Scaffold:GCSC_146 Details

Name: GCSC_146
Class: Scaffold
Type: scaffold
Source: scaffold
Position: GCSC_146:1..560530 (+ strand)
Length: 560530
Note: GCSC_146
>GCSC_146 class=Scaffold position=GCSC_146:1..560530 (+ strand)
TTTGCTATTATAATACGCACGCTAACATAACGTGTTTTACGTCTCTTACCTTAAGCTATAGACTACTATAGTAAAAGATA
AGGAAGAGCTTTTATTCTTAAAAATAGTAAAAGACTAAAAGGAGTATAAGGTTAAAGATATTATTATTTACCTTAGCAAA
GGGTTGTAGACCTAGTTCTTAGTAAAATAAAAAGGCTAGCTAGCTAAGTATAATACCTAGGAACTAAAAAGGCACCTAGC
GTACGCTAGCTATAAGTTATAGTCTTACTAAAAGACTATAAAGCGTACTTATAAGAAATAAAAAGACTATAAAGTAATAG
CTAGCTATATATAAGCTAATTATTAGTCGACTACTTTTACTATTTTTATATAATTGTATACTATAAACTACTTATTCTAG
CTTTAAGGGCGCCCTTTAGAGCTATAAACCTAAAACATACCGTTAGCAAGCTATTACTTAGCTAATAGCTACTTATTACT
ATCTTTCTTTATAAACATCCTCTCTACCCCCTTATCTCTCTCCTTAATACTATCCTTCTTATCCCTCTCTTTACTACTAA
GCAAGCCTTTGCTAGCTAGTATATAGCTACTACTAGCCGCTAACTAGCTACCCGCTAGCACACTTTTATTAAATGCTACT
TTACTACTACTACTAGCTACTATAACTACCTTACTACCGCTAGCTATAGCACTAAGAATAGTCTTAGCGCTTAGCTAAGA
TTAGCAACTTAGCGTAAGACCGTCGCTTGCTAGGCGCCGCTAAAGGTAGCGGCTAAAGAAAGACTACTACCTAGTTAATC
TAAGCTAGCTTAATTAAGGCTACTATAGTTTGTAGAATTCGCTTAGGCGGCCCTTTTACTCTTATAGTATAGTAAAGCGT
GCCGCTACAGCTAGCTTAGACAGCCGCAGCGCGCTAGGCTAGGCTAAGTATAATAGAACAAGGATTAGCCTAGGTAATAA
GTTAGCAATAACTTAACAATAAGGATTAAAGGACTTGCTATTGCTTTAAGGGTAGTAGCAACTTAGGTCTACGCCTATAA
TAGTATGCCTACGTCTAAGAATGTTAGCAGCAAAAGCTAGGCTACCTTTGCTAACTACTACGCAAGCGTTAAGGCAAGCT
CTAGCTCTTGCTAGTACTAGTAAAGGATACTAAGGCATAATGCAGCCTATTATGCTATCTTAAAACGTTTGCGCTAAAAG
CGCTAGTTAGTTGCTAAAAGCTTTAACTTGTCTTCTTATAAGGCGCGGCTAAGTTCCTTAGTTACTACTATTAAGGCTAT
TAACCTTTAGGCGATTACTATATAATCGCTTAGCACTATAACAATATTATTAACTATTATCCGCTAAAGTAGCAACTTAT
TTATACTAGCTAAAACTTCTTAAATATATTAAGCTAAGCCCTTAATCTTTTTAAGAAGCTATTAATTAGCAATTAGCTAC
TAGCGTATATAAGTTAACGTACTTACTAGTAAGCATAACGTATTATTAGCTATATAACTAACGTAGCACGCTAGGTTCTT
TAGCATAGCTATATATAAAAATTTATAGTAAATGTCTAGATAAGCCTTAAGAATATAGTTTAAACATAAAGCCTACTATA
GAGTTAGCTATTACTTAGTAAACGCTATACTAGCAAAGACCTACGCTTTTAAGAGATAGTATATATACCTAGAAAGAGCG
TTTTATAAGGTTTGCATTTATAAAAAAGTCTATTAAGACTTAAAAGCAGTTTTAGTTAAATATTGTCTATAGGCAATTGT
TAGCTAGCCGCTATACAAAGTTACAAACTATTACATTAACCTACTATGCAAGTAGAATTAAAGAAAAAAGGGCTAAAGAG
GCAAGAGTAGTTTTATAAGTGCAGACAAATTCGTCTTAAATTATAGAATACACCTGCTTTTTTATACCTTAAGGTAATAA
AGAAGCCGCGTTATTAAACGTCTAAATGCATCTTAAAAACTTACTTAACCTTACTTTAATAGTAAGGTAAGAAACGTTTA
AAATTAAATAAAAGAACGTCTTAGTAGTAGACCGCCTTTACTATCTAGTAGGCAATAGTTCTATAATCGGCGGGTAATAA
ACAGCCGCTATTGCCTTTATCTTGCCCTGCTAGTAGTTAGAAGTTGCAAGCCTTGCGCCGCCGTTTTCGGTTAGCGTATA
CTGCACTCCTATACACCTAGTGTCTAAGGCTAGCCCCCTTACAACACCTATCGGCGGCAACCTAAGCGTTCCCTAACTAG
GATCCAAGCTGCACGCCTCCTAGAGAGCTCTAACGAACAGGACAACCCGTGCATTAGGCAGGATCCGGCGTTTACTGCCG
CCATAGACCAAGCAGTACGTGTACGCTTCCACGTTACCCGAATGCAGTCGCACAAGCAAGCGGTCCGCGACCGCTCGGCG
ACAGCTAATAACCCGGAGCGCTTAACTCTTTTTCCTAACTCTACAAGGGGAGGTTTTTTAACGAACAAGTAGCTGCCGCG
TGTGCACCTTTAGGCTAACGGGGGCGTTACCTAAGGAGGGGGGGGATAGTGTAAGGGTATTCTACACACGCGTCCCTACG
CACCGGTTCGGCAACCAGTCGCTTACTAAGCGACGGACTTAACAAACTATCTTAACACGTTGCACAGGACTAGCACAGCC
ACTTAGCTGTGCCACGCCCCACTAGGTTTGCGCTACACTGCATCTTCTAGCCACGTATATATTAGCTGGCAGGCCTTCGC
CTACTAGTCTCCTATAGTTCATTAAGTTGAAGTCTTAATACAATAGTACAAACCGGTTAAGCCTTTGTGACCACGCATTG
CATACCACCCCCTTTACAACTTTATAAGTATACTATATATCTTTATAACTAATTAATTCTTTAAATGCGTATTTACTTAT
CTCTTTTATTTAAAAAGAGAGAAGAAAAAAGGGTTTTTATATATATAAAGTGTATAAGTAGTAATAGAAGGCATAAATTG
TTCTATATCTAATTAGTTAGGAAAAGTAAGGTAGGTTATATAACAATATAGCATCCCGCAAGAGTCTTAATTTATTACTC
TATACGGCCAGAATAGGTGTTTTTAAGGTATATTTTTCTTTATTACTTACTATTAAAGCACTTTTATTTAAAATATAATG
TAACTTATCTTTTTAAAGGCGTAAATAGTATTAATAAGTAAAACTTCTTAAATTAGTTACTACTATACGCTAATTAGCAT
ATAAAAGAAGCATTATTCTAAGCGCATTTTAAAAAGCTAGTATTATACTATTAAATTGTTAAGTTATACTTTAAAAGTTT
AGTAAAAAACTATTAACCCTTCTTTAAATAAGTCGCTCTACTTTACTATCTTTACTATTTAAGACACCTACAATTTTACG
CTAAATATATAAAATAAGCAACAAAGTAAAAATTAACCTTTAAAATAATAGTAGTACTAAAAATATACTTAACAACGTTG
CCCTTTTAAAGCAGGCAGCTATAAAGCAACAAACTTTATTAAGTCGGCTTAAACTTAACTTATAACAATACTGCGCCCGC
AAGGTAGTGCGGTTAAGGCGTCACCTAGCAAAGAACCAACGCCTACAAAACAAAGGGGTGCTTACTATTAAAGACGTACG
CGAAATGCAGTTAAATTTAGCTATAGACGCAAAAGAAAAGGCAAAGAAGGCTCTTATAAGGGCACAAAACAAAACGATTA
AAGAAGAACAACAAAGGATCAAGGCAGCCCAAAATGTAGCACGCTGGGAAGCCCGGAACCAAGGCAACACAGATAGCTAG
TTGGTTTTATTATAACTTTAGTAGCGGTGGCGCATTGGCTGATTTCGTTGAAAGACCTGATTTTGTGGTAATACTGAGCT
TTTGGCTGGTAAGTGCATTTGGCTAGTCAGCACCTATTTTAATAATAGGTGCACTTTTTAAGTGGGTCATGAATTATAGT
GGGGCGTGGCACGATTAGGCACACGGTCGAATATAGTAGACACACAGGCACACGTGACTTAATTCGCGGTTAACTACGGC
AGAATACTGAAATCGTCCCCGTGTAAAAAGCAGCACATCTGTTACTAACCGGGAACCTGCTCTAAATAATCGATACAGCT
TGTCGTTTTACATCACACACTGCAGATATGATTCTGGCTTAGACAATGCGGTGAGAAGTAGTTGACTATAGAAATGACTC
CATCGACCAGCCATTTGAACGGAAGGCATGAGCAGCGCTTGCGGACTATGATAGTATTTTGCAAAGTATGCTTACGACAC
ATGCAACATATACGAAGTATAAGCTAAGTTATGGCAGAGTACTTACGCCTCGGATTACTTTGGACTTTTAATACTCTTAA
CTATATACATTGTGGTCAGTGTATTTTCTTCAAGCCTTGCTATCTTTACCTATGTCCAACCTAATGTCGTCCTAGGCTGA
ATTTTGGGTTGATCCTTTCCACCGCATGTTCTTTATTGACGACATCAACATATCTTTTCCCCATGCTGAGATAGAAAGAG
TACCGGCTTGTAAGTGACCCTTAATACACATTAAGGGGTTGCAATACCTAATGCACATCTACTGATGTGGTCTGAAATAG
TGATGAACTTTGTCTATGCTCTTTTCATTCCTCTCCTCACCATCGCTCTCTATAACACTCTCACTGGCGCCAGCCTACAC
AAGCATCATGTCGCAATACTCGGAATCGGCATAGCATTACTCCTTGCATCTGCCTTGACGGACATCGTGAAGAACATGGT
TGGCCGTCCACGGCCAGACCTGCTTGCCCGGTGCAAACCTGCCTTGGATACACCTCTGGGCACGTTAGTCTCCCATACCA
TCTGTACTGAGACAGACCGTCACAAGCTTCAAGATGGTTGGCGTTCCTTCCCCAGCGGACACTCTAGCTTCGCTTTTGCA
GGCCTTGGCTATCTCAGTTTATTTCTGAGCGGCCAATTAAAAGTGTTTGTTTTGAGAAATAGCGATAGCACCATGCCAAC
CACAACGGGGGAGAGGCTAGATGGGAACAAATGGACATTTCATGTGAGGGGCGACCTTGGACGAGCGTTGATATGTCTCA
TGCCTACACTTGGAGCTACGGTGATAGCTATTTCACGTTGCCAGGACTACAGGCACGATGTGTACGATGTCTGCGTTGGC
TCATTTATAGGCTGGAGCATCGCTTACTGGAGTTACCGAAGATACTGGCCACGACTAGACACCTATCATTGTGACAAGCC
ATGCACTGCGCCAGAGTGTTCTAGTGCAGAACTTGGTGGCTACAGGCATGTTCGGGACGAAGAAGAGGGTAATCGCAATT
TAGGGGCTTCCTCCAGATCCTGAGAATATAAAGCTATTCTCCGGTTGTCTGACCAACCACAATCTCTGCCACAGAGCTTT
AGGTTGTTTTAGGCTGTTGTTCATCACAAGAGTAGTGGATACTGATCAAAATAGTATCTCATGGTCAAGTTAGTCCGCGA
ATTGAAAGCATACAATGCTTGAGACAGCTCGATTTCTCCGGCAGCTATTAATACATCGGCAAAGGACTAGAACCCGGTGC
CACCATCCAGCTGGGACCAACGTCAAGCCCGTATTTTACTTCTCATCTGCACTTTCATCCTTGGCAAGATCATGTTCTTT
AAGCAGAGACGTGATATCATCTGCACTCCATAACCTGTGGTATATCTTGCCTTCCTTTGTCTGCCCTACTGTAGCAAATT
CGACTTTCGAAAAACATATTAGCAGATCGAAGGAAAGATCATGGTCGACCATGTGGGGGGTTAAGAACATACTCTTCTCG
CTGCTCAATTTTGTAGAGTCCATTGTTTTGCTCAAAACCTTAACAGCCATGCCGCAGGCTTCCTTCAATGTGCAGTCTTC
TTTGTAGTCCTGCTTTAGCAAACTCTGGGCGCTTGCATTATTCGCCCCGGCACTGGTAGCCTTCCATCCGCCATAGTTAC
CAGAGGGGTTGGAAAGGTATAGCTGGAACTGCCGTTGCGGATCCCATCCAGCATAGATGAAAGATACCCCGAAAGGACGC
AGGCCACCATGCTGGGTGTATCCCTGCTTCAAATCACACAGTCTTCGCACCAACTGCTCGCAGGGTATATCGGTATTATA
GGTAAGGAGGTATCGTTGCGCAGCCTGTCGGGCATAGTTGATCAATATGTTGGCATCTGCAGTCATGCCTGCGACGGCGC
AGATCATGTTACTGAAAAATCATTAGCCTAAGTCAGCTATACTCTGTATTGGGGGCTGTAACTTGCTCGTTCAGTATGTA
AAGTTTCTCCGCAGAAGTGTCCTGCTCTAATAGCTTTGACGTGACCTTGCGCTCCGCAGCAAGAACAATGCCGTCTTTAG
CTAGAATGCCAATAGCTGTTCCAGCATGCGAAATGGCCTCGAGCGCATACTCGACCTGATACAACCGGCCCTCTGGGGAG
AAAATTGTGGTCTGGAAAGATATCAGTTCATGTGTATTTGTTATATCTTTCGTGTGCAATCTAGAGTGTGATATTTTTAA
GTTCCATACGAAACAAAACATACGCGGGAATCGTATCGTCTCGACATGATGCAAGTTAGCAATCAGTTGGAAAACCGAGT
CCTTATATATGAGCCGGTGATTGTGGTTGTAGGAATCTGAGTTACTGCTCCTGAAAGGGAGTTTAGGGCTGGTAGTGCAT
GGAAACCAGAGCTATCAGCTTGAAGCTCCAGGCAAGCGGTAGGACGCGTATGAACGTCGAAATGTTCACCTGAATTATAA
GGCATAAACTGCTGTTACATAAGCGTTATCTCATTTGCCTCCACCCCCGAACTTTGCGTCGCACCGCCAACCTTTCGCAA
ACATTACCGGGTATATTCACACTATTTCCAAGCACGCTGCTGCCTTCTGCGTTGTCGGGTGTCAAACTTTTCTTGTTGCA
AGGGACTTCTTGGACATTTCTACGGACCAGACGGGAACTACAGTGAGCTTTACGAAGCGGTGGCTTCGAGAGTTGACTTC
ACCCTCGTTGTTGTCTAGACTGCCTTAAAATATATTGTAGCTCCATCAAGGGTTTCTTCCGCCAGGAGGAGTGCCAATCG
TTCGGTTGGTTCTTTGATTAGGACCAGGCGCCCTTTGAAAACAAGAGCAGTGGCGTTCGAGATGGCCGGTGAGTACGATA
GCTCCTAGTGCATGGCTCATGCCAAATCCAGCTATACATGTTGTCATCGCTATTAACACATGATCGTAGCAGATCCGGAG
CCACGTCGCTCTGTTCGAAGCACAAAAGGCCAACACAAAGCGCTAGAGCAACTCGGCCAACCAGTCGAAGCCAAGAGAAG
AGGGAGGAAGGCAGGAAAAAAGTCGGATGATAAGCAGGATGAATCTGAGGAAGAGGTTATTCGCTGCGTTTGTGGCGCCA
CTGAGCAGGACGGTGACCCTGGCGAGCCATGGATTGCGTGCGACAGGTGCGGCGCTTGGCAACACAATGTCTGCATGGGC
ATGAGCGTTTACAGCGAAGACCTTGCGAAGGATTATTTCTGCGAGCAGTGCAAACCCGACAACCACAAAGAGCTTTTGAA
TGGTATGGAACACAACGAAAGGCCTTGGGAGGAACGGCGTAAGCTTTACGAAGAAGAAAAGGCATCCGGGAAAAAGAAGA
GGGGTGGGCGAAAGGCGAAGCCCAAGCGAAACAGTGACATCCGGGAAGACTCTGCCAAAGCGTCCCCGCCGCCTGAGCTG
AAGAAAGACCAGAAACTAGCCGCAGGAATCAAGCGAAAGTCAAGATCAGGTTCCGAAGATCAGGAGGTGAAGGTAACTTA
AACTTACCCCAGAAATGCTAACACCCTGTTGACATCGTGGCTGAAATGTGGTATAGGAGACTCAAAAGCGAAAATTGGCC
GAGAAAAATAACTACCCAATTTATATTCCACCCGACGACCTACCGGAAAATATTACGGGCCTTCTCGATGCACGTCAGCC
TCCTGCTCGCGGTCTCTTCCGAGCCATGTATGAAGTTCTTGGTGGGCTTCATAAGAAAGGCGAAATTACTTTGGTGGACG
ATGAGACAGTTGAGTTGGTAGCAGAACGATTCGCCATCCAGATTGAAAGGGCTGTGCACGATGAACATCCCAGCCACAAA
GATTACGGCGCGCAAATACGAACGCTTCGCTTTAATCTGAAGGAAAATCCCGATTTAAGCACTCGACTGTTGGCGTCGAC
GCTGACACCCCCGATGCTAGCAGTCATGACAAGCGACGACCTAGCGTCCAGTGAGCTGCAACGGAAGACTGCAAAAATGA
AAGCCCAAGCTGAAAGACAGAGCATTCTGGGAACGGAAGACAACGCTCCTCGTCTCAGACGCACGCACAAGGGGGAGGAG
CTGGTTGAGAAGGACAATACTAGTCTGATCAGCGAGGACAAACCGCCCTCGTTGCGGCGACAGAGTAATCGAGAGGCTTT
GATTGCAAAACCTCAAGTCCACGAGCAACACAAGAACGCCGTTGAACCCCAGGTACATTCTGGACAAAGGCAAGCATCGA
TAAAGGGAAGTTTGCACATCGAAACACAGAACGATTCTGCTCGAGGAGGCTTCGATATAAAAAAGGTATTCTCGAGTGTT
CGGTCCCCGATTACGCCGCACGCACAGCGGTCGTCATACTCGCAACCACCTACTGGCAGCACCGGACCTGGGGCAGATCC
CGAGGTCGACCGGCTTTTACAGGACGATGGGGATGAGTCGCCACCATATTCTCCGTCGGATGATACAGACCCTGATATCG
TTTGGAAAGGGAGTGTTGCCATGAACATGGTAGCAAACTTTCAAGCAACCGCCCGGCATATCGGAGGAGTCAACCTCACC
ACAACTATCGGTCTACCATGGAGCACGCTTATTCCCAAAGCCCTCACCGTAGCTGGGCGCATTGACGAACAGATTGCGAC
AGAATACTTGTGTAGCTTACGATACAGCGCACCTACTGATGTTACTGTGGCCAGCTTATCCCCGGCCACCGATGCAGCAA
CATCTGGATTTCTTTCATTGGTTGATTACTTCACTGCAAGGAAGAGATACGGGGTTGTTGGAGAGAAGGGTGTCGGCAAC
GTCCGCGACACCTATCTTGTTCCCGTACCAGCCGGAACAAGTAGTCATCCAGAGTTCATGCTAAATCTGGAGGATAACTT
TATACCTGTCTCAAGAGCAGCCCCTATGTTGTTACTGGTTGTTGTCTATCGGAACGATGAAGCGGCCATGGAGAGGCTTC
GAGGACCAAATTGGGCCCGGCAGTACGATTCGCATATCGCAGCTACGGCTACGACGGCTCTCAAAATTGCCAGCGACGCC
CCACGAAATCCTTCGTCTACAACCCCTTTATCGGGATCCGCGTTATGTTCCCAGCCTGCACCTGTCCAAACGGCATGTGT
GCCACTTCAAGCGCCACATACAAGCTCAGGCCTACCAGCTGTGTCCCCAGTTATTGATATCCACACGGTCACGAACAAAG
ATGCCATCAAAGAAAGCGCACACCGGGAGGGTGAAGCTGCTGCCAAAGAGGTTCTCGGCCCGTTGTCGCTGTGCCCAACG
GCTGTCTTCTTGATGTCGCAAGCTGCCAGAATGCAAAAAAACGAATGGATGATTGTCCGAGATGTATTTGAAAAACAACC
ACAAGCTCGAAATGATCTTCAATTTCTCAAACGCGAGCTAGAGAAGTACCAGGAGCAACACAGCGCAGCTTTACCTGCTA
GGCCATCCCAAACACCGGTTCCTGTTCCGCGAATTCCTCATGCCGTTTCACCTCGTTCGAGTCAGCCACCATCAGAAGCC
CATCCTACTAACTTATCTTCCGCCTGATAGCTCGCGATTTCCGTGGACTAATTGTGCCTCAGAATTGATATTTTTATTTG
TACAATACTCAATTTTCCCTTAGTTTTTTATTGGTTGATCTGATGTATTGTCCCGCTATGCTGCTTGGTCGCATCTAGGC
TTTCAAGTCTGCGTCTGCCTCAGTACTTGTTATGAAAATATTTTGTGCGTAATTTATATATGCACATATCTAACGAATTT
TGAACTAGTGCTCTTGAAACTCAAAATGGATTGCCCTGGCACAGCTAGTTCAAGAGTCGTGAAGTATCACATCGGGCTTA
CTGTAAAAAGTCTCGCAGATAGCCTCTCTGTTGTGCCTATGATGACTGGTGTGCACACTGCGCAAAACAAAGCATTACAT
CAGCAATTGCGTTGGAAAGTAAGAGTGTTGGGTACTGAAGTTTACAGTATGGTTGGCCGAGTCACAACTACGGTGGCATG
ATACCTAACCAGCTTCATAGTTTTGCCAGGGCCTGATATGGATCACAGAAATGAACCGCAACTCTTCTTTCTTGTAACAA
AAGGGCGTCCTACTCAAATATATCATCCATTATCTTCCATAGCTCACCCGAACGCGCATGTGATGACCTGTCTAATGCGT
TATCAGCCCAATCGCTGCCGTTGAGCTTCGGCTGAGTATCAAAGCCATCGATTGAGCTGTCAAAAAATTGCACGCCAGCA
AATCCAACGAGCGTTCTGCGCACGCTGTCTGTAACTTCTTGGAGAGCCCGCGTCTCGTTGCGCGTCTTTTCGAGCTGATT
CTGAAGTAGGGATATCAAAGCCTCTCTGGTTTGGTGTGGCCGCCATTCATTGACCTGCTGATGCATGTTGTAAAAGATAG
TTTGCAAATCTGCCAGTTTCTCGGTTGCATTATTGGGATTCGTGCTCAAGATTCCAGCCAGCTCCAAGAAATTCAGTAGT
AGAGACTTTGACAGTTTCTTCAGTTCAAAAACTTTGTTGGCATGAATATCTTTCTCGGCTGATGTAGAGGGTATCATCGG
GCCAAGGCGCTCAATTCCATGGTCTTCGAGTGATGGCAACCGATCACTCAACTGACTTTGGTTAGGTATCAACTGCGTGA
AGCATACAGTGCAAGCTAAGCTCAACATATCGTTTTTCATATACTTACATCGTGCAGTTGTCCGAACAATCTCCATTTTC
CGTCATCGGGTGGTGGTGGTGGCTTCAGATACTCCAATCCTCCGAGTATGTTTGGAGTTATCGAATGCGTTTGCCGAGAA
ACTTCAGATTCACTGGTATTGCGAACATTCTGTGTTCGAGTGTACTTATCATGGGTAAACTCTTTCCACAGATACGAAGG
TGGGCTTGGATACGGGGCAATTGAGCTTTCTGCATCTTCTTGGTGAGCCATTGCCACGGTGAAGGTGACGTACGATCCGC
GCAGTAGAACAAAACGGCTAAACGATATAGACTGCTTTGCAGATGTGGCTGCTTATTAAGAAATGTGGCTTGTACTCCAT
AGTGGGTCAGAAATCGATCGTATCTTATTACTCCGTACTCCGTACGTTGTACGGAGTAAATACGGAGTAATAATGCTCAT
CTACTGAGTGATAGCAATTTGTCCATCTCCTTCTGTCGTCTATCATCCCCTGCCATGGCCGACATTCGAGCTCTTTTTCG
CGAGCAGCGCTCGGCATACCAGAAGTCTCACCCGCCCGCTGTATACTCACCCACAGGGAAACTTTTTTGCGATATTTGCC
ATGAACTGGTAAAAACAGAGGCGCAATGGGACGCTCATGTCCTGTCAGCTAATCACCGTCTACAATCTCGAAAGTCGAAA
AGCGTAGGATCAAGCGTGGAATCCCTTAGTCAGAACCCCTCGAGTGACAACATGGTGGCCCAGCTGTATAAGAGGAAACA
CGGTGAGGTCGACGAGGGCACTATAAGCGAAGCCAGCTATGGCGATGAGGAAGAAGGTCTTCGGAAGAGAAGGAGCAGGT
CCCAAAACCCGGGGCACATGGCGGAATCGAAATCAGATGGACGTGATCAAGATAGTACACGTCCAATGCTGAATCCTATT
AGGGTCCAACCAAAAACACCGCCGATAGGACGTCGAACATCAAGAACACCAATTCAAGGCAAAGAGCTGCAGATTCCGTC
TCGGCCAGCAACTCCAAATGCAACACGAGATGTGTTTCTCGTCAACAATGCCGCTACCGTCAGTAGCGAGCTCTCAACTG
CTGCACTCATGCCCAAACTTGCGTCGACGACCCGCTCAGTGGCCACATCTGTAACACTCAAAACACCGAAGATAGCAGAA
GGAGCTATGGAAGTCGACATAAGAGTAGCAGAAGTTGCCGAAAACTCAAAGATTGACACCAGCTCTTTCAGAGATCTAGA
CGAGGCAGAATGGGCAGCTTTTGAGGCCGACGTGGTCAACGCCCCGAGCTTCGCAGCCGTGGGACATCCTTCCAACGCAG
AAAGTATTGTTGCCTCAAGAGAGAATGCCGATCTGCCCGAAAAAGACGGGTCACAATTCAAAATAATGGCAACGGGAGAT
ACACAGATGAAGGAAGAGAAAGAAGAAGCGAATAGGGCTTTAGAAATCGAGTTCGAAGAGATGGTGGAGCTCGAATCTCG
TGTCAAAAAACTTAGAGAGAAACGCGAGGCTCTCAGACGAAAATTCGCCCTGGGGCCTTCTATCTTGCTTGACGAAGAAA
GTATTTTGCCCATTGTCAGTCCGAAAATGAGGAATTCAAAATCAAAAGCATATATGAATAGCCACGCTAGCGCTAGCGCC
GACGAGGACGACGATGAGGACGATGATGATACAGACGATTGGGACGGGTTCAGATTCAGGGCCTAACTTCCATCGAAGAG
GCAAACTCAATCCGAGTATAATATCGTCCTCCTATCATCACCACATATAATAGGTTCTGTACCAAAAAATAACAGCAAGG
GCATATCTTGACGTGGTAGTGTCTTTGTTCGGTATGGCGCTTTCAAATTCGCCCTCGCGGTATGCAAGTCATTTCTCGCC
ACGCGCAATCCTTTCCCAGAACTTTCGCAGCCTCCAGACTCTTCCAACTCCGACTGTCTCTTCCCATTTCCGAATATGAT
CGCTTCGCCGCCCCACCTCTCTTTTCCAAACAGCCCCAATCCACTGCTTTAGGCCGTCCTTCAGCCTCTGCCGCTCGATC
GCTCTTGTTAGTGCGACGAGCGACGGCGCAATGTGTCCAATTCCCGGCGCACACTCAACAGGCAGAACACACCGTCCAAC
CAACACCTTCACGGGTGGACGAGCTGCCAAACGTCGCGAGAGGCGGATGGAAACGAGGGACCTGGCGAGCTTGCGGGACA
CCACAGTCGTTTTTGTCAAAAAAATAGAGCGATCAATAAGATCAGAAAGAGACGGACGGGATAGGGAGAAAAGGGAATAA
GCGAGAACGGTACGACAGCGGCGTCTTCGTAGAAGGTGTAGAATTGGGGCTATACAGAGGTAGCGAAGCTGGTGGGATGC
CTATTCATATAAAAAAATTAGCTAATTAAGCGGGTGAATGCTGCATTGCTAGCTACAATGAAACTATTTCTCAAGGAATA
AATAAATGTAAGCGAAAATGCGTTACGGAGTAGATCAGATACAGACTCAAAGCTACTCGGCGTACCCTCGAAGCAGAGAG
CAAGTCGCTCACGTCCAAGAAGTCAAGTATGAACAGCATCACCTCGTTTGGCAAACTGCCAAAAGATATTTGTTTTAGTG
ATGCCGGTTTAGCCCGACTTAAGGACTTGCATATCGTAAGTGGGGTTCGGGGAGTATCTGATCGAGATGGTTTAAAACTG
GCAAAACCATCGTAGGGAGCTGTGGAGGGAAGGTGCGTCAGCTCCATCGACCGAATCAGCCACGTAGCACTCGGGGTGGC
CTCTGTAGGGAGTGAGAGTAGCCAGTTTGCGGTAGGATAATTTTGTCCGGGAGACGTTGCCTCTATAAATCGAGTAAGGG
CAATGATGGCTGCAATATGCTTGGAGCGCTCTATGTTAAATGGCTAGGTTGAAGCATGGGATGCTCCGGATTGGTGGGAA
GGGTTCTCTCGTACGTTAGTAAAAATCACACATTCTAGTGCGCGTCACTAGACAAGAGATACGATATTAAGAAACACTGT
ATGTACTCCGTACGTGGTGCTCCATAGAGATGAATATGTGTCTTATCTTACGAAGGACGGCTCACATGCATAGGTACATA
TGTATGTATGGCATCATTCGGTGATTAGTGTGGGGCACCGGTTTCGTTCTAGTGGGTCGTTAACGGGCAGGTAGCTACGT
CGTAGGCCTGGTAGAACACGAAAACAAAACGAAACAGCCCGTATTGTACTCCGTACTCCGTACTTTGATTAATAACAAAA
TCCCTTCCTACTTCCCAATATTTCCTACGTTCAAAGCTGTTGGTTTGCTCGTTACCGAAAGAAGTGGCTTTAACAACAGT
TGGGCGTTGTGCTGGCGATGTGTTGGCGATATGGAGGTTGGCCGCTTGACGTGGCCACCTTTACATTTCGAACCGCCACC
TTCAAGTCGCAAAGCCCGAGGCATATATATCTGCGATCTAGAAGTCTACAATTATTCTTTCTAATCCCATATGTACTCTC
ACACCGAGGTAAGCAAGCGTCCAATTATCAATGTGTGTAACCCATGACATCGGAGGCACGGATTCGCAAATTGAGGAATG
CGGGGTTGCCAGACGGTTTGTTGTCTCACTGCTGTGATGCGGGGAGTGAGGTAGAATACAGCACGTAAGATACATGATCA
CACGCACCGCTTTCCTCCTTAAAAGTACCAGGCAAAGAGCAGGGTTTCCGGCTACGTAAAGTTGCTGGAGGGCTTTTCGA
CGAACAGCAGCTACAGGGAGGTTTCATAATTCAGAGTAGCATAATCGTATTCACACACATATTCTGAAAATGCCCAGCCT
TGCAAGCGCATTTCAAGCGACAGAGTTGAGAGAATGAGGAGCAATAATATTTACTGCTCAAGTGGTCCAGTTACAACCCA
GGAAGTTAATATTGCCCATTACATTACTCCGTGAGTGCCAATTTCATGTATTTTGCTGCAGCTGTAATTTCAGGTCTCTT
GGACCTGCCTAGCCAGCCTCGTCTAGCAACCACGACCATCATCTTCATTGGACAATGCTAGCCCGTGGCCTTATTGTGCC
CCCCACTCCCCCTAAATGTTATCTGTTTAATCGGCCCCAGCAAATCTAGTAAAGCACGACAAAGAACATGCGAGCACTGA
AGTGTGTCCCGGCTCCTTAACATACATTTTTATCTGAGTAGCCTTCTTTTTTCTTCCATAAAATAGGACTCGGTTTATTC
CGGGCTTCCAGGGGTCGGTGGCCGTAAGCGCTGATATAGCAAAACAAAAAGGCTCAATTTATTGCACGTTTCGGGAAACG
GCACGGCCCGTTTTGGAGACCCGGTCCCCATTTCAGGCGTCCTAATTCAAAGGACAGTAATAACACAATAAGAAAAATTA
TCTGTCGCGTTGGCTTTCCTGTCATAGTCACATAGTATTGAATGCTGCCCAACCAAATCAGCAAGAACACAAACAATGAA
AGACATCGAAAAGAGGGGCCCGTACGGAGCACCGTGGTCCTTTGAAAGTGGCCGTGTCCCACATCCCCCTTGCTTAGCTG
AACGCATATAGTTTCCGTACTCTTTTTTTTTTTTTTGCCGTCAGGGGAGCAGACAAAGGTTTGGTTCGCTTAGTTTGCAA
CTCACATCAGCAGTATTCCTTCCACCACACATTTTCGTAGCTCTATCTGCATAATAGCAATGTTCAAGAATGTTATGCAC
ACAACCTATAAACCTACAATAACAAGTTAGGAACAACAATGATCTGAAAGAAATAAGTCAAGGTAAGATGAAAGCAAGGC
GTGCCTCGCTTAGATGCAAATTTAGGACAACCCTTGTAAGAGCTACCCAATATTCGATTATTTTGGAAGCTGCTTTGCTG
GCACTCTCGGGAGCTTGGAACCGCCTCTGATCGGCAATTAAAAAAGCCCCTGTCTTTCAGTCAACGATAGCGGTTCTAGG
AGTATGCTCCCACCATAGATGAGGTGAGATATCATATGTGTTGGCAAGTGTTTAAAAGTACGTCACTGGTATGCAACCAG
AAGGCGGGCTGCTCTTGTTGATGTTAATTAACGCCGAGTACATTTGCTCATGATTAGCTATAACCAAAGCTATACCTAAA
TTGACTTACTTGCAAACAGAGTATATCATGCACATGCTTTGCCTCTGAATACATACTCCGTTGCATTATGTATGTTTGTC
TTTAAATACGTACGAGCAGGTTTGATAATATCTTTTAGGTACCTAGACGTATTGCCTGTCGATACTCCACTCACACTGAC
GGGCAAATTGGTGCACGCAAGCCAGCACATAATTATTCCGTAAACGTAGAAAGCCCGATAAATACAGTGTAGTAGATTGT
CACAACCACCCCCCCCTTTTCCCCCAAAATCCGTTTAGTCAGCTTTGGCGACGTGCAAGCAGAATGAAAATGAAAAATAA
AACTTGATCTTGAACGGGCATGGCATCAATCTCGACTTCTTATCGTCCCGTCCTTATGCTGTGGCGTACTTCGCAACAGC
TGCAGTTGTGCTAAAAAAAAGATCCCAGGACGCAATTCTCAGAACAACTCATCGCGTGCAGCCATCAGTTTTGTCCAACT
AGGATCAAACAACGCGGGCTTATACTATAATATCTTCGCCGCAGAGGGGCTACTGGTGTGATGCCACGTTTTTCACTGTT
GCTGGCGGTAGCGTTAACAACGATAGATAAATTGCATTTTATTAGACATCTGAGCTCGCCCGCGGTCTGACCCTTTGTTG
CATCTTTGACCAATTTTGACCCATAATCATCTTTCTCCATGCTATAGTCAGCCGGCTGACCGAATACACGTGTGGGGATT
ATTCTTAAACTCACCCGGTGTGGATATACATCTACAATACATTGTGGGTTGCTTTACTCCGTACAAACGTGTCTTTATAC
CCGCCCATATAGATACGGAGTATAATCACCCATATCGTGTGAAGTCGTGCAATACGAGTGAGTGTACGGAGTACAGTGCC
CCGTTCAAATCTTCCTCTAGACTTATTGTTGGTGGTGGTAATCACAGCTATGCTAACCAAATCTCATATCCATATTCTAA
TGACTTTTCATTCCCGTTTTTCTTGCGATTTCTCTGATGCTTTTGAGTTCTTGTTACTGTAGGGTAGCAAATACAATGGT
CAGTTTCAAAAAGTGTAGTAGACGCTTATGTGCTGAGATTGATGACGCCGTGTAAAGAAATTTCAGCTTCGAGGTGTAAA
TATATCACCTAATACGTAGCCAACTATTATGCAATAATGAGAAGTCAAATCATGCGTTCACACCTTAGAAAGAGGGAAAG
CATCGGCGTTGGACCCTATTGACTGGCGATATCCACCTCTATACATTCTTAATCTTTGCAAATCCGTTCGCTCATAATGC
ACGCATAATGTACGTATAGTCATGTGAACAAGCTGAAAGCCTACCGCTGTCCGGTCTCCAGTGACGGGGGATTTTACCAC
GTAGGCACGCGAGGGATGGTAGGCTGATGCATGCACCGCTCGCGCGCTTGCGCGTGGGTAAACGCCAATTTCTGTACAGC
AAATCGATATGAAAATGGGAGTATGGGAAGAGTAGGTTTCATGTAGGCTAGAACTTGAGATATTTCTAGAACTAGCATTA
ATCGAATGGGACCCGGCTTCTCTCAATGCAGGTGGTCTGAAAACCAAAGCAGCAAAGTGGTTGTGAAATTAAAATATATT
CTTTTGCAAACTAGGAATTTAAGTAAACTAGGTACGAGAAAACTTGCCTGCTAGTTAAGTGGCATCCACCTGTGGCTTTA
CAAAGGGTGGACGGTGTGGTTCACGGAATACATGGCGTGGTGGGGGGAGGTCGAGCCAGGTCGGACTTTGAACCATGCTC
AACGTGGCTCCATCGAATGTGACCATGGAGAAAGACTCTGGACGGGAACAGCGAAGGCTAATTTGTCGGTAGACAAAGGG
ATTGTTAGGGTGGCACCAGAAGCTACCCCTGGTCTTTTGAAAGTTGGAAAGTATTCTGAGGCGATCATAGTGATCCTCTC
CAACTGGCGTTGGAGCACTTATGGCTCTGCCTGATGTGTTGTCTAAAGGTACCCACCTTTGAGAAGTAAAGGATGTGGCG
ATGTATAAGTATCCTGCAAAGCCTTTATTGTTGACGGATAGGATAGTATTCATGATAGTGTCTAGCTTCAAAGCCCCTAA
ACACACGCAACTTCAGAGAGTCGACGGGGCGACGCAAACTCGTTTCTTTTCATTCAAGTTGCCGATTCCACAATCTATAC
ATGCCAGGCAAGGCTACTGTAAGTAGCGCCTACAGAGGGCCGCACACATATTGAGCTCAAAAAAAAAAGAGGGCAGGGTG
CTCATACCAACACCAAACTATGCCCTGCTCTTATCGTGGGTACTGCTGACAAGTCCCGTATTCAAAGAATTGCATCTTGC
CGTGAAACGCAAGCGACAGCTGAGCATGTGTTATTTTGAGCAGACTCTATGGAGCTGTGGTTACTGGAAGTGGGGGAACT
TTCGGCAGCAATGCACCAAAGAATACCGAACCGGAGAGACATGTGGACTAAAGCTTGTCTACATGACAGTATTAAAAGAC
GGCCAATGCAAGCTTTGCGAGCAGATGGAGAAGAAGCGCCGTCGCCTAGATAAGTTAGTCAAAGACGTTGAGCGATGGAA
ACATGAAGGAAATAGACCAGCTTCGATCGAAAAGGCAGAGAGAGAGATTGAAGAAATCGATGACCGCGTCAGCAAGATTT
ATGTGGATCACCAAATACGGGCAAGGAGTGTTTCCTGAGCAAGGGTTTATTTTCGGCATGACAACTGTGTATGAGGTAGA
GATAGGTCAAACAGCAAGACAATAGACTCGACGAGTGTCACATCATACTTTATGCGCAGTTAATGGGAGCATTGAAAGTG
AGAGGGCTCAGGCAACCCTCGCCACTGTATATTACGGGTAATCTCGTCTTCTTTGCTTGTCTCTTCCCTTTTCTGTCACT
TCAGTCCTCATTCAATTGCCCTGGACCAACCATGATAACTGACCGGCGTAATGAAACATCTTAAAGAAAACCGAAGCCCA
TTTCAGCCATTTTTGAGCGTGGCAGGGCAACAACGTTACCAAGAAATGGAAAGGGAATAACAGTTGGTTCCATTGCACAG
TATCTCCAGGTGGCAAAACTAACGCGCGGGAGTTATCGACCATCCGTCCTTTTTTCTTTTTTTTCTTGGCTGGATAGAAA
GTTCGTTGAGTTTTACATTACACTTCAACTAAAGAAGTTCAGCGTGAGCCGCTGCCGACACCCTCTTGTAACCAAAGTAA
AGCCTCACCTTTGACTCACTATGAAAGCAACAGTAAATTGATGTCCTAACTTGTTTCAACGTAAGGAGAGCATGACATTC
TTAATACGAAACTGGTACTAAAGCAAGTTTAGGAGTATTGGAGAGGGAGGCTTCATACAAGTCACCCACGTAGATAAAAG
TTGCGATGCAGACAGAAAGTGATCGACTATGGACAGATTCTCATAGAAAGGTGCCAGAGGTGAGTGACGGGTGTAATTTA
AGTAGTTTGATGTTGGATCATTATGTAAAGAATGGAGTACGGAGTATATTTCGTAGCTGTACCGTTTTTCGAGAGTATAG
ACTCTCAGGTTGTGCATGGTACTCTGAAGTTGAGCAGACAAATATACACGCTTGCCGACGTCGTTGAGCCTCCCAACCAT
GATTACAGACGCCGGAGAAAGCTGGCCACATCCAAGCGGGACGAAATTGAAGCTAGAACAAAGGTGCTATCTTAGGGTCT
CCACATAGCAAAGCAGCTTGCGCACGTGGCTGTAGCTAAATGGGTGCTGAGCTCTGAATTGGGGCACTAAAATGTTGTTT
AAGCGGATGAAGTCCAATCACTGACACAAAACAGTACCTACTAGCAATTGACAAGATGGTACAAAAAAAGGAAACATTGG
ATGAAAGACGACAGACAGTGTGACACTTTACGCCTCAAGTACTTAAAACTGGGTATCAATTGTGACTGAAGCTTCGAAAA
TTTAGGGTAGAGAAGACAAACGAGGAAATGCCAGAAGTGGCGGCAATAAATCTAAATATACATGGTATGGGGAACACTAG
GAGACGCATGATCCCGAAAAATAATTGAGGACATGTTATTAGCTCATACACACCTGTGAAGTCGGCTAGCCGGTTGGAGA
GGCATACTTCGGTTCCAAAGTTGTACTCCGTAGATGGTATGGCATCACTGCGGATTAAAAGACCGCCTTTGCAGCATCCG
CAAAATTACCAACAAAAGGCCCAGAAATATCAGCTGTGTCTGGGAGAAAGTCTCGTTGCGGCTCTATTGTGTTCTCGATT
TCGTCATTGTCTTCAATTTGTGCTTCACCATCTGTCTCCTCCAAGGGTGAGAGCTTAGAAAGCAAACTCTGATATCGCAT
AAGGCGTTCGTCTGGGATGCCAAGTGCGTAGGTATTGGATATACCGCGAAGATTGGAGCTGGGCTGAGTGATCTCGAAAA
CGTCGACCATGTTACTAATTCGAGCCGAATGTATGTTAGTATCTCACCCTTGACTTGCCTTTGAAATTGCAGTACTTACT
CAGATGTATGGGCTACTACCCTTTGCAAGGCTTCAAGCTCCCTTTGCATTTCCTGTGCATCACATTGGTTATTCAGGTTT
GAGTCGCCAAAACTTCCATAGTGAGTCGCATCGGGGTCGTCAAAAAAAGGCCGAGACTCATCGTCCTATGGCAGTGCGGA
TCAGCCTACGAATCAAATCGTCGTTGTCGACTTACAACGACTACCGCAATTTAAATCCAAGCTAGGTGTCTGTTGATAAT
CTCTTACATCCTCATCGACGCTTTTGCGACGGCTGCCCAAACAAGAGCCGCAGTTTCCCATATTCTTTATGTAAAGCTCG
GTAGCTCGGCAGCTCGGCAGGAGAGCTGTCAAGACACGCGTCCGTCGCGAGATAGTAGGGCTATTCGAAGCTTCGCAGAA
GAGTTAAAACACTGGGGTCGAAACACGAGCTATCGCATTGGCGTGCATCACAACGAACGTTTGGCAAGTGGCTGCTGTCT
TGAAATTTCCAGATGCAAATTGTCGGACGACGGCGAAAACAGCGGATAAATTACTAAGCTAATTACAGTGCATTTGCGGG
GAAGGTGGTCTAAAACATAGTGATCCGATTGGGCATACCGATATAAAAGTGGGTCCAGGGGCAGTCAGCACCTTTGAGCA
ACAGCGACTGCTCCATAGTGGTTTCTCCTAGCTCCGTACGACGTTCGTAGTATCTTACGAACGGCTTTTCCCTTTTACGC
GTACAACATATAGTAGAAAGATGCCATCACTGTCTTGTAGAGGAAGAAAAAGTGTGTCTTGGCTACAAATCCTATCGATC
ATGTTCGGTTCTCGGCGTAGCTCTTCTCGAGACCGGACTGACAATCGGGCTAGAAAAGTAGTAGTTGAAAAGACCACTGT
CGTTATTTTCCTGTTCTTGAACGAAAAGGGTTTTGTGCCGGGCTCCTATGTAGCTCTCTTCGATGGACTGGTAAGAGTGT
GACTTATCCAGGCTCTCGGAAGCATTTACAGCCATAAATCGCTCATGGGGTTGAGAAGCTGTACTCTGCTGCTCACACTC
CGTATTAGTTCGCACTCTTCAATTGGTAAAAACCGCCGAATTTATCGGTGGCCTGGCCCGTTCACGAGCACTTCTGTTGC
ACATGTTGTGCTCCTTCTTTGAAGCCTCTATTTCAGACTTGCGGGCAGCAGTCTAGCATATGGTCGGAGAGCCAGGATTG
TAAAATACCTTTATCATCTCGTCAGATGTATCATTCCCAAAATCGGGCATTGAAGTCATCTTGTGTAGAAGCGATGCCTC
TTCAATACGTCCTTCCAAGCCTATGCTACCGGGACGTTAACAAAATTAGACATGAAGCCGGGCCCATACAGGCACCTACA
TACAATATGGTAGATACTTCATAGAATTTGAAAGCTGGCTTCTGTCTTAGAAGTTGTATTGCTGCATCGACGTCAAATTC
AGACTTTCTGTCCAGGTTTATACGGTGAGTATTCGGGACAATGCAAGCGAATAAGGCGTTATACGTCGGTCCTAAATAAG
AGTCAGATTCATATGCAGATATTCTGGTCTCCAAGATATTGAAACTACCCTACCCTCTTGTTGTGGCAACTGAGATAAGA
AATTGGAGAGGCTTTGGAAACCTGCGGTAGGTTGGAGGAAACTAATCTGCTTATCTGTCCGACCGGTGAACGTTATACGA
ATGAAGTTGTTGAATGGTCGTGATGAGAAATCAAGTTCGTATGCCTCGAGCAAGGCGGAAAAATCCCTGGTTTGAGTCTC
GAAAGTGCACATATACAGCTTCTTCATCAGGCCTTCCGCTAGCAAGGGGAAATATTCTTTTTCCTTGAGGTTTATTGGCA
CGGGCCAGTCAGTGCCTGCAAATAATAGATAAAACTCTTTCAGAGAGCAGAAGTTGACCAAGTGTGTGCTAAAAGACACA
AGTGGTACATACTAGCAAGGTAAGTAGGCCTTTCAGAGAGCTGTTATTGCACTTCTGTAGGAAAACAAAGGAGCCATTGT
TGTTCAAGCTAGATTCATTGTTGAGTAAGCTTGGGGTGTCGGGTTTGATCAATCGGTCATAGTTCAGGGTGATTGCCTTG
CGGGCGAAGACTCGAAAGCATTCTGACGGAAACGCATTTCTTAAGACGGGTTAGTCTAATCCTTAACGATATACCGAGCA
CGAATTCGTACCTGGACTGTAGGATAGCGCTTAGCTACGTAGCCAGTAAAGTTAGTGTAAGTAAACGCTGCGGTCGAAGT
CATTTGTCCCTACTGCTGCGACGGTGGCGACTCTGATAGAGTCGTTCTTGAGAGACATTTTGGCAATGCCGGCAAGCGAG
CAACGGCTGTCCCAACCAAGCAACTTGCCTTAAAAAACGACAGGTTAGACGGCGACTCTACAAAACCCACTCCGATTGAG
CTATTGACACGTCGACGATTTGTTCGAACGTTGGCAAAGGATGCTGGTTCGATTGACAATGCTTAGATACATGCAATGCT
GCACCGGGGAGTTGGAAATGGCAGCTTGAGAATTTTCGACTTATTTTTATCCTAATATAATATGTATTGGGTAGGCAAGT
CTTAACGTATCAAATTGGGAAGGTGCCGCTGCTGACTTGAAGAGCAATTGATAGTTGGTGAGAGAAGGTGCCAACTCGTT
TTTGAAAGTCTCACTTTCTTGTATGGGCTATTTGCATTTCACATGTAGCAGGCCGTTATTGGCTATCGGGGGGTTTGCTA
GCAGACGTTTGAATTACTTACTATTACGGAGTACAAGTGGCAAAGGCGGGGTGGGGTACACTCGTAATCTGTATATTACT
CGCAAGATACGATACCTGTGAAGGTTAAAGGAGGCTATACGTAGCGGTCATATAACGTGATGCACTGTGAGGAGCAGGAG
GCTGAATAGGGTCTAGTGTGGGCGAAAGAGTGTTGTGTACTAAGGAAGAAATAGATACATCGCGACCCTTCTGGGGATCC
GTATTAATACTAGTGTCAGGCCCCGCTTTTGTGCCTTCTGACCAATTACAGGCCCGTACGGCCAAGTGGGGCGGAAGGGC
CACAGTGTGGCGGATTCCAATGCTTGACAATACCATCAATCATTGAAGTGGCAATAGGCTTCTCGATTTTAAAAAAATGA
AGAGAAGGACACACAACCACTCCGTAATCCATGTTAGGATGATGCTTTTTGTCGCAATCAAGACTTGGTGGCGTGGCACG
TGAGGAGCCTAGCCATCGATTTGGCGCCTGGCGGTTAAGTGGTCCATGCTTATTCGGTCAAGGCAAGGAGCGATAAATTC
ATCACACGCATATTACTCCGTACTCTCTGTTATGTTCTCCCCGGCTAAACTAGGTTGACGAAAACTTGGACAAGACAAGG
CGACACCGGCTTTCTCCTACCAAAAAATTATCTGCTTGTCATTTATACTTTCGCAACCTCGACTTTATCAACCTTTTCCC
TCTTCTATTGAAGGTTTTTGAATCTGCTTTCTGTTCGTCTGTGTTTTGTGGCCACCGATCCCCTCTATTTTCTCTTCCTA
TCATTTCTCTTAGCAATGTTCTGCCCGCAGTTCATTCATCTCGCCTGATCACAACTGTGTAGCCTATTTGGGAGCAGTTC
AGGACCGAAACATGTGAGGCATGTGCTTAGGAAACTGGTGAAAGAAACCTTACCCGACGTGAGTGGCTTTTCTGTTCTTC
GGTCCGCATAACCAACGCGTCTGGGACACGCCATTCCTATCCGTATCCTGCCAGTATGTTTTCTGATCTTTGATGGCAGT
AGCAAGGAAGCGAACGCGGTTTTCCTATAAACCAACCTTCTCCAAATCCAAAGGCTGCCTACATTTGAACCCCCCCTATC
ATCCAACAACCATCAACCTGCCTTTTTGTCTCGCAACCCTTGCTGCTATTTTCACACAATGAGCACGCCACCACCCGCGC
AAAAGACTACGGAGGTCTCTCGGCCACGATCTAGTCAGCTTGTTTCCGTCAGCTGGGATGAAGCACCGGATACTGTGCCT
TCTCGAGGGTCACGGTTACAATTCGAGGTAGCAGAGTGTGTCGAGACGAAGACAGTCACAACTACCACAACAACAAAGCG
ATCATATCCCCCGCTCTATGTCCGCGAGCCCCGATCTCTGCAGTTTCGTGACATGAAAGAATATCCTCTCGCTACGAAAC
CAACGCCTCCGGAGCTTTCGAAGTTCACAATTGATCTTGACCGTTTCCCCGGCGCCGAAGCATGGTCGTCCTTTGATGAA
ATTCCCAAGTCCCACTCCTTCGATTATAGCCAGGATGATCCGCAGCTGATAGAAGCGCACTCACAAGCCGGACAAACTAA
AAGTGATCAAGACGCAACCAAAGTGGACTCTAGTTCTGATACGTCAGTTCGTGATGAGTCCCCTAGACGCTCAGCAAAAA
CCCCGAATGAGGGTATCAGCCGAAGATCTACCCGTTCCAACTCGGTGGCTTTGTCGCCAAAAACCACTACGAAAAAATCT
CTTTTGACCTCAAGCCTACCTGCTTTTCCAGAATCGCCCCGCCGTTTGGGGCCAACAATCTATGGGCGCAAGGAGAGCAG
GAACAAAGAAGCAGAGCGGTCTACCAGAGGCACGCTATCCTCATTTCCTGCCACACCAGACAACTCAGGCACAATGGCAA
GCGATGTTGATCGTATCTCTAGGCTTCGTCCGCTCCGATTAGGCAGACCCAACGACGGAGGGGACTTGGTTATTAGTCAA
CCCGTTTCTGCCTATGACACAGGCAGCCCGACCGGTAGCGACTCACATACAGTCTTCAGCAATACCGTGGCCACACCGCC
GATTATGGATGCAGATGCCGAGCCATTTACTGATGCCGATGAGTCTCTCCAGCAGACAGTGAGGGCCATGCACCCCAGGA
TACTTAGCAATGTGGGTGTTCTTGACGCTAGCCTACCAAGCCCGCGTCTTTCGCCCACACTGTCCGCGGTTCACCCGCCA
TCAAACTCACAGGATGACGATCATGATGAACTCGAAGATGTGGCATTCTCACAGCAGTTGATTCGCCATGATTTGCCATG
GCCACATGAGTCGCAGGCCACCGAAGATGCTGATACAACTCAGCTGACGGCAGCAGAAGACGCATACACGCAGCAGAGCC
CAGTCTCCCGAGTGGCTCAAGCAAAGCCAAGTTTCCTCGAGACTCGATCCATGCTGGAGAAATTTGACACTATGCCGAAC
GAGATGAAGACGTTCATGATGTACCAGTTTCTACGAAGATGTACGAGGAAAACCCTCCACATGGTTGCGGACGTCGTAAA
TCCGGCTCTCAAATGCGATTTTTTTAGGCGACTCCCAGTCGAGCTGAGTCTTCACGTTCTATCGTATTTGGGTTATCGCG
ACCTTTGTCGTGCTGCCCAAGTATCGAAACACTGGCGAAATGTCATCGACACAAATGAGACTGGATGGAAGGAAATTTTC
GACCGAGATGGTTTTGAATTGTCTCTGGGAGAATTACAAAGGGCGATCGCCCAAGGATGGGGATGGCAGGACCCAGTGGG
ACCAGAAGGTTGCGAAGCAGATTTGAGTCAGCGCAACCGAATGATATCAACTGACAACGAACTTATCCGGGCATCAAAAA
CAGACACACCTCACCGGGTTAGAAATTCAAAACGAAAACGGGCAATTGCCTCCTTGCCTAGCGCTGAGCGATCAAAACGC
CGAGCTAGTGCGCAGGAGGCTGCAAGAGACGAGAAGTTCCACCCTTGGCCACAGTTACACAAGTCCGAAGGACCAATATC
GGCTGCAAGTGCTGCTGCGGCTGCTGTTCCGGATCCACAAATCGGCATTCCGAGTTTAAGGAAACTTCACCTTTTCAAGT
CACTCTATCGCCGCCATCACATGATCCGGCAAAACTGGACCAGTGGGAAAGTCAAACCCGGCCATGTTGCCTTTACTGCA
CATCCCAGACATGTTATCACGTGCTTGCAATTTGACGATGACAAGATTATCACGGGTAGTGATGACACGCTCATCAACGT
ATACGATACCAAAACTGGAAAGCTGCTCAAAAAGCTAGAGGGACACGAAGGAGGCGTCTGGGCTCTTCAGTATGAGGGCA
ATATTCTCGTATCTGGCAGTACCGATCGCTCTGTTCGTGTCTGGGATATCGAGAAGGGACTCTGTACTCAGGTTTTTTAT
GGACATACGTCAACAGTCCGCTGCCTTCAGATCTTGATGCCAAGCGACACCGGCAGGATTGAAGACGGTAACCCTGTTTT
GATGCCCCCAAAACCCTTGATTATCACAGGATCTCGCGACAATCAACTTCGCGTCTGGAGATTGCCCGAACCAGGATCAA
GACGATATATACAGACTGGCCCTCCTGCAAATGACTCAGAATGTCCTTATTTTATCCGAATTCTTGCGGGACACACCAGC
TCTGTTCGGTCTATTGCGGCTCATGGCGACATTCTTGTTTCAGGCAGCTATGATAGCACTGTCCGAGTGTGGAGGATAAG
CACGGGAGAAGCCCTTCATGTCCTACATGGGCATAGCCAGCGGGTATACAGCGTCGTTCTTGACGTCAAGCGTAACCGCT
GCATTTCAGGCTCCATGGATTCATATGTCAAGATATGGGATCTAGACACTGGCTCCTGTTTACATACGCTAGAAGGGCAT
TCCCTCTTGGTAGGCCTTCTGGACCTGCGCGACGAGAAACTTGTTTCGGCGGCTGCAGATAGTACTTTGCGAGTATGGGA
CCCTGAGTCGGGTAGATGCAAAAGCACACTTACAGCACACACGGGCGCCATTACTTGCTTTCAGCATGACTGTCGCAAGG
TCATTTCTGGCAGTGAGAAAACTGTCAAAATGTGGGATATTCAAACCGGCGAATGCATCCAAGATCTATTGACAGACCTC
GGTGGTGTTTGGCAGGTCAAATTTGACGAAAGACGCTGTGTGGCAGCTGTTCAACGTGATAATCTCACATATGTCGAGGT
AATTTCTTGGTCCCCGCTGCACTTTTGCTATTTCGCCTGTCAATTGCTTTACGATAATGGTAGTTTGTCTAACTGTGTAC
AATACAGATTCTCGACTTTGGTGCTGTGCGCGATGGAAAGCCTCCTGAAGAGTTGGGAAAGCGTATACTTTTGAACGCAC
GAGATGTTCAGTCCCTTATCGATGAAGAGATATGAGCTTTATGGTCGGTACCCCGTTAGCAGAGTGCGCCGACATCGACG
AAGTCGGATCGGCGAGGACACCCCATTCAGTCCGTCCTTCTAAGCACATTCGTTTCACTGATCATGTCTCATTTGTTTAT
TTACTTGCCCGGCTTTTCTTCTTTGGGGGTTTGTTTTCTCTTCTGAAGACACCCACCCGGAAAGGCGCGCACTAAAGTAA
ATGGACGGCGACATAATTGACGCATTCTCCACTGCTTTTTGTTAGTTTTGAAATTCTTTATTAATCGACGAGGCATAGAG
TGCATTTTTAGGCGTCTGTTTTTTCTTCTTCTTTTTTCTTTCTTTTTTGTTCACTTGGCGTCATTTTCAATACAGGCACG
ATTCTTGCAATGCTTTCTATCCCAAGTGCTCCCGATGCTACTGCGTTTTGATTTAATGGTTCTTTAGCTAAAGCTCAACT
ATAGATGGCTAAATGTCGGGTACATAACTCTGTAAGTATTGTCCGGTGTTTTCGAGGCGTTCAATCGACTCCATTGTTAG
TTGAAACCGACGCCGGTCTTCTTTCAGTCCGTTTCGTCTATCGCTTGTCGTTTTGTCTTCCTCCATAAGATCGCAAAAGG
ATTGGGAGGCTGTATTGGGATAGTTAGCAGTTGTATTAAAGTTCGGGAAACGTGATAAACAGGGTGGAAAATTTCTTACT
CATGCCGTCAAAAACCCCCAACTGGCTGTCGATATGCCACTTAGAAAGTGACTCGGTAACATCGGGGATAAGGCCAGAGA
TGATGTTCAGTGTGCAAGTGTCAACAAAGCGTGTGCTCGCTGTTAGGTAATAGCCGCGCACATAGGCACATACACTCAGC
TCTGCCTTGAACGGGTCTGGGCCGAGTTTTGTAGCTTCTTGATTCATGCGGACGTCTTCACGAGCTCGTTCTTCTTCCGC
CATCAGCTCCCATGGCCGAGGTGGTGATCGGTCAGATGCTTTGTCTCCAAGGTACGCAACCATCCGATAGTAGTGTCGGT
GTCGTGCCAAAATTTTGGCCTCGGCGTGCTCGTGTCTAGCGAGGCTATCTTTGTCTAACGTGTAAAATTTTCGGGTCTCG
AGCGCATAGTTTTTCAACAACACGTCCTTCACGGAATGAAATTGGTCAACAATATACTTCTTCAAAATTGAAGCTGCCTT
CTTGAAGACAAGCCGTTCCCGCAAGTTACTGAAAGCCTCGCATAGTAGTTGATGGAGCGTATTGTCCAGAAGGCGATACG
TCCTATCCAAAAGCTGTTGAAGAGGGCCCCTCCATGGTCTCACAGCTTCCATGCAAAGCGAGTTGTACACATCTTCGGTG
ACAATTCCTGGCATCCCTGGCTTGCTCCTAGAAGCGATCACCGCTCGCACCTCCTGAAGCGATCTGGATTTAGCGCGGAG
TTTGGAAGTAGAGCTGCATTCTGACGGTATCTCTGCTTTCACCGGGCCCTCTCCCCGTTGTCGTTTACTTGGTGTGCTGG
GACCATGAGGATCCGGACCCTCTAGGTATTCATCTAACCGACGGCGTCTTGTGTCGTGCGACAGTCTTGGAGATAGTGTT
GAGCTTATTGAGTCGTCGACATGTGTTAAGTCGATCCGGCCGTTTGTATCGAGTCTATTTAGTGGCGAGATTTCGGTCTT
GACGATGTATCGCGGTTTGAGATCTAATATCTCATGTCGAAATTGCTGGACGACGTCCCCCCACAACGGCGACAATGATG
CACCTTCCAAAGTTGTTTTTATGCGGCTGGCAAAATCTGCAAGACTGCGGCGCACCTCCAGCTCTGGATTTTCTGGTATA
TCGGGGAGCTTGGCCAGTTCGCGGTTTACATCCAGTAGCTTTGAAGTCACCTTTTCCTTGATCTGAGGTAAACTAATAGG
CAAACAGTCAGAAACAAGCTTGTACAAGGTACATCTTCTTGGTAGTAGCCGGAATATGGCAGGACGCAGCCTATGTTGTT
CATAAACCCACCACTTTGCAAATTCGGCACCGAGTTGCTGAGACATGAAAGCGACGAGGCGGCTGACGCCACATCTGTCC
TCAAACTCCTTGAAGCATTCGCGCCACTCTTGATTCGCCAGCCCAGGGAGCTGCTTGTTGAAAAAAGCCTCTTCGTACGC
ACCCTGGCGTTCTAGATCGTCAGCAGGTCGGGAAGGGTCTCGTTGTGGTACCATATCGTCAGGAATTAGATTTTGCGTGA
CTACCGGGCGCGCGGTCATGAAATATCCATGCCCAATGCGATGCTGCTCGCCACGGAGCATTGACGTCCACTGTGACGGC
GCACTTGGACCGGGAGGAAGTAGGTCGGCTTTTGTCATGATACCAATTGTCCGGGATTGGGCATTCTGTGCTCGTATAAT
AGAAAAGGTGGAAGACGTTTCCGGGTCGGCGTTCATTGGAACCGCCCAAAGAATGATTGCTTGTTGGTGAGAAATGTATT
TTGCCGTCAAGTTTTCCACGACTTTTACCAAGTACTGATCTTCGTCTTGTTTCGCACTTGTAAATACCCCTGGAAGATCA
TAGAAGCTCAGATCTGCCAGACCAGGAGCCAAAATATCGAGTGCAACTGTGTTGGGACTAAAGGCAGCTTCGTTTTGAAT
TGACTCGAGATCAAGTCCCTGGCAGCGTTTCCAAATCTCGCCAATCCCAGGTTTGTACAGACTGTGGTCTCTGCTAGGAT
TCAAGGTAGCTCTCTGGGCCCATCGAAGAGTTTCTTCAATCCGAGTTGGATCACCCAACGTGGCAAACTCTTTGATGTCT
CTGCGCTGCTCAAACCACGGCCCAAACGGGCTGGCACGTGTGACGTTAGCAGGCGGGCGATATTCGTAGTCCTGTTGTAG
CGATATTCGGCACGACCAAGACCCGCCATGTGAGCCAGAAAGCCGAATGTGGACCGGGCACCTGGTACAAGCTCCCTCAC
TGCGTGGCAGATAGATGCCGGAAAAACTAGACATTAGACTGGATTTCCCAGCCGACTGGTCTCCAACCAAAACCAGCTCT
GGAAGACTGGTAACATGTTGGATTCCCAGCGCCTGAAGCTCACCAAGGGTGTCGTTAAGTTCCTTCACCTTATCACCAAT
GGCAGTGAAGCCGTGAGAGACAAAGCTGACGTTTGCCGCTACCGTATTCTGAAGGCGATCAAGCATGTTCTCCGCGGCCT
GCGACTTGATTTGCCTAACCTCCATAAGGACAGGCTCATCATCGTCATCGCCGTTCAGTATGTTTTGGTCACTGCTCGCT
CGGACAGTGTGTAACGCAGACCTAGTTTCCACGCTTGCTGTTCTCTGCGTTAGATACAACAGTCTTCTGGGGGTTCTTAG
GATACTTACGGGCACCAGAGCGGGAGAACCGGCCTCCGGGCTCAGGCAAACTGCTGGAAGCGACAGCCCCTTGTAGTATA
AGCCCCCCATCGTTGCTTCTATGAGAATAACTTATGCTTGTCATAAGTGGGGCTACAGGCTCTGACTTGACTATGAGACC
AGCCATCGTTCATGGAGTTAGCTTTCTCAGCACTGTGTTGCGGCCACTAAGACCGACTATTGAGCTCCAACTGTACGTCG
AAGCCGACCGAAAGCTTGCCAAAAGCTAATGCAATGGGCTACTGTGCTGGGTTCGGCGAAAGACAAAGAGACAAGATGCG
ATGCTTTAGAAGAAGATGGTCAAAAGACGTAGGGACGATATTAAGGTGAAGATAAAAGGGGAGTAAAGAAGGGAATCCAG
AGCGGGCCAAACAAAGCAAGCAGTATTCTCCGTCTGAGCTCGGTGTTTCAATAAGGAATGTTAGATCTGGCTAGTAATTA
TGGGTGACTTGGTAACAGTATGCAACTAAGAGCCGAGACAGCGTAGAGTCTCGCTCGGGCTTGACGGTCCCCGGCAGAAC
CAATTGTCCGAGTTGCCTAGCACGGGGCGTGCAATAAGAATGCGATTGGCGGGGCACCCACATAAATGTGTTGCGAATGG
GGCCAGCTTGCCAACTGTTATTGAGTTCATGCCACAATTTCCATCGTCATTTTCTTACTGTCTTCTATTTGTCTTCGCAG
AATCATGTCGCTTCAAATTCCGCACCGCGAGAGGCACGTTAATGGCATTAGCGCTGTTACGAAAGCAGTTATTCTTGTAG
GTTCAGTTGTGTTGCAGCATGGTCGAAGTGCCTACTGTCATCAAAACTGGGAAAACTGCTAACAATGGTGCTGTAGGTAG
GCGGCTCTTCTCGTGGTACTCGTTTCCGCCCGCTTTCTCTAGATGTCCCCAAAGTAAGAGATTCTGCTTGTTTCCGATAC
ACCCACATTGCACGCTTTCGACATAGTCTGGTTGTACTGTCCAGCTAATGTATCTACAGCCTCTATTTGATGTAGCCGGA
CACCCGATTATCTGGCACTGCCTGACGGCTATCGAAAAAGTGCCTTCAATTCACGAAGTGTACCTGATCGGCTACTATGA
CGAGTCGGTGTTTCGCGACTTCATCAAGGATGCTTCGACTAGTTTCCCTCACCTCTCCATCAAATATCTGCGCGAATACC
AGGCCCTCGGAACCGCTGGTGGCCTGTACCATTTCCGGGACGCCATACTCAAAGGCCGACCGGAGCGGCTCTTTGTTTTG
AACTCGGACGTTTGCTGCTCATTTCCCTTGAACGAAATGCTAAAGATGTTCGTTGAAAAGGATGCAGAGGCGGTCATTCT
CGGCACTCGGGTTAGCGAAGACGCGGCCTCCAACTTTGGCTGCATCGTGTCCGACAACCACACGCGTCGTGTACTACACT
ATGTTGAAAAACCCGAAAGCCACATTTCGAATTTGATCAACTGTGGCGTCTACCTCTTCAGCACCGACGCTATATTTCCT
TCTATTCGCAGTGCTATCAAGCGGCGCAGAGATCGCCCTGCTCGCCTTGTGTCGTATCCGTCATCTGAGAATCTGGAGAG
CAGTTTCATTGAATACGATGATGACGAGTCTGAGACGACTGAAGTCATTCGTCTCGAACAGGACATTCTTTCAGATATGG
CTGATAGCAAACAGTTTTTTGTCTACGAGACGAAAGACTTTTGGCGCCAAATCAAAACAGCAGGTTCTGCCGTGCCTGCT
AATGCCCTCTACCTCCAAAAGGCATGGCAGAGCGGTTCAAAGGAGCTAGCTGAGCACAGTGAGAACATTATCCCTCCTGT
TTTTATTCACCCTACCGCACACGTTGACCCCACTGCGAAACTCGGTCCCAACGTCTCTATTGGGCCTCGTGTAACCGTGG
GTGCAGGCGCCCGCATTAAAGAGTCTGTTGTTTTGGAGGATTCCGAGATTAAGCACGATGCTTGTGTGCTGTATTCCATA
ATTGGCTGGAACAGCCGTGTTGGTGCCTGGGCGCGGGTTGAGGGAACACCTACGCCCGTGACAAGCCATAGTACCAGCAT
CATCAAGAACGGCGTCAAGGTTCAGTCCATCACTATACTCGGCAAAGAGTGCGGAGTTGGTGATGAGGTCCGCGTGCAAA
ACTGCGTGTGTCTACCGTTCAAAGAGCTCAAGAGAGTAAGTCGCGGCCGATCCCATCTGCCTTTCGACGACACAAAGAAG
CAAATCTTCCAATTGCTAACTTTTTCAGGATGTCACGAACGAGATCATTATGTAAACAGGGCGCTGTAACCAATGGAAAT
ATCTTGAGTGGCACGCAGAAAGAAGGTATCATATATGTGGGAGCGCAACTAGCGTGCTTTCTGATGGATGTCGTATCAAG
CGCGTGATCTGACCTTCAGGGTTCGCTAGACAGCCGAATAAAGTACGGAGTCCAAAGTACAAGGTGCTGTAATGCGTAAT
GTGTTGTCGCATCTACTCATATCTCAGGCTCAGTTTTCGGGCACCGAGTAGATGACAAAACCATTTGTGACGTGATTGAC
AATAAGACACGTACCATGCGCGACATGTGCTCGTGATGAGCTTGAAGTCCCTATTCACCTATAGAACCATGAAGAGGAGG
CATCGTGCTCAAGACAGGCGAGAAGGTTAGGAAATGGCGCGTAACTTTGTCAGTGCAGACTCCAATGCCGACTGACACAC
TCCTTTCTGCAGGTCTATGGCGACGTTGTAGTCAGCTCAGACGGCGTCCGCTCTCAGGCACGACCGCGGGTGCTAGGCTA
CGAGGACAAGCCAAAGAGCTCAGACTGCTGCTGGATGTTAATACACCGTGACGAGCGCAACATCGAGGAGTCCTTATCGT
TTCCCGACCGCCTTAAAGACGTATACATCGTTCTCGAGGGCTGGGTGCTTATGTTTCGGGTCATCGTGGAGAAGACGCCG
GCTCTGGTCGACTAGAAGCTTGTCTGCTGAGACCTGTATCAATTTTCCGGGAGATGCCACCCATCCGTTCATGCCGACGA
GTATACAACGCGTGGCACAGATGATGGAGGACGGGCAAAAGTGGCCGTGTGTCTACGACGGGCCGGGAAAAGAGCCGTGC
CAGCGGCATGTGCGGACGCACTAAGACATCCAGTGAGAAAGAGCTCTATACATACACATAACATGCACGCTGACTAACTA
CTCGTCTTGCAGATATCACCGCGTTACAGTAGTACTAAAGACGGGTGAGGTGACGCGCGACATGTGGCACAAGACAGACT
AGAAAAAATGTGAAGGAGAAATCCGACAGCAGTAGCATCTCTCGAGACGACTGGATCCATGCCTTTGACGTGGAGAAACG
TGCAGAAAACGTGATCGAGCAGATGTTTCCCAGACATTTGGGGTCCTGCAGACGCCATGCCGAACAGCTGTGGCGTTGAG
GCCACCGCAAACGGCGTCTACTGAGGCTTGCACTTGTCGAAAAATATACTGTTTTTGTCTCTAGGCTAATAAGAGGTCAT
CATGCAGAGACTCGCTAAGCATGGGGCCGAAATCAGTGCCGTCATCGTGCATAGAATACAAAGGGTCATTGAGATCAGCA
AAACAGGCCTTCATGACACCCGACATCCTGTTCACGTAGTCAGTTGAGAATGCGTCCATATATCTCCCTTTCGTGGGGGC
AACATACATTTCATCCTGTTGCTGTTGCTGGCCTATGTCGAGAAAGTAATTTTCCGGTGATTCCTTTTGGGGGCTGAAGC
TGCGATCGTCATTCAGCAGGCCGTTCTCCTTGAGCTGGGCCATGACCTCAGTGAGCATATGATGTGTCCAGAAGACTTGC
TCCATACTCTGCAAAGTGTGAAGGCACATGCGGACGTCATCGGCACGTGCGTTCTGGCCGCGGGCTAGGGCGAGCAAGAA
GACTTGGAGTACCTCAATTAGGCAACTGCTATCCAGCGTGACCAGGCTACTAAGCAGGGCGGCATCTCGCATGAGGCCTA
TTACGGCCAGGGACTTCCTTGCAGCCTCGATGCAGGTAGTAGAAAACTCCTCGAAGGAGGCCCGCTTAGCAGGCGGAAGA
GCAGCAAGGCCTATGGGATGGAAGGCACTGTACAATAGAAAGGGGCGGGTGGCAAAGATGGTGGCGCTCCAATAGCGCAG
ATGCAGAATAGACACGGAGCGCTGGTGGAAAGGAGCAGCTCTGGAGACGTCACATAGATGGGGCGGAATGGCAGCATACC
ATTCGGTCAGCACGGACAGCACATCGTTCACAGCCGATATGGACGGTCGACAATCGGAGAGCGGGGTGTGTGCCGTATAC
ACGGCCGAGTCACATCCGTACAGGAGCCGGCCCAGGCGGCGTTTGATCTGGGCGAGCTCGCAGGAGACGGTGAGGTAGTG
CAGCGGCATGTGCGAGCCCGGACTAAGGATCTGCAGGCGGGCGGTTAGCACGGGGGAGAGGGGGGAGAAGGAGTGGACGG
GATATGGCCGGCATATCTTACTTGCTCGGAGAGGTCGTGCAACTTGCCGGCGGCATGGTCTTCGGTGATGGCGGGCGGGT
TGCCGTAGCACAGGGCGACGTCGAGATCGAGGAGAAATAGGGTGGAGTACAGGCGCAGGTCAACCTGACGCTGCAAAAAG
CCCTTGGGCTCGATGGTCTTCCGCAAATGCAGGCCCAAGGTGAGGGCGATTCGAGCAGCAGCGCCGATGTAAATGTAGGC
GGTGTTGCTGAACAAGGAGCTTTGCAAAGCGAGGCCCTGGAGAAACGTCAGCGGATAGAGCCGGAATAGGCAGCAGGCGG
CAGAAATGGCGCACGAGAAGACAGAGGGCACGAACGCTGTCGATGTCGGCCTCGTCGCAGAGTGCAGGCACGAGCATCTT
AGCGAGCGATAGATATCGAGCGGCGGGCGGCGGTTCAGCAGCGGCAGCCTCCTCAGCGGCCTCAGCAGCCTGAACAGCCT
CGCTCTCACACGTCAGGGCCAAAACGGCGTACAGCGAGCAGAGGGTGGCGGGCGTCGCACTGGTAAGGTCACCAGCGTAT
AGACGATCGAGGACGGCATAGAAGCGCTCGGCGGAGACAAACCAGTAGACGGACTGGATGTCGCGGAAGAAGCGGGAGAC
ACAGCGGTCGCAGAGGTCACGGCGCGGCAGGAAGATCTGCACACGGCACAGGCTAGTGCGGACGTGTCGCTGCTGGCTGT
GGATCTGGTTATGTTGCACCGAAAGGCCGGGGGAGACTCGCCCGGCAGATGAGTCGGGAAGCGACGGTGGTGGCAGCGGA
GGCGCAGCGGTAAAGGGAGGGACGAGGTCGCTGCTGCAGGAAAATTCGGGCTCACGCCGCTGGCAAAGCGACCGCACTGC
GGCGTGGAAGGTGTATCCGGAATCGGCACCGACGTAGCCTGCGTCCAGAAGTATTATCAGCAGGACGGCAGCCTCAGCAG
CCTCGAGAGCTTCTGGTACGTACGGTATGTTCCCTTGGAGTCGATGCGTAGCCAACCCAGCTTGCCGTGCATCTCATCGA
TCTCCTTGATACTCACAGCACTCTCCTCGGCCTTGACAGGGCAGGGGTCGAAGAGTGGCGTGCGGTGATCGTCACTGAGG
ACCACGACCGAGTCGGACGAGGCCTCTGACACGGCCACAGACGGGCGGTTGGCCGGGTTGGCAGCATCGAGTGACTGGAC
GACCTCCCGGAGCGACTGCAGGCTGAGTTCGACATGAGGAAGGAAGTGCTCGAGCGCCTTGGTCATGTAGCGGAACTCCT
CTTCAGAGACGTGGTAGTATGGCCTCTGCCGTCGCCGCGACGGATCCAAATGGCAGATTGCATCGATGCTGGCACAGAAC
TTGCAAGGTCCTGGGACTATCCGACCGTCAGCCCATGTATCTCTTCTCCCCCTCCGTCCTCCCAAGATAGCACGAACCTG
GATCCACGCACTGCCAGTCAATGTATCAGTAGCTACCATGATAGCGACGCAGATTGGACGAGATTTACCTTGGTCTTCCG
GCTCTTGCATCGGTCGCAGCTCATCGGTGCTCGCCTCTTGCTGCCCATCTTGCTGGACGCGTCCGTGGTAGAGCCCTGTG
TTGACATCTTCAGTGGGCCTGGTGCAATGTTTATCGACAGGTTCAATTCGATATCAATGTCCAGGCATGCCACGGAAATC
GTAATGCCGGCCTCTTGGAACAAAATCTGCTTTGCCTCTAGCCCCTCCCTGCCCAGCTCTTCGACCTGCACCCCGTTCCG
CCTGCGAGGCCTGGCCGCCCATTGGCAACTGCCGACAAAGGGTATTTCGAATTGGATGCCAGCGTGCGGGGGAGCTGTCT
ACGACGTACAACTTGCCCCGCAGTCGTAAGACAGTATTAGCGTATTACTATCACTCCGTTTCTCGACTCAACGTCGTAGG
AGAAAGTCGGCCTTTCTTTCTGCCATTCGGCAACGGCCTTCTAGGTGCGCCGGCTGTCTCCCCCCCTCCCTCGATATTGG
TAAGGCCGCCACGGCTTCCGTTCGTTTCTTGGATGACAGCTGCTTATGGCAGGCTAAGCTAACTGATATCGTAATACAAC
CCTGCCAGCTCGGGTGTAACTCTGTGTTGTCTGGAAATATGCAGCCAGATAGTTTTAACACTTAGAGAACACATGCTTCA
TGGTTCTAAGCTGGGCCTCTCCCTCTCTTTCTTTACCTCCGATCGCTGAGTCACTGTACCAACCTGCGCATAAAAAGACA
CCCGTACGATCCTCTAAGCCAGCATATCAGTCCATTTTCGCCCTAAGCTCACAAGCTAAGCCCGGAAGGCCCCGATCCCA
CAACTAAAACAAGAGCTATAATCTACTGAGTACATAGCCAAAGGTGCCCCCCATCTGTGGATGATTCCGTAGTTACAAGA
GAGTAGAGTAAGAGATGCAGCTATTCGAGATAGTAAAACTTTGCATGGGTGGGTCCCTTATTAACCAATCAGATGCACCC
TCATGTTATATGGCTTGTGATTACGGAGTATCTTTCCACCGTACGCCACACCTGCCACCGCCTTTGCAGCGCTCGTACCT
CCATTTATTAGCACAGTACGGAGGTCCCTCCCAAAAGAAAGGGCTCACCGCTTTTGGCAAAATAGGTAGGTGGGTATATT
CTATTAACACTGTATTTACCACCAATCTATTAGCGCAGTCTTATGTGCTGGGAGCCCTGTAACTATATTAATAAGCGGAA
CACATTAGTGAGATAGTCTGCTAAACTTTAGCGAGCTATCGCTAATAGCTTTCTCCGTATATATAATAATAATCACTGTA
TACTGCCACCACTATGGAAAAGCGGTGGGCCCTTTCTTTTAGGAGGGACCTCTGTACAAGACGTGGAAGACAAGGTGTGA
AGGTTAAAGGAGGCTATACGTGGCGGTCATATAACGTGATGCACTGTAAGGAGCAGGAGGCTAAATAGGGTCTAGTGTAG
GCGAAGGAGTGTTGTGTACTAAGGAAGAAATAGATACATTGCGACCCTTCTAGGGATCCGTATTAATACTAGTGCCAGGC
CCTGCTTTTGTGCCTTCTAACTAATTATAGGCCTGTACGGCTAAGTGGGGCGGAAGGGCTATAGTGTGGCGGATTCTAAT
GCTTAACACTCCTCTTAAATACGCTATATAGGCGTACTATAATGCACTAAAATTATTCTTAGTAGCCTTTTTATAGCTGC
TAGCTTATTAAGCAAGGCAATAGCCTTTTAAATACTACCTTAGGTAGTACCTTTATTATAATATTAGTAATTTAATCTTT
AAACTTTATATATTATACTATTAATAAGCTGCTTAGCATACTTTTATAAAAGTAGTACTACTTAATATTAAAGTGCTTTA
AACATTTTTTAAATTTAAGCTTTTTTATAATGCTAATTATAAAGGTATTATTTATAAATATTTAAATATTAGCTTAAAGG
CTTATTTTAAGTATAAATTACTTAATTTAGTAAGCTTATATTATTATATAGTAAGTAATGCTATATTTAGCTTTATAAGT
AAAAATGCTAATAGTTAAAAGCTTTTTAACTTTTTAAAAGACTAGTTTTTTTTAAGATTTTAAAGATAAAGCTATATATA
AAGTAATAATTAACTAGATTATTAGCTTAAGATATATTAACTTACTTTTAATATAAATATACTTTTTTAAAAAAGGCTTT
TAATAGTAGTAGACTATAATATAGTCTTTCTTACTTTATAAGTAGTAAAGTAATTACTTAGCTAACTTAGTATATATCTT
TTTAAGTAATTTTATTACTTTTAAGTGCTAGTATATAATAAAAAAGATATTAAGTTTTATTATTATATTAGTATAAATTA
GCTTATTATTTATATACTAATATTAAAAGCTATCTATTAAAGGTATACTTAGGTAGGCTAGGTAAGTTAGGCAGGCAAGG
AGGTATCTTCTTAATAGAAGAAAGCAGCCGTATAATCAATAGCTAATTCTTGCCTTCTACACTCTAAGGGAGTGCAGGAG
GCGCTCTTTATCGTAGGCGCACCTCTGGCGCACCAAGTGCGCAGGACAGGCGCGACCCCGTTTCTACTTGGCCCGTGCGC
TAGCACGTGCTGTGGCCTGTGCGCAGACTACGCTACGCAGCCTGCGCCATAAGCACCGCTTCTAGTTTACAATGTGCATC
TAATACGCTGTGCGCATACTGCGTACGGCTTGCGCGTAGCCTGCGTCGGTCCTCTCCCTAGGGCAGCGTTACAATTGCTC
CCCTCTTGTGCCTAACTCCCCTAAGGCAGGTCTTGACGAAAGGCTTGCAACCTTTGTTCCTAGTGGTAGTGGTGCTTGTC
CGTTTGCGGCGGCCCCTTTATGCTTGCTAAGATCGCTGTTAAAGGCGACTTAAGGCGCCTTTAGTTCCCTTTATTTAAGA
GGTTAGTCCTGTAGTTAAATTAGATTATTGTAGGGTCTAGCATCCGGTTACTTCTTTTAGAAACAACAAATTCGTCTTTT
AGCAGCAATATAGCTGCTTCTAATTCTAACGTTCCTGTGCCCGCGGTAAGCGCCCCTAGCGCTCTAGTACCCGCTGCGGC
CCTAGCCTCTGCTCCCTAACACCCTTTGCCCTTTAGCTAAGGTGCTAGTTCCGGCCGCGCGCAACGTGCGCGCGGGGCTT
ACGCTAGCATAGTTCGTTGTTTAGCGCGGACTGCGGCGCGCGCCGTGCCCCTGGTTAGGCCTCTAGTAGCCTGTTAAGGT
GCGAGAGCTGCCCTTGCTAGTCCGGCGCTCCTAGGGTCGGTGGCGGCTGCGCTACTAGCTTACCCTTAGGTTGCCTTGGA
CGGCTTGTTGTGCGTGCGGTGCTTGCACCGCTTTCTAACGACTCTCTCTGCGGAGTTGCCTAGGTTTGCGGCCGTGCCGT
GTATTTACAGCGTCGCTGGCGCTAGGCGCTGCGACGGCTGCCGTGCTAGTAAGCACGAGTGTTGCGGGGTAAGTTCTCTT
TAGTGGCTATAGGCCGCTCTAGTAGCTAACAGAATGCAGGTTTTCCCGCTAATAGTTAGCAACTAGGCTAACTTTAAGAT
AGTGCTGCGCGGCCTTAATAAGAAGCTCTATAGCTAGGGTTCGCCCGTAGTGTGCGCGGCACTTACGCATGCTGTAGGTG
CTTTTGTCGCTACTTTATTATAAGTAAATAAGCAGCAGTAGCCTACGTTGCTAAGGGTGTTGTTAGCTGCTAACGTTACG
TAAGCGGAGCTTAATCTTTGCTAGGGCATTAAGGCCTAGAAGAAGGCTTAAGAGGTAGCCTACTAGGTAAAGGCTTAGCA
AGCTTTATTAGCTTAAATGTATTTGTTGTTGCTATATACACTCTTTTTGTCTTTGCCGCCTAGGCTTACTACTTTAACCC
TTTAGTAGCTCTCTTAGCTGCTACGCCTAATGCTTAGTAACACTAGTTATGCCGCCTTTACTATAGCCTTTAGTGCTTTT
CTTAAGGCGGTAGTAAGAGCGTATGTTATAGACAAAGCTTATACTAGGGTAGCGGCCGGCGTAGCGTTGCTTTAAAGGCT
TCTTAGATAGTTTTGCGTAGTCTTCTATAAGGCTTTTTAGCTAGTTAAATTAATTTAAGCTCTTGCCTATATATTTTTGT
CTTTATGCGCTTACTACGCATATACTGCTTAATTGCTATATACGCATTTTCTATATCTTCTTTTAGCACTTACTAGTTAT
ATTTAGTTAGCTAGCCTGTTTAACGTACTAGGTATTTAGTCTAGCTAGCCTTACGTCTCTTATCTAAGACTACTTTTACT
TCTTATTTATTATCTAAGTTTTTTAATACTAGCATTGTTAAAGGCGCTTATTCTATGCTTACCTTACTCTTCTAATGCTT
TAATAGCAAGACTAAGAAAACGTTATATAGTTAGCTATATTATTTTAGTAGTGCTAGTTAATATGCTTGTTTGCCTATAG
TCCTAAAGATTCTAAAAGGCTTAATGCGTCTTAGTGCTAACTTTTTGTTTTTTAAGCAAAGGTTTTTTATAGAAAGGCTT
ACTAGCTCTCTTACTATAAAGCTTATAAGCTAGTAGCGCGCATTATAGTAACGCTTCTAGCGCTTTATTATATACTTTTA
GTTTACTGCTAACCTTTTCTATATAGCTTCTAGTTTTTCTAAGCAATTATACACTACTAGGACTATGTTGCGCGTATTCT
GCTCCTTTTTTATAGTTGTGCCGCCCTTAAGGCAAGTTTGTAGGTTCAGTTTTTAACTATATAGCGCTTTAAATAGGCTA
ATTTTAGTTATTGCGTTAATAGCGTTATTATAGGCGTATTGCGCTAAAGATAACAAAGAAGGCTAATTTAATTGCTTTTT
TATTATAAAGTAGCGCAAGTACTACTCTAACGTTTAGTTAGATCTTTATATTTGCCTGTTTATCTAAGGGTAAAATGCGG
TTAATAGCTGCTTATAGATTCTAGTTTAATAGCAATATTTACTTTAGAATTTGCTAGTAAATATACTTCTTTAGTTAAAG
ACTATATTCTCTAGTGTTATGCTATATACTAGTTCTATATGTTAGTGCATAAGGTGCGTAAGGCCTTTGGCTATTAAGGT
AGTTTATATAGCAAAGAAAAAGTTTATTTTTATAAAGTAGTCGACAATTACTAGAATTGCATTTACTTTGCCGCTTATGC
TTACTTTAGCTACTAGTAGCCTAGTAATTAAGTCTATAAAGATTTCCTACTAAGGACTTTATAATAGCAGTAGTAGGTTT
AGCTTACTATATTACATATGCCGTTTAATTGTCTATCTTTAGCAGACTAGGTATAAGGTAATATAAGCCTTTACGTTCTT
CTTTATTTCTTCCTAGTAGAAGTAGCAACAAAGCAGTTTTAAAGTCCTAGCAACTATAAAGTGCTTAGAGATCTAGTTGT
TATAATAAAGCTATAGCAGCTCTTAACAAAGGGCGTATGCGCCGCCTATATACAGGCAGTTTTCCTATAGTAATATACTA
TCTAGTGCAAGGCTTTATAGCTTCGTCGCACCTCCTACGCTTATAGTGCGCTTTACGCGCGCCTTAACAACTTACACCTC
TAGGTTTACGTCCTAGATTCCTACTATTGCTTTATAAATAGCTTTAAGGACTCTGTTTTCTTAAAGGTATAGATGTAGGG
CAGCAACAATAGCTAGTTGCTATAGTAGGCTAGAGTATACTAGGTTCTTATCTACGCTCGTTAAAGGCGTTAGACCCTTA
ATTAGCGCTATAGTAGTAATATTCCTAAGGTCTCTTTAAAGTCTTTTATAGTCGTCTAGCCTTTCTAGTTTACTACGCTT
TGCCTACTTAGGTAGTACGCTGTTTTGCGCTGCGGTGGCTTGCTGTGTAAGATCTAGGGCTACTAAGATCTTAAAGGTAA
CGCTTAGCTTTTCTTCCCTACTAGGTCCTTTTATAAGTGCGCGCATCTTACGCGTCTTATTCGCATAAGCTACGTTGGTG
ACTAGCTTAGCGCTATTGTCTTCTATAATAAGTGCGCGTATCTTGCGCGTCTTTTGCGCTATAGCTATAGTGCTTGCTAA
CTATACGTCTTTCTTTTATACTCTAGTAATAGTTATTCTAACTTGTCTAGGTTTATTAAAGTAATCTAGCTGTCTTAACG
GCGTATTAGCTAGGTTTGTTACGCTTAGTCTATGCTTAATTATAAAGTTAAAGAAGGATAAGTATATAGCCTAGCAAGCC
TTATATTCGTTATACCTTAGCTAGGTTATAAAGGTGCGTAAGTTATTATAGTCTAATAAGACTTTAATCGTCTTTTTGCT
ACTATTAAGGTAGTATCGCTATTGCTTAAAGAAGTCTATAATTGCTAGTAGCTTTTAATCTAGAGTGCTATAATTTAGCT
CTAGTCCTTATAGTTTTCTTAACTAGAAGGCGATTAGGTGCTAGGCTCTCTCTTTGTCTTATTAAGAGATAATCCCGCTA
ATAGCTACCTTTAAGGCATTAGTCTCTATGTATATTGCCTATTCTAGGTTAAAATAGCGTAGCAAAGATGCTTTTATAAA
TGCCTCTCTTAGCATTGCGAAGGCTGCGCGCTCCTTGCTTCCTAGCTACACTAGTCCTAGCTTTTTGCTATTTTTGCTGC
CTTATAGCAGCCTTAACAAAGGAGATAAGATATTTAAGTAAGCTTTAATAAAGCAACGATAGAAGTTGTAGAATCTAAGG
AAGACTTGCACCTCCCTAAATGTTTATAGCGTTAGCCATTTTGCGATTGCGCGTACTCTGCGCAGGTCTATCGCAAACTC
TTTGCTTTTAATAATAAACCCTAGGAATTTAACTTCCTGTTAGTAAAACAAGCATTTATCGCTGTTAACAAATAACTAGG
CTTGCTAAAGACGTTTAAAAACCTAGTCTAGGTGCTTTGTATACTCCTCTTTGTTGCGTAAGAACATAAGGATATTGTCT
AAGTAGATAATATAGATTGTATTTACTAGACTATGCAGCGCTTAGCTAATATAGTACTAGAAGGTTGCTAGGGCGTTAGT
TAGCCTAAAAGGTAGGACTAAGTATTTAAAGAGACTATATCTAGTCTAAAAAGCTGTCTTTTