACTCTGGTCCGGCCAACAATGCCGATGCGGCAGTTGCCAGCAGAAGTCGGAGA
GGGAGAGCTGGGCGACGAAGAGCCTGACGAGCAGCTGGATGAAGAGGACAACCAGCTGAACGAGGTTTCGGCTTCGCCTC
GGCTCACTGCTGTCCAGCCAATTCCCATCAGCCAGAAACAGCTCTCGCCACAGCCGCCGTTGTCGCCGCCACCGTCGCCA
TGTCCATCCAAGGCCACCACGGCCGTATTGCCACACACGACCCCGCTGACAGCCCCCCCTTCGCCACCGCCTTCGTCCTC
GTCCTTCTCCGCAGCAGCCTCGCAGCAGGCCAAGGCCTGGACCATGCCCCGCACCAAAATGGCCCTGCCGCCGTTGCCGC
AACCCGGCGATATCTCGGCCTATCTGCAGGGCCGTGTGTTGACTGCCGACGACATCAAGGCCGCTCCACGTCTACTCAAC
CGGCTCCGGGGCTCTGGCTATGCTGCCGAGGTGCTGCACATCCTGGCCCCCGTCGTCTTTGCGGCCGCGCTCGCCCACAG
CAGAAGTAGCAGCTCAAGCAGCAGAAACAAGTTTGCTGCTTGGACGCCCTGGCTGGCCGGTCTCGCCATGGAGTGTGCTG
CTCGCCAGCTGCGCGACCACGACAACAACGGGCTGCGCACCACAACGCTGGAGCACGACGAGTGGACCCGACGTGGCTGG
TCCATGGGTTGGTGGTCTATGCGTGGCGCCTTTTACGAACACGCCATGAAAGGCGTCGTGGCCGGCGTGCGGGCACGCGT
GCCCTCGTTCGTCGGCGGCATCCTCGAGGACTACGAGTACCTGTGGGAGAACTACTACTTCAGCACAAGCCCATGAGATG
GCTGCTGGAGCCCTGTTACATTATCGCCTTTCGTTTCTTGTCCCATTAGGTTTTCATCTTTTGTCTTACATAGCACGTGA
CTACTGTTTTAATTGACGCATATGCTACAAGTATCGGTGAAGATGCATGATAGCAGACCGCCTCGAACCTGAGACAGGTG
GATCTCCGATGTGTTGGCAAGACCCTCTCTCAACAGAGCGCATAACGTTGTATCGGCCTTGGAACGATGCTGCATGAGGT
GCTGGCAGCTTGGCAGGTAACTACGTATGAAGTATGGAGTTTCGTAATCGTAACAGTATTCTACATGTATGGGACGGCCA
AGTCACGTGACTCTTGGTTGTAAATGCATCTTCTCAACCGGATTACCACACTCTTTGATACAGTTATACAAATTGGGTTG
TGCCAGAGGCGTAATAGTTTATAGTATAGTTATGGTCATTCATCTCTTCGGATCCCAAAGCAACCACAGACGCCACGGGA
CAAAGTCAGCCGACTTCCAATCCCACACCCAGTCCAGATCCCCTGCGCTTTTAATACACTGTAAAACACAACCGTTCTAG
TTCAGCCGCCGGTGTTTGTCACCACCAAGCGCCCGGCTCTCTCCGCGTACATCTCTGCGTCGCTTCCATCCGGGCAATCC
CTTTGTTAAAGGCTGCTTGCTCCAACACTCCTTGACTTGTCCGATTGTGGTGGTGGTAGTGGTACTCGCTCCCAGCGAAG
TCCGAACGCCGCGCTTCTCGTAAACCCGCAGCGTCCAGAGCAACGTGATCAGTGCCTCCTTGGACGGAAGCGTGGCCCGG
CCGCCCGGCCAAGGCCAGGCGCCGTCCGCCGCGCCGTCCGCCGACAGCTGCGCAAGCCGCATCCCAGCCGCGCCAGCCTC
TCCACCAACCCGTACAACGTCAAGTGGCTTCTCAGAACACACCAACCGCAATACCCGCATCGTCGCATCCACTAGAGGAC
GCGCCAGCATGGGGTTGCTGGTCAGAATCTTCCGAAGCACCTTCAGTCTCAGGGTCGAAGAAAGACGGCTCGGCCGGGAC
AAGGCCGCAGCTGCCGACGAGGACGTCGTAGCCGGATGACTGCTGCGCCCCGTCCGCATTGAGGAAGTCGTTGATGTCGA
AGCCTGCGCCGAGGAGTGGCGGTAGGGCCTCGTTGTCAACCAGATAATTGAATTCAGAACTGCCCGAGTCGGGGGAATCG
AGAAACCCTGCTTCAAGGACAAAGCTATCAGGGTCAGAGGATGCCGGAAAGCCAAGAGAGTCATCGTAGAGAGAGAGGTC
AGCATCAGCTGGCAGAGCAAGGCCGTGTGCGCCAGCGTCAACGGCTGCGGCATCGTCCAGCCCGGGGACACCTCCGCCGA
CAGACACTGCAGGTCTGGGCACAGCGTCGCAGCAGGACGTTGTGTCTTGTCGGGGGAGGGCCCAAGGAGGGACGACGCCA
GAGCGGCGACGTCGGCTGCTGGCTGGGCCAGGTCTTGGAGCAGCTGCTGCTGGTGGATCGGTTGTGGCAGCGAGAGCGGC
ACCGGCTGCTGTTCCGTCGCCCCGTGGCCGTCGTTGTCGGTCGTATCGCGAACCGGGTTGAGCGGCGGCGAGAGCGAGAC
GGGGTCGATTGTGTTTGCGTCTTGTGGAGACATAAAACCGCCACCGAGAAGCGAGGCGTGGCCGTCCTGCGAGCTGAAGA
GCTCCTGCGAGAGCGTGACGGGCGTGCTCCGGCTAGACGTCATCACGACCGACTTGCCCTCGGCCTGGGTCAGCCGCTGA
TACAGCATCAGGTTCTCCTTCTGGGCGTTGAGCAGGAGCGCCTCTAGCTCCTTGTTGCGCTCCTCGAGGGCCTCGACCTC
AAGCCGCTTGCGCTCACGAGACGACTGGGCGGCACGGCGGTTCCGCAGAACCCGTTCCACACGCCGCTGCTCCTTTTCGT
CTTCGGTCTTTGCACGTTTTCGTGGCGGCAGGTTGGTCTTGGGCTCGGGCAGTACCTGGCCCCATGACTTCCGCTTCTTT
GTCTTCTTCTCTGTGACCGGAGAGTCTTCCGTCTTGGTCACTCCCGCGTCGTCCAGGTCAAACGAGACCGACTTCTCCCG
GTGCTCATCCTCGTCGATGACAGACACGTCTGCGCCATCCAGACTGTGTGGGGTTGCGGGTGCTGATGGCGAGGCGGATG
CTTGTGAGAAGAGGGACGAGTACACCTCACCGGGAGCAGATAGGAACGACTCCGCCGGCGACGCCTCCAGCTTGACAGAC
ATGTCGAATATGAGACCAGCCAATCTAAGCGGTGTGCAAGTGGGAGTATGTAAAGTGGAAGGGGATGTTTTTTTGTGTTT
GTGTTTTGATGTTGTTTGATACTCGTTGTTTCGGTTTGGAAATCAATCATTGGCTGTCCCTCAAGACGATGGTAAAGACA
TGCAAGACGGTTCTTCTTTAGGGAGCCGCTATATTGCTGCCTACGCCAACTAGGGGCGGGGATTCAGGCGGATGACTCTT
ACTCTTACTGGAGGTCGTTTCCAAACACAAGGCAGAAGGCGATCTTTATGTAGAGGACACGTTGGCAAAAGAGCCCTGGC
TGCCTCAGGCAGCAGCAGGCACAGGAAATATGGGGCGTCTCAGGGGAGGCGTGAGAGAGAGCCCACGATTGGTGGGTGTG
GGGTGAGTGGGGCACAGCACGCCACCATATTACGAGCAAATTGGCACGGCCTGGCAGAGAAGAGGGTGGGAGCAGTGACA
TGCAGCGAGGCAGCGGTGTCTGGAAAGGTACTTTGTTGGCCCAGGCAGGGATGAAACCAGCGAGCGAGAACGAAGCACGC
ACTGTGGGGCGGCTCCGCCGAAAAGGGCAGGCCAGCAGTGTTGGGGGCGAACGGGGCATTGGAGTGCTCCATCTCCCTGC
GTTAGTGCGACGACCAGGCGAGGGAGAAGAAAGGGGGGCCTCAAGGGCGGAACGTGCTCACCTGCAGGTGTCGTGCTGGC
CGCCGTTTGGCAGAGGAATATGAACGTGTTGGGACGAGAGCACGCTCGCATATGGAGTAAGAAACACGTCAGATACGCCC
GCAAGAGGCCGACTCTGCCCGTCAGCTCTCGGACACATCTTCTACGAGTACGGCCACGCTACAGTGTTATTAGCTGTTGC
ACCCAGCTGACGATTTTGAGGCAGTGCGGCTATCTTTAGACATCGTACGAACACTGTGCGTGCACTGTTTGGTCGAGAAT
CTTCTACGGAGTACGAGATTGCTGGCAATCTACGGAGTAGGTCGTACTCCGTATATAAGATACGAACCCGGCCCCTGTAC
TCCGTATGTATGTAAGAATCTCACTCCAGGCCCGAGTGCTCCGCTGGCCCAGCCTCGATACGAGTACTGGTATCTTGCAT
TTGTACCCTGGTTTTATGCTACATGCTGTGCATACCGCATCTTATCATCTTCATCCACTTTGGGCAGAGTCACTGCCAAA
AAGGCAGGTGTTTGGGGCGGTAGGATTCGTAGACCGCCACGAATGCTCCGTATCAATGCATTGGCCATTATGCATACTAA
GATGCTCCGTACGAGTACGTGATTAGTATCTTATGTGTGTGTACTCGCACGGAGTACGACATGTGCTGCCACCGTCACGT
GGTCGCTTCACTCCATGCAAATCTAGACCACTGCCCCCAGCCAATCAACACGTGTATTCACGCACGTGACTGGGTTGTGT
TTATTCTTCTGCTTATTCATTTTATCTGCCTCTTATCACATGTATCTCCACAGCTCGCCACTGCGCTCGGCAAGATGGAA
GAAGAGGACAGAGGTAGGGGAGGGGCTCCTGAAGGAATTGGCCGTCTGCCGAATACACGTCATGTCGCTGACCAGCCGCA
GATTCGACTGCCCAGTCGGAGATCGACCAGGACGAGGTGATGGAGGATGTGGACGACGCAGAAAACGACCGCGAGGGAGA
GGGGGACGAGGAGGACCAGCTGGACGAGGAGGCAGAGGCTGACGCTGAAGCGGACGCAGAAGCAGAAGCGGAAGCAGAAG
CAGAAGCGGAAGCAGAAGCAGAAGCGGAAGCAGAAGCAGAAGCGGAAGCAGAAGCAGACGCCGATGCAGACGCCGAAATA
GAAGCTGAAGCTGAAGGAGAAGGAGAAGCGGACAGAGAAGGCGAGACCGAGACAGGCGGCGGGTCGCCGGGCAAAGAGAC
TGCTCGCAGCACAGATGCAGCCGACGGAACGGCTGTAGACTCAGCCGAGACGATAGCAGCGACGCGGCAGCGAACGGGCA
GCGCGTCACCGGCATCGATGCAACGGGTGTGGGCCAGAGCAGTGGCAGCACGGGTGTACGACATTGTGCCGACGATGGCG
GCACCGCAAGCGACGAGTATCAACGCGCTGGCTGTCACGCCAGACCTGCGTTTCATCATGACCGGCGGATCGGACGGCTA
TATTCGCAAGTACGACGGGCCAGGCACCATAAACGGCAAGCAGCTGCTGACCGTGGCCCAGCGACACCCGTTTGTCGACA
GCGTCGTCAAGGCCGGCATCCTGATGTCGTACTGGGAGAACGACGAGCCGCCGCCGGGTAGCAGCATTGGTGGTGGCGGG
AGCGGCAGCAATGGCGGCGGCCCTGGCGGCGGGTCTGGGATGACGGCCACAACGGCAGCAGTAGCAGCTGCTGCAGCTCG
CAGCGCGGCCGAGGATCACATCCTGTCGCCGGTCTACTCGCTGGCCGTGCACTCGCACGCTCTCTGGCTGCTGGCCGGCA
CAGAAGGCGGCGGGATCAACCTGCAGAGCGTGCGGCACGACGAGGGAAAACGTATCACCAGCCTGCTGGGCCATAGCAAT
GCCGTCAGCGTGTTGCAGCTGGCGCCCGACGAACGGAGCGTGCTGAGCGGCAGTTGGGACAAGAACATTTTCGACTGGGA
TCTCAACACAGGTCACGTGCGTCGCCATTTCGACGGCACCGGCGGCCAAGTTTCAGCCATTGAGCTGCGCCCGGCCAGCG
GCGCGCCCATCCCGTCACAGGACGACCAGTCGGTGGCAGCAGCAGCGGCAGCAGCAGCGGCAGCAGCAGCGGCAGCAGCA
GTGGGCGTCGATTCTACCTTTTCGTCGTCCAACAGTCAGCCGCTGACTAATGGCGTCTCCGTGCGCGATGGCCCGACCAG
CGGGGAGATCAACGGAGAGACCGGCTTGGGCACGGCAGCCGGTGTAGGCGTAGGGCCATCAGCGAGCGGTGCATCAGCCA
CGATCAACGGCGACGACCCCATCCCCGATCACGAGTCGCTATTTGGCAGCCCGGTCGTACCGCTGTACGGCGGCATGGGC
GAGAATTCGTTTGGCGACGACGACGGCGGCATGGTCACGGCTATCGACAGCTTTGAGCAGGACGTCGACATGGTGTTGGA
CAGCAGCAACAACAACGAAGCTGCAGCAACCGACGCCTTTGGCGACTCTTTTGGCGCAGATACGGCCGCTTCTGTTTCTG
CTCTTTCAGCCTCTGCTGCAGCGCTACCCCTCGACGACGACCCGCCAGCTACAGATCCCATGGTTGACCAACCGTCCACG
CCAGCTGCTCTTCAGCAGCAGCTGTCGGCCCAGACCCACGGCCCCGACTTTGCCGACGCCCCGCTGCTCTCGTCCTCGGC
TGCTGAGCCGCCTGCATCGCAAACCGAGCCCAGCTCTCAGGCCACCCAGACCGCTGCCGACGCCACCCAGACGTCCCTGA
TCAAGTCCGAGGCCGCCCTGCCGTCTCAGCACGGCTCTCCACCTCCCGTCTCCTCCCCCTCGGCTCTTGTCTACTCGTCC
CAACCGCCTCCGGCCGAGTTCGATCCCACCCAGATCTCCGAGACCACATTTTTCTCTGCCAGCATCGACGGCACCATCCG
CATCTGGGATCGTCGACAGAGCCTGCCTATCGCCCGCATCGGCAACCGTCCTGGCGTGCCGCCCTGGTGCATGGGCGCCT
GTTGGAGCCCCGATGGCAACCGCATCTACGCCGGACGTCGCAATGGCATCGTCGAGGAGTTCGACATCCATCGTGCCCGC
AGCTCCTGGAAGCCTGAGCGCTCTCTTCGCTTTCCTGCTGGTAGCGGGCCTGTCAGTGCTGTTCGCGCCATGGTCAATGG
CCGTCATCTTGTGTGGTGAGTGTGGTGTTTTTCTCTGTTTTTGTCTCTCTCTTCTTTCCTTCTTTCCCATTTTTCCTAAC
CCCAACAGTGCCTCCCACGATATCCTCCGCCTCTACGACCTCAACGATGCCGCCTCTAAGACCTCCAGCGTCCCCTTCCT
CATCATCCCCGGACCTCCGCGCGCTGGCGTCATCTCCCACCTCTACATCGACCGCACTTCGCGCTACATGTTCTCCACCG
CCGGTACTCGTGGCTGGGAGGGCACAAGCACCGAGGCCCTGATCGGCTACGAGATCAATTCCGTCGTCGGCTAGGAGCTA
CCGCGACAGACTCTGAAACCTACGAAAGCCAGAACCAGAACCAGAAAGGGCTTGCGAGCCTCATCTACGAAAAAGCTGAC
TCGGGGAGGTCGACTACGCTGGAAGGCGTAAACCTGAAGACCTGGGACAAAGCACGGCGTTCGTCCGTACATTTTCACTA
CGGTGCTGCCACATATCTTTAGGGCAGGAAATGCAGACTTACGTAATCAAAGTAGCCTAGCAGCGCGACAGCTTAGTGCA
AAGGCTACCTACCTACTGCTTTATTTCCCTGGTCTATATTGAATGCCACAAGTCCATTCGCCCAGATGGGCCTCCGTGTC
CGGCAGCCTCGCCTGCCCGAGCTGTCACAATGCATATGGTATTCCCCCATGCAGAAACAAGCGCAATAATCATAAGCAGC
CGCCGCACCCAAAATACAGAAAAAGAAAAAAGAGCACGGAAACGCAAACAGCCAGATATGCAGCCAGAGGAAGAGGTGGA
AGCATTGTTTGCACACCAAGAAATATGCTAAGAATGTAACTAGCTGGCGCTTTTCGTAGCCGAGCAGTATTATATATGCG
CCGTTCAGCACATTTCAGAGACACCAATGCGTAGCAGGACCGAATCTGCCAGTGGGTTAGAGCAACCAAAGGTATCTCCG
TCAACGTCCGCGGAGCAGCCGCTCGCGACAAACAGCGGCGTGTCAGCAGCCCTGCTGGATGCGGGGCTAGGATTCCACCC
AAGAGACGCCTGGGAGTCGCTCTGGCCGGACCGACTACGACTGCGGCCGTTGCTGTGGCCGTGGCTGCGGCTGCGGCTGC
GGCTGCTCGGAGACCCACAACCGTGGAGGGACAATCGGCCAGCGTCGGAAAGATCACCCGCTGCTGCATTGCTGCTGTTG
ACCTGTCGAGAATCCTACTTCGTCGCCCGGTCTGCGGGTGTCTTCCACAAGCCATAGTCGCCCTCGCAGTTCTTCCACAT
CTTGATCGTGCCGTCCTCCGACCCGGTGGCATACAGCTTTCCGTCCGGCGAGAAGGCGACCGACCAAACCGGTCCGTGAT
GGCCCTTGAGAACATCTGGCTGGTTAGAGCAAAACGAGAGAAGATAAGAACACAGGGCAAGAAAAAACGAACCAATCTCG
TTGCCATCCTCCCAGGAATACACCCGCACCCAGGTGCCCGGCTCCTCGCCCACGATGAACTTGCGGCCCTTGAGATCGAG
ACCGACGCTAGCCACGCCATGCGACAGCTGGAAGTCCTTGATCTTGTTGTCAAATTGTTCGCCGTCCCAGAAGTATACCG
ACTTCCCGGCTGCCGCCGCCAGCACTGGCTTGCCGCCGCCAATATCTGACGGGCTGCTGTAGCCTTGCGCCAGCTCGACA
ATTTCGCAGGACTTGATCTCGCCGTCCAGCACCTCCTCGCGGACACAGCTCAGCGATGGGATGTCAAACCAGCGGAGCGT
GTTTCCAGACGCCGTGATCAGGATTGTCGGCTTGTTTGTCCATACGATGAATTTGATTGAGTCCTTGTGCACGCCGGCTC
CAATTTCAAAGGCCGCCCCGGTCTCGAGGGTGACCGACTCTATTGGCGCGGAAGCAGACGGCGAGCTCGGTCTCGGTCTG
GTCTCGGCCAGGTCGAATATGCGCAGCTTCTTCTCGAAACCACCGGTAGCGATCATATCTGCATTGTGGGGAGGGTAGGC
AATGGCGCGGACGATGTGGTTGTGCTGAAGCGTGTAGAGGAGCTCGCCCGTATGGGTGTCCCAGATCTTGCTGAGAGAAC
TGGTTAGGAGGTGACGCGTCGAGGTCGGTCTCGCCGGAGGTCGGCACCACTTACGCTGTGAAGTCGGCCGAGGCCGTGGC
GGCCGTTGAGATGTCGTGGCTCAGCTTTGCCTGCCAGACGGCACCCTTGTGGCCGATGAAGGTACCAATCCTGTCTAGTT
AGCAGCTGGCAGTTGTGAGATGGACGTAGACCCTCCGCTGCCACGTACCAATCGCCCGTACGGCCATCTCGGAGGATAGG
ATTTCCATCTGGAGCGGAGTCAGCCAGCAAAAAACAAAGGCGAGATCGGCGAGTCAAAAATCGGCCTCACCCTTGCAGGC
CGAAATTAGGTAGTAGTTCTCGTCGCGAGCCAGAGATGAGAAGCCAATGTGCGGCACCGGGCGAGAATGGCCGTGGCAGG
TGAGCGGCACATACTGCCGGCCATCAGGGGGCACGCTGGTCATTGGTATTGTCTGTGCGTCGTTTCGGGAGGGAGGACGT
CGTGGTGCTCGACAATGAATGTCGAAGATAGAGGCTGGCGGGAGAGAGGCAGAGAAAGGAGACGAAAGTCTGATCTCAGC
AGCAAAGGACTGTCGGTGAAGAGATGTTGAGCAGGGAAAGAGCGTGTAGGTCCAGGGATGCAAGGCACAGAAGGCGCAAC
CGTCTGAGAAGAGGCCAGCAAGAGCTGCAAAAGAAGGAGCGTTCCAGTCGTATGAAGTCGTGACGTAATAGCAGTTTTCC
CAGACCGTGTCCAAAGAGCGAGAAATACAGAGGGCGAGGGCACAAAAGAAGAACGAGAAGCAGACCAGCGCAGGCAGACC
CAACTGCAGAAAAGGGAAGCAAGTGGGCGAGGAAGATTGTGTCTATTTTATTTCGGGGGGTTTCATCGATTTGGGGCGCC
ACAAGCGCCACAACTCTATCACGACAGCGGGGTAGGCACTATCCACTGCAGCAGTGACGAAGAGCTTCGCCCGTTGGCTG
ATTAGTCAACCTACATTACAAACAACATCTCCTCTAGGCCGCCCAGCCTCTTTTCCCAATCTCGAGAGCAACGACGAACC
CGACTGTGCTCGCGTATCAGAATCAGAGACTGCAATACCCAAGAACCAGGCTGCGATGGCGGACAACAACGGCGACTTCC
AGCTTTCGGCCAGCCTGGCTGGCCACGACAAGGATGTGAGTTTAGAGAAGCCGATGGAAGGAGTCGAGATGATTCGTTGA
AGCGCTGCGACGTTGAAGCTGTCAGACCTCTTGCTCACACCACAGGTTCGTGCTGTCTGCTTTCCTGCCCCGGGCAGCGT
CTTCACGGCCTCCCGCGACTGCACCGTCCAGGCCTGGCACGAGTCCGTGGCGAGTCCGCCCACATACTCGGCAACGCTGC
TGGCACAGGCACCTTACTCGTTCAACTCGTTGGCTTACCTCCCGCCGTCTGAAGCGCGGCCCCAGCACCCACACGGGCTC
GTTCTCGCCGGCAGCCAGGGCCACACGATCGAGGTGCGGCAACCCGAGTCGAACGTGTCGGAGCCCCGCGTGGCCCTGCT
TTCAGGCCACGGCAGCAACGTGTCGACTATTGACGTATCTCCGAGCGGTGACTTTGTCGTCTCGGGCGACTGGGACGGCA
GGGTGAAGCTGTGGAGCACAGAAACATGGGAGCTGCAGCTGGACCTGCCCGGACCGGACCTCAGCGACAAACAGAGGGCG
ATCTGGGCCGTGCTCGCGTACAGCGACAATATTGTGGTCACAGGCTCGGCCGACCACGTCATCCGCGGATACACGCTGCA
GGGGTCGCACAACGGCGGCGAGCTCAGGGCCGGGGTGGTGATCCGCACGCCCGACGTGGTGCGAGCGCTGAGCCGCGTGC
GCAAGCATGCCGGCGGCGCCAAGATTGCGAGTGCCGGCAACGACTTCTTGATTCGGCTGTGGCAGTTCAACGGCACCGAG
GTCGGCGTGCTGCACGGCCACGACAGCTTCATCTACGCGCTGGACAGCCTGCCGACCGGCGAGCTGGTCAGCTCCAGCGA
GGACCGCACCGTACGCATCTGGAGAGACACGTCCTGCATCCAGACCATCACGCATCCGGCGCTGTCTATCTGGTCGGTGT
CGGTGTGCCAGCAGACGGGCGACTTTGCCACCGGTGCCAGCGACAGCGTGGCTCGCATCTTCACGCGGAGCCGTGACCGC
ATCGCCGCTCCGGTCGTGCTGCAGGAGTTCCGGGAAGCTGTCCAGCACTCCGCCATTCCGCAGCAGCAGGTCGGCGACGT
CAATGCGAGCACACTGCCTGGACCGGACTTTATCGAGACCAAGTCCGGCACGAAGGAGGGTCAAACGGTCATGATCAACT
CGGGAGGCGGCAACATCAGCGTGTACCAGTGGTCTGTAGGCACGTATTATTCCTCTCGTCGTCTCGTCATCTCGGCTCGC
TCGCCTCGCACATGCTAACATCTTGTTGCAGGCCAGAATCAATGGCTCCTTGTCGGCACCGTGGTGGACTCGTCCGCTAC
AGAGGCAGAAAGTGCAGCAGACAACACCTTCACGCTGGACATGGCACCACCCGCCGGCGAAACGCCGCCAAAGCCGAGCA
TCAGCCATCCGCTAGGCACGCAAGCAGTGTTTGCCACTCTGCTTCAGAGCAATTTTGCCCGTGAGCAGGCCGGGGGGACA
GATGAGAAGGAACGACTGCTGACACTCTCGCAGCCGTTCTCAAGCGAATCAACACGGTGAACAGCACTCTCAGCGACGGA
TCTACGCTGGATGCCGACCAGCTGGCGAAGCTAGACCATTTGGTGCAGACTCTGAGCAAGGAAGTGCCCCAGATACCCGC
AGCAGTGCCAGCAACGGCGCGACCGACGACGAAGACCTTTGACCTCGACGCCGACTCGGTGACGCTGGTTCTCCGACTGG
CCACGACATGGCCGTATAAGGACCGGCTGCCTAGCCTCGATCTGCTGCGGTGCATGGCCGCATCGCCGTCCGTGGCCGAA
TTCAGCGACGGCGAGGGTCACAGCGTGCTGGATGCGCTACTGCCGAGCATCCTCGCCTTCCCGGCCGATGCCAAGACGGG
CCTACCACAGGATGCAAAGGCGGCTGAAAATAACAGCATGATGGTGCTACGGCTGCTGACTAATCTCTTCGTCACCGCTG
CTGGCCAGCAGCTGGTGGCCAAGAACGCCGAACGCGCCGTGGGCTTCCTCTCGGACGTGCTCGACTGCAGCGGGCACAAG
AACCGCAACCTGATGGTAGCGCTGGCCTCGGCAGCAAGCAACATGGCGGCGTTTGCGCTGCGGGAACACGAGGCGACGAG
TCAGTCAGCCTTTGGCGGAGACACGCTGGCCAGGCTGATCAAAGTGCTGGCAGTACCGGTCTTGGATCTGGCCGACGGTG
AGGTGGTGTACCGGTCGCTGGTGGCGCTGGGCAACCTGGCCAGCATACCGGGCGGCGACTACGCGCATCGCCTGCGCACG
GCTGGGGCGAAGTCGTGGATCAGCGCGGCGACGGACAAGATCAAAGAAGAGAGAATAGGGTCGATCGGAGAGACCATTCT
CCAGCTGCTGTGATACTCGTGCAAAAAGGGGTCATAAATTATAGCATGCCGACAGCCAGGGTATGATAGCAATGAAAGAG
TGCGCGCAGAAACAGCGCCAAATATAAATACAAGATCGTGGACCCCAGCCTGGTCCTTTCGTTGCCCCAAACGCCAGTCT
ATATATGTACACAGGACAGTGTCAGCGCCTACAGCAGTAGCCACAGGCCGGCAACGAGGAGCGGCAGCCAGCTGACGGCG
AGCGAGCCACGGGCGGTGGACGGGGCTCCCGCGCTGGACGTGATGTTGGTTGCGACCTTGGTGGCAATGGTGTAGAGGGT
GGAGAAGCCAATGTCCGTGCTGTTGAAGCAGTTGGTCTCGTTGACGGGATTGAGGCGCGGGTCGTCGTTGTCAACAAGGG
TGATGTCGACGCACTATTCCGGTTAGGACAGGACGGAAACGGACAAACGGACAAACAGAGAGAGACACGGCAGCTTACCG
AAAACAGAGAGGCGCCATGCACGGCCAGCTCGACGACCTGGATGGTGGCATTGTCGCCCACCTTGGCATTTGCGTTGGCC
GGCAGCGGAACCTGTGGCAGACAGATGGTGCCGGGGTATGGGTTCTTGGACGGGCCGGTGATGCCAAACTGCGAGACCAT
GACGTTGGACATGTTGCCGGGACCGCCGTCAGGGCCATCGGTGCCGAAGCCCATGTTGATAAAGAGCTGGGCAGTGGCAT
GGCCCTGGAACCAGCCGGGTTGAAACGACACGGCGCCACCGCCGATGGGCCAGAAAGTGCGGTTGGTCGTGAGCTTCATG
CCACCACACGGGTACATCCACTGCATGCCGTAGGGAAAGGTCGCGTTCGTGACGAGGTTGTCGCCTCGCCAACCGGGATA
GACGATGATGGTGTGTGCCGAGACCAGGGCAGCGCCGAGGACGGCAACGAGGAGCGAGAGCGTGGTGGACGTCATGGTGG
CGGTTGGTGCTGCGAGGGGAGAGCTTGGAGTTGACAGAAAGACCGCAAACAGAGGCCGAGAAGTGCAGGAAACAGGTCGA
TGCCGAGAAGGATTGGCGACAGAGTGCGGGTGGTCTTGGCCATATCTACTCGCTCGGAGCAGCAGCGCCCTGTTGCCGGA
GAGTGTGACGGCACATGCATAGGCAGAGTTGGCTGGCCAGAGCGAAAGTGATTCCCCCGCTCTGCTCTCCAGTCCGCCAA
TCACATCGTCGTGCTCCTGCAACTCTGCCTGCTCGGGCCGCCCGGCTTGGGAGGGAGAGCAGTCTGGCGGGCGGCTCTCT
GGCCTGCAGGCCAATCAGACTGCCATTCAGCCATCCTGATCCCTGCTGGGGCCACTTTTCGTCATCACAGCACCAGCCAA
TGGCAGGCGGAGCGGCACCAACGAGCGGGCGACTCGCCCAGACATGCGCCAATGGGCACAGAAGACGTCTGTCGCACGCG
ATGGAGCAGGATCGTGTCCGTACGATCATCAGGCGGCCGTGCGATCCCAATCTGTCTGGAGAGCCTCCCGATGGCTTGCT
CGACACGAGCAGAACGCGACGCAGGTGAGACTGCTAACGCAGGGCGGCTTGGCCACCGCACTTGTAAGCGCCGGCATCAG
TCCACGCTGCATGAAGCCAGTCTCAACGGAGTACTCCGTAATTTTAGGTTGGTATCCTTTTCTTTAGTGCAACGGTCTTC
TGTTTGTTGCATATGAGAGTTGTACTCCGCCCCTTTTCATGCATGTGTCTATTTGTTGCATGTGTGCAGTTAGTCGCTTA
ACTTTCTTCAGCTTCAACTAAGATACCTGAACAGCTCAACTCATCACTGCGACTTGCAGCACCATGTCTGCATCGCCACC
CGCCATTCCCGACGGTGACAGCGCCGACTCTCCGTCTCCGTGGACCGTCGTCAAGGTCAAGGGAAGCCGCCACAGGGGCC
ATGGCCGCCGCAGACGTAGTGCTGCCGCCCTGGACTTCCACCAACCAGAGCCCATCCGGTCATCAGCCAAGGGCCCGGCC
TCTGCAGCCGATATCGAACATGTCCAGCGCGAACACACGCGTGTAGCAGCAGAGTTTTGCGCACAGCCGTCGTGGCGCCA
CGTCACAGCCTGGGTTGCCGCCAATGCTTCCGGCCATGCAGCCGTGTCTCGAGCCGTCTGTCTCGGTGCCGGGTCCTTTG
GCAGTCCTCTTGACGGCGGAGAGGCCATTCGCCGTGCTCACGTCCAGACTGCCGTGTTCCTGGCGATTATCGAGATTCTG
GGTGTGTGCTGTCGGCCTTGGTCTTCCTGTCATCTCCTCTTGCTGACCTTCAGCCCCTGCCGGCATCCCGTGCTTCTTTC
AAGAGCCGCTGTACGGCGATGCCGATCGCAAGTTTCTCGAAAGCCTAGGCCACTCCGTCGTCGAGACGCCTGCTGCCACG
GCCATGATCAATGCTGACACGCTGGTGTTCGCAATCCACCTGCCCACTCGCGCATATCTGGACTGTCTCGCAGGCGACCA
GCCGGCCTTGCTGATCGGCTCTGGCTACGAGTGTTATGAGCGGTAAGTAAGCAGTGTGGGTGACAGTGATGGTGAGAGCA
GATCGCATAGACAGCATCTGACATGTCGACCGTCCAGACTGCCCCAGTTTGCCACAGCCAAGACATCCCAGCAGCTGCAA
CGTCTGCAGGAGATCCACAACACGTTTGCACGATTTGCTTTTCCGCAGGAGAAGCATGACTACTGCTTCTCAGACACCTA
TCTTTACTGGCGGCCCATCCAGAATGGCAGCCGAGACTGATGGCCACCAGTTGGCTGTTCTTCATCGTTGGCCGTGCCTT
AGCCTTGCCTTGGCCTCTGCTGCAAATCAAGCCAAAGGTCTCTTGTTGCTGTTGCTGTCGCCATCATATCTCATATCCCG
TCGTCGAAGCCATGAAAGCACTTGATCGCAGCATATACTGCCTCTGTCGTGCTTCTTCAAGAAGGAAGACGAGGTCGTTG
AATGTAAAGGCCCAGAGAACAGTGCTGGCAGCCGTCCAGACAATGACGCCTTCAAGAAGCATGTCGGCAGGCTGCACCGA
CAACTTTGTTCCCAGCATTGTCAGGGCGGCGCCAAACGTCTGCGGCACAAAGTTGACGTGCGTCTCCGGTCTCCTTTCAC
CCTGCTTCTGCTTCTCACTCCTGCTGACTGCTCAGCTGCACAAACGTCGACAAGCTCACCCGCATCACTGCCTAGGTCCG
CCGGCCAGACTTCCAAAAGGTACACCCGCGCAGCTTCGGCCAGCAGCCCTTGGAGGTTATTGGCGGCCTCACCGACTGAC
ACCTTCGCATGGTCGCTGGTGTCGCTCGCCTGTTGTGGTTATTGTGCTTATCATGCCTGTTCCCAACTGACATGTCAGAT
TCCTGGCATGAATAGGCTGCTCCACTGGCGTGCCTATGAGCGACGGACAGGCCTCGGCAGTCTTCGCCCACCCATTTTCA
AGGCAGCTGCTAGAACTGGAACAGACTCTGACTTCGGCTCCGTGACCGATGATCGGCACTAGTACCAGCAGTTAGCAAAT
TAGAGCACCATCTACCGTCCGCTGTTCCCACTCACTCACTGATAAGACTGATGAAGTGCCCCATCTCCCGTCCCGTCAAG
CTTTCCGCGACTTCTTCCACTTGACGGCTGTCCGTCTAGCTGCCGCCTTCATGGAGTCGTTGACTCTAGACCGTGCCGTT
GTGCCCCTTGCTGTCGCCCCAACTGGCCGCTTCTATAAATCCCGCAAGTCGCGGCCCTGTGATGCTTGCCGCCGGCGTAA
AATCGCCTGTGACATGCCTGCCGGGCCGCCCTGCCATCGTTGTCTGTGCAAGACGCAGTCGTGCACCTTTGAACACGGCC
CCGGCCAGCGAAAACGGCCAACTCACGTCCGGCCAGCAGCTACGACAGTTCAGTCTCCGTTCCCATCTGCCAATCACAGG
TCAGCTGTTACCATTGCCCCTTCTTTCATGTCCTCCTTGCCATCAGACCGGAAACTGACACCAGCCATGTGCAGCGATAT
CTGGTTGGACGATCCGACCTTCTTTTCTGGGCAGCTCGGAGGAGCCCTGGACTTGCCCGGCTCTTATGCAGACCCACCTG
TCGGCCATCACAACGTCCTCGGGCCTGCACATGCTGCTCCCGGCCTAGACACGGCTTCCCAGCCGTCTGAGGAGCCCTCT
GCCTCCGAAGGATCGCTCGAGTTTCTGCCCGGCGCCTTCAGCTTCTATGTCGGTCCTACAGGTGTTGCCGACGTGCACCT
TCTCAACCGCGGTCCGTTTGGCCCGGGCGGTCTCGCACGTCCCGGCGTCAAGGGCCTTCAATACCGGCGCATGCAGCATC
AACGTCAGCAGCATCGGCACACCCAGCGCTGTTCGTCGTCGTCGTCGTCGTCGCTGCCATCTCACAACACTGCAGCTCCA
GCCAATCTTCGGACTGACGGACCACGCGCTGTTGGACAGAGCCGAGCCCAAGCCGGAAGCCGAGGCCACAGAGAGCGCAT
GGATGGCGCTGTGGAATATCCTGGACCCGCCCTCGGCCTGGAGCCTCATCCAGTTATACACACGCTTTGTCGACCCGTAC
TTCCCCATCTTATCGCGCCACCGGATGCCGCCAGGCCCGGATACGCTCAGTAACATGCCCCTGGCGCTGCTGACGGCCGT
GTGTGCCACCGCGCTGCCGCTTGTCGTGTATGACCGCTCGTTGCTTGCACTGCTGCTGCGGCCACCGTCCAGCGAGCAGC
TGTATCGGCTGTGCTGGATGAGAATCGAGCAGGAGCTTCACGCACCGTCACTCGGCACGCTGCAAGCCTGCCTGCTACTG
CAGCAACGCCTTCCCACCAACCTGTACCTGAACGACACGGCCTTTACGTGGTCACTGATGGCTACGGCCGTGTCGGTTAA
AAAGGGCCGCACAGCGCGTGAACAGCTGTATGCCTGGCGGGACCACCTGCCGGCTTCGCTGTGGTTTCGCCCGCGGCAGC
AGGCCTGGCCACAGGCGCAAGTGACAATTCGCAGCACGCCTGCTGACGGAGCCATAAACAGCTTCGAAGGACGCTCTGCG
TCTGGCGACGGCCGAGACCTGGACGGCTTAGAGGGTAGAAACCACAATAGCCGTGGACAGTCTGGCGGCTTTTCTCGGGT
CGACAACAGCCAGCGGCTGGATGGAAACGCCTCGCTGTACCTGTCGTACATTGTGACGTACATGACACTATTCCGCGCCA
TGCTGCAGCCGCTAAATAGAGTTGAAGATGCAGATGCAGAGAGTCGTTCCAAAAACCAGTCTCAGGACCACCAAGAGCCC
AGCACGCAGACTGTAATGCACGGGGCCCTGCAGTGCGTGCGTGAGTTTGTCGAGTTTGTCGAAACCCTGACGCCGACGCA
GTGGAACGCCTTCTGGCACGGCTGGAGCCGAGCTAACTTTTCCATGGCCGGATCATTCACAACTCTGCCCGGCCCAGACG
TTGCTGGAACAGTAGATTCGACAGGTTCTGCAGAGGCTATGGAAAACGCCGGTCGGCAAAGAACGAGCGCAAGGACCAAA
GGCAGTATTGGTTCCGCTGCCAAGATGGATGTCACAACGACAGCACGCCCCGGCTTCGAGGCTGAATACTCCCAGCTGCT
GGGCTGGGTCAAACGTTGGCGATGGGCATCCCGTGTGTCGGCCAACGGAGCAGGTGCAAAAGGACTGCCCAATCTGGGAC
TGCTGCGCGTAGAGCCATTTCTCGGCCAGTTTGGAGAGCTCGAGGAGATAATATGATGCTTTCTTTCTGGGCATCCGATC
ACACGGAAGGCAGGTGCGCGTAACTACACGCGTTGATAGCAGGAATGGGAAAGAGCTTCCGTCACATGATATTTCGTATG
GATACACCGAGCATATAATCATCAACCCTGTAGTCCTTGGCCTGCTACCTCGTCGAATTGATATCTTTCAATACAACCTG
CTTGCCCAACTTGCACAGCCATCCCGTGCCGCATTGTCACACATCGGAGAAGGCAATCGCGGACGAATATGGACGAATCT
CGAGCCTGAAATCACGCTTGCGGCCAACTGGGCGATACTTGGGGATGTCCGTAGTGTTGGTTTGGATAGGATCGATTTAG
CCAAGTACGTGTCGGTATCCCTTACAAGCTGCTCTTACGGTGACGTCCAATAAACTCACAGCTCCCAATCGGTACTTCAG
CGACAGATCTCACTCTCCGCTCACATTCATCCCAGCGACCTTCAACCCACAGCTGTTATCTAATCTTTCACACCTCCGAC
TCACAGCTTGATCGTCACCATTTGTGTCATCTCAACCATGCCCGCACCATTCGTCGCAGTTGCAGGCGCCTCTGGCGGAC
TGGGCAAGCTTGTCACAGGTGCGTTGATACGACGAGGCGTGGCCGTCAAGGCCCTCGTGCGTCCTGGCACCGCCTCTTCG
CGAACAGATGGCCTTCGCCAGGCCGGAGCGGCTGTTGTTCCTGTCAGCCTCACAGATGTGCCGAGTCTCACGCGGGAACT
CGCAGGAGCAATATGCGTGGTGTCGACGCTCCAGGGGCTGAAAGAAGTCATTCACACCGTGCAGGGAAAGCTCCTCGACG
CCTCGGTGGCCGCTGAGGTGCCGCGCTTCATCCCGTCGGATTTCTCACTGGACTTTACGAAGACGAGGCCGGGATCGAAC
CGGAACCTGGATTTGCGCCGCGAGTTCCACCAGACGCTGAACCAGTCGGGCATCAGCTGGACCAGCATTCTGAACGGCGG
GTTCATGGACCTGATGGCGGGCGACTCTCCCATGATCGACCACAAGAAGCATAGGGTGCCGTACGTCGGCAGGCCGACGC
AATTGCTTGATTTCACCACGATGGTGGACACAGCCGCCTACACTGCCGCTGTGGCCGCGGATGCGAACCCTGCTCCGAGC
TTTCTCCGCATTGCCGGCGTCTCTGTCAGCGCACAGGACATTGCTGATGCGCAGACAGCGGTGCAGGGCGTGAAGTACAA
GCCCTTTTGGATGGGTACGGTGGGGACCACGGCGTTTATGATCCGGGCCATGCGTCTGTTCGCCGTCGGGGGTGGCGGGA
AGGATGTCTTTCCCGCATGGCAAGGCATGCAATACATGGTGAACATGATGTCCGGGGCTGGAAAACTCGAGCCGCTAGAC
AACGGCAGATACGCGGACCTGACATGGACCAGGTTGGAGGATTTTTTTGCTGCGGAGCGAAACAAGTGATAAGCGAGAAG
TGGTCTTGTATTGCAGTACTTCTTATTGCACGGCAACTCAGCACAAGTTCAGCATGACGCGTTCCTCGTCGCGGCCGCAC
TCGCCGTCGTCCTCCTCGATTTTGCTCGGGATGGGCACGTTGGCCAACGGGGTCAGCCGGAAGGCATGGCGACGTTCGCC
GGACTCGTAGTCCAGTGGTCCCAGACGACAATCGTGCCGGGCTCGTAGCGTACGCGGCAGGCAAAGTCCTGATCGCGGTT
GATATGGTCGAAGAGAAAGCGTAGCAGCATGTCGGACTCCTCTTCGTCCCATCCTGTGATGCGTTGGGTGTAGGACGAGT
TGACGAAAAGGGCCTTGCGGCCGGTGACGGGATGGACCGTAACGACGGGGTGGACGGCCTTGGTGATGGGGCGACGCAGG
ACGGCCAGGTCACCGTTGTCGCGGATCTCGCGCAAGATCGGGTTGGCCGTCGTGTGCAAAGCCGTGAGGCCCTCGAGGCG
CTTGCGGAAGGACGGGGAGAGTTGGTCGTAGGCACGGTTCATCTGGGCTGTTAGCATCGGTGCAATAGCAGGACAGGGCC
ATGGGCATGAAAAGAATACACTGGAGATGATAGTGTCACCACCGGCTCCAGGAGGCGATTCGAGCATGCAGAAAAAGGTC
AGACCAGGCGGCTGGGCCTCGGGTGACTTGCTGAGTCAGCAAACTGAGGCGGGCAGAGCAAACAGGTGCAGGTCGGACTC
ACCTGGTCGACGTGGAACTGGATTGGGCTCTTGCGGGCCCAAGACTTGCGCACACGAAGATCTCTGGTCGTATTGTCAGC
GCATATTTCGAGAGGCTGAACGGGCAGGGAGATGCGCCCTCACTCGCGCGAGTCGTAGACGATGACGAACTCGACGGGGC
CGTTTTTGGGATGCGGCATCCAGCCGTGCTTGTGGAGGGGGCCTGTGGACGTCAGGATCGAGAAGACGGCGAGACGTCGT
GCGAGTCAACCAAAATAACACACCAAAGTATCTACTAATTAGCCGGACAGCACGCCGAGACAGGGCCGACACCTACGAGG
CAATTTTCTTCTGGGCCTCAAAGCCGATATTGACAAAGTCCTGATTGCGGAAGACGAGACAGCCTCTCTCGGCACAGAGA
TATGCCATCTCGTCGAGGCCGGCATCAGTCAACTCGGACTGAAGGTCAGTAATGGCCTCAGTCTAGCCACGTCTATCATG
CTCACGATCTGCACGCCCTGGATTTCGGTCCTGGAGAGGGAGTGCCCGAGAAGCAATCCACTCACGAAGGTAGTCGGGAT
ACAAAGGAGCATTTGTCCTGGGCGATTCGGGGGCTTTTGCGATCATTTTGGAAGCTGCTGGCAACGGAGGACTGCTTCCC
GGTCCCGTCACATACTGCCCAGCTTCATCATCGGCCCTCTCTGTTCCGATCTCCGACCCTCAACCGAACACTCGCCATGG
GCTCTCCAGAGGTCATTGAGATCGCCAGAACACCCGATGGCACGCCCTTCGAGAAGGCCGTTAAGGCCGTCAAGACTGGC
CACGCAGACGAGGTCGACTTTGCCGCCCAGATTATCGCAGACTACGCCGACCAGATCGGCGACAGCAGTTGGACGTCTGA
GGAGGAGAAGGCGCTGATGCGCAAGGTCGATCTTCGCATCATCCCCATTGTGCGTCCATGTCCTTCACCATCGGCCGCCC
TACCTCACTCACACATCTAGCTCTTCGCCTGTGCCACGCTCTCTGGTCTCGACAAAACGGCCATCTCGGCTGCCGCCATC
TACAACATTAAGCGCGACCTCCATCTCGCCGGCGACCAGTACGCCTGGATTGGCTCGGCCCCCTTCTTCGGTGGCCTCCT
CTTCATGGGCCCATCGGCCTACTGCCTGCAGCGGATGCCGGCCGTGATGTTTTTCTGTGCGATCCCCTCGCCCTTCAGAT
CCATCGTGTTGCTTTCCTCGTCCTCCTCTGACATCTACAGCGTTCAACGTCTTCTTCTGGGGCGTCACCGAGATGTGCAT
GGCTGCTTGCACCAGTTTCAGTAGCCCCTTTGTCTGCCGCTTCCTCCTCGGCGGCTTCGAGGCCCTCCTCATCCCAGCCG
TCACCCTGATTGTCGGCATGTGGTACAATACCACCGAGGCTCCTCGCCGCAACAGCACCATACTCAACGTCATCGCCCCC
ATCATCAACGGTTTTCTCGACTGGGTGGTGGGCTATCATCATGGCTCCTTTCCTACCTGGAAGATCATCTTCTTGCTGGT
CAGTGCCTTTACGGCCATTTGGGCTGCCGTCGTCTTCTTCCTGCTGCCGAACAATCCGCTCGACGCCTGCGGCTTCACTC
TCCGCGAGAAGTACATCGTCATCAGGCGCAAGGCTGCCGATAACACCGGCATCGAGACCAAGAAGATCAAGAAGGAGCAG
ATCTGGGAGGCCATCATGGACCCCAAGACCTGGCTGATATGGATTGCCGTCGTCGCTCTGCAAGTCCCAAACGGCGGCCT
GACCACCTTCAACACTCTCATCATAGAAGGACTTGGCTTCGATTCTCTGCAGACCTCGCTGCTGGCCATGCCACCCGGTG
CCATGAGCACCCTGTCTGGCCTCGCCCTGTCCTTCATGGCCGCCTCCACCCGCCGGCGCAGTGCCGAGGTGCAGGACAAC
ACGGCCGCCGACCAAGACTGGCTGGATCTGACGGATCTGCAGAACAAGTCGTTCAAGTATACCACGTAGACGGGCAACAA
CGACACTGATTCAAGTAGGTACACCGAAAAATAGATCATGTTTAACTGTAGTAGCAGCGCATCCAAGTGTGACAGAAGCT
GTCAGTGAATCACGGTCACAGCGCAGCGTTCCTCTTGACAAACTCGGCCCACGTAACGGGTTTCGCATACAGCAGCGTCA
GGCTAGGCTTGAGCCGAGGTAGTAGCCCGGAACCTCGATGGGAATATGGATGTCTTTAAACTCCCGACCCTTGGTGTCGT
TAGTGAAGTAGCACAGCGATGAGAATATGATGTGAGACACGCCAACGTTCTTGGTCACATCGCGCATATTTTTGCCCTGT
GAGTATTCCGTTTCATCATTGAGAGTCTCCCGGAAGTTAACGAGGGAAACGGCTTAGGTTCCGGCTGAGTTCGTGGCCAG
AGGCTCGACTAAATTCAGGACGGCCCATCACTTACTTGTCTAGTGGTGTCTTAATGCCATCCAGGACAAGAAACATACGT
GCACAGCTCGAACACCCTTCTTAGGAAGTTCTACAACGGGGTTTTTCTCTTACTGTCGCAGGTTATGCCGCGAATCTTAT
AAATCCTTGGAAATCACGGCACCCTTAAGGATGCTCTTGACGACAGAGCCGCCCCGGATTCCGGTCTTCAAAGATGGCAG
TTTTAAGAATTATAGGGTAAGTTTACAATATAGTAGGTGTATAACTTGGCACAAGTCAAAACCATTCTAAGTTCGCTGAA
AGGCCGTCCAAATAAGCTGTAGTTTAGATTTGCTATAGTATTCCTGGTTTTGATATATACTGCTTGGAAGATTTAAAGTG
GCGACAAGAAGCGCCTTATATGATTACAACAGAGGAGAGTATCTAAATTCATTTTTTTTCTTTATATTGATATACTGCCC
CCTTTTCTCCTCTCCGTTTTATGTTTATATTTATCTTACGTTTCAACTAAGTTTCTTTACCTAACTATAACTTCTCTATT
TTGCTAAAGTAACTAGAAACCAGGCATACGTCATACTATTGCAAGACTAATAGCAGAAACATTTAATAAATGAAACGCTG
AATATGAGTAATATTACATTAAGCACTGCTATCTTTTTTTATTTAACTTCGGCGTAGGCAAACTATACAATACGGCGCCT
GCATGCTGCGGACTTGTAAGCTTTATACAGCTGCTTTTGTTGCCCTTTATCTGTTCTCTGTGTGCCGAATAAACCGTCTT
CGGCCCAGCTTCCGGCCAAGTAAAAATCATTTGTTCCAACGAGGCACAGCTAGCTTAGAAGCTCTTGCTAAAGAGTCAGG
TCATTCTCTCATTCTTCTCCGTGCCTGCCGCGCTCAAGCAATGCTGCCGCCGGTCCACTCCGTATCAATAAGTGCGATTT
GGGGCGATGGAACGGCTTCTTGAGGTGGTGTTTGAGGGGAGGGGGGGTTTCGCTGCTTTAATAGATTATAAATCATACTC
TGTTACGTGCTGATGGAAAGAGACAGAAGACAGACATACCATTTCTTTCCCTTCTTCGTCGACTAGTTCTTGCCCAAGAC
TTTTTGATCGGCAGTTTTGCATACGTTGTGGTGGTTGAGACGGGAGTGGCCGAGAAAATGATGAGTGACGATGTGATTAT
GAATATAGCAGGTAAGAGTGTTGTTACGTTTTGTCACACAGTCCATTTGACGATCGCTGTATTGTAAGATGTATGTGTAG
ATTCCCCATTTCAGTATTCACCATTAGATCTATCATTCCAATGCTACATCTAAATAGTTCCGCGAGAGTCGCTCAAGGCC
ATGCTGCGAAATAAGCAAAAGGTCATTGAAGATTTAGCCGAGTATCACGTAGAGACTGGCTATTAACACCCCCAGTCCGG
CCAGGCCTACCCCTGTGTAGCTTGCGGCCCGGTAACCCTTCAGCACGTCTTCTCCGTGATTTCCCACGTAAGCTTCCACG
GTCCCGGCAATGCCCAGGCCGATGGAGACGGAATAGTTCACCACTGTATTGACCACGGATGCTGCTATTCCTTGGTGCTC
TCGTGGCATAGAGTTGCTGAGGATCAACGTGCCTGACGGGAAGGACATATCCCTGATTGCATTAGAAAGACATAGATACG
ATGCTTTGAACGGCTGAGTGTACTCACATTCCCCACGGCGTGATGATACTGATGACAAATGCCTGTGCCCAGTAGTTCTG
GCCGATCGGCAGGGTGGCTAGCAGTATTTGGCCCACAACAAAGGCGGTCATGGCACCCAGCATGATCAATGATGGACGGA
TGCGGGCCATAAGGAAGCCGGTGGCCAGAGATGCTAATGCACCAGACACAGTAGAGCCAGACCATTTGGCCGACACGAGC
AGCGGAGAGTTGTGTTTAATGACCTCCATGATCTGGAAATAGTAGAACACCACGACGCCAAAGCTCGACCAGCCCGCCCC
GATGCAGCCCAGCACCCAGCCAAGCTCCCTGGTGAAGAGTGCAGGCGGCAGCAGTGGCCGCGCGGCACGGCGCTCGATAA
AGCCAAACAGGCCCAGGGGCAGGAAGCCGACGATGAGCAGCACGTAGATGTAGGGCACGTCCCAGCCGACGACGGGGCCC
TGGTTCCAGGAGAAGTTGATCAAGATCAAGCCGGTAATGATGGCAGCCGAGCCGGCAAGGTCGAGCCGGCTGGCCCAGTG
CAGTGAGCGGTCGATCTTAGGAGCCGGGCTCTTGGGGATGACGACGGTCCCCAGCACGGCCAGGCCGAAACAGACGATGC
CCATGATCCAGTAAGCCCAAGGCCACCACAGGCGCTCGGCCAGCAGCGACGACATGGCGGCACCCACGGAGTAGCCAGTC
GGCGCGGCGGCCCCGAACAAACTAAATACCATGCTCTTTCGCGGGCCCGGTGCATACATGCGGCCGAGGAGGGCGACAGC
ATTGGGCATCAGCATGGCCGGACCGATACCCTGGAAGGCACGACAGCAGTCGAAGAAGATCTGGTTCGACCAGACGGAGA
AGCCGGCCAGCAGCGACCAGAGCCCGAACCAGGCAAAACCCACGATGAAGAGCCGCCGGTGGCCAAAGTCGTCGCCCAGC
CGCCCAGCAATCAGGATGAAGGTGCCGACAGTGAGGCTGTATGCAGAGGCGTACCAGCTCAGCTCGCCGGCCGTAGACAC
GTTGAAGCTTGCGCCGATGATGTGTAGAGGTTCAATGGCCATTGCGAGTGCGGCCTGCGTCATGAGCTGGGCCATGCAGA
TCGTGACGATCAGCAGGATCTCTCGGCCCAGCGGCTTTGGGTACGAGGACCCGGGAGGAGCTTCGGTCGAGTCGCTGGAG
CCGCCAGAGTCGTCGGCCGGGGCCTTGTCCATTGTCGGCATCTTTGCAGGCTACTCTCGTCGATGGGGGCCGTTGGACAA
TCACGGAAGCTAAATCGACGCGCCGGCACGCCGCTTTAATCACGGACTTCATATCCGTATTTCCGACTTTCTAACCCGCC
CCGACCCGATCTTTACGAGCTCAGTCAGCAGCCAACCCCCGTCGACAGTTGCCTTTTTCCACATAGATTCGTGTTCGGGA
TGACATCCGCTCAACAAACCGAAGCTCCTCTGGACTCTAGCTTGCCCGCCACAGGGACGCCGTTAAGCTACCCGTACCCA
AGGCGTGGCCCGACCTCGCCGTCTTGGAAAAGGCGTTTAGACATTAAGTTTGTCCGGCGGCTGGCATCCAGCGAAACGGA
TGCAGACAACTCGAGATCGACAAGAATGTGGAAAAGATAACAACATTTAGATAAAACCAAACAGAGAGCCATTGATAGGC
GCAAAATCTCGCATCATCTCAATGCTAGTTTCTCCACTGTCACAGAAGCTCGTCTCGATGCTTGCCAGTATCTTGTCGAT
CTATCTTTACGTCTCTAACACTGTGCGACCACTATCGTAAGGCTAAAGGAGGCTGTTACTAATCAACGTATCAAAAGTTA
TTCCATATCATTCGTATACAGTCGCACCATTGTTGCCAAAGGGTAAAAAACGTCAGACTTAAAAGTCCAAGATCGTTGCG
TAGCGGCCAACGACGCTTACGTCTCCACCGTTCAAATTGCATTGCGGATGCTTAGCGGTGTCGAAAAGGCTAGACCAAAA
GTGCGTGTGAATTTGTCGGGTCACGTGTGTGATCCGAGGAGGCCTGTTTCTAATCCCTTGCTAGTTGCAGAGGTCCCTCC
CAAAAGAAAGGGCTCACCGCTTTTGAGGTGGGTATAGTACGCTTGAATTATTAACACTGTAATATTTACTACCGGGAATT
GATAGAGCGGCGGACCCACGTGCCTTTTTTGGCGGTTACAGGCGGCAGAATACTGAAATCTACGTAATAGGCAAGCTGAA
TTTCCCGCAAAGCACTACTGTAAGGGTTGGTGTGCAATGTGTGGTCACGAAGGCTTTAAACGTGTTGGTACTGTTGTATT
AAGACTTCAACTTAACGAACTATAGGAGACGGGTAGGCGAAGGCCTGCCAGCTAATTTATACGTGGCTGGAAGATGCAGT
GTAGCGCAACCCCAGTGGGGCGTGGCACAGCTAAGTGGCTGTGCTTGTCCCGTGCAACGTGTCAAGATAGTTCGTTAAGT
CCGTCGCTTAGTAAGCGACTGGTTGCCGAACCAGTGCGTAGGGACGCGTGTGTGGAATACCCTTACACTATCCTACCACA
CCTTACGTTTTAGGCTCTACAGTGCTTTTATTCAAAACTGGGGTACAATTGGTAGAACTCTTTGTCCTCATGAAGAGTTA
ATGAAAAGAAATGCTGGGTCTCTGTTGATTGGCGGTCTTCGAACTGTAGCTTACTGACTGGTAAGTGCAGTGTGTCCCTG
AAACGTCCGATCTCACACATCTTAGCATGTACCTAGCATGCTATTCACTTGGGATACGGAATACTGTAACGAGTCTATAT
GCTCTCTATACCGCACCTTCAGTGAGTGCCTTAAGGAACACGAGAAGAGAAGAATCGTATAGCCTCAGAATATAGTTGCT
AGGGCTTCAGACACGACCACCACCTGCACAGGCCTTCCTCGACACTCACACTAAAAGAGTAGGCTAGGATAACGACTTCC
GACCCGTGTTGAGGACCCGGCTAAGGATCCTTCTAAGCTAATGCTTCCCTAAATCTTACTCTTAGGGCCTGCCTTACTTG
TCGAAGAGAGCTACCTCCAGGACGGCGCGGTATATCATATTACAACATTCTCATTTAGGAGTCGAAGTCTTTGCTAGCCC
GTTTTTCGCTAGGACAGCCCTCCTGTTAACGTGGCCTCTTTGCTTACACCAAGGATTAAATGGCCGTTTGCATCCCACGT
ATAAGAACCTTTTCTCTACCCTTTTATAGAAAACTTACTGTGTTTTTTTTACCATTTTTTTTTTTTAATCCTACTTGGCG
GTAATATAGAGGGTAACAATTCTTTTATTTTTAACATCCGTTTGTTAATCAATTACTTTCAGAAAAAATTCAAAGCTAAA
CCGTTCCAAATTATATGATGATCTTTATGTTGTTAGGTTTCCACACGAATAAACAATTAAGGGGGGTTAGCGTTCTTTTT
CAAAAAATCTAGGGAACCGGCTGTAAAAGGCTCTTATCTATACTGTTCTAACCCCAAGGGTATGGGCGGGTGCCTTTTTT
TCCCAATAGCCCCTTTTAGAGACTTATTCTCGAATTTACCGAGTTACAACAAGTATATATAAAGAGTTGGTGCGTTTGAG
GGAGAAAGCCCTTATACACCAATTAACGCCTATAACCTGCTTTAATATAACTGCCCTCCATAATAAAAAAAAACTCTATT
ATTCCATTGCCTATTTCAATGATGAATTCGTTTATCATTATGAACTATATTTTTTTTTTCTTAAAATTGTTTTTTAATTT
TTCTTTTTATGTCTGGTTTATTAAACGTGATTTTTATTCACGAGAAAGTTACTTCATAAAAATAATATTATATTTTATAT
TTTTGACACCTCAC

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62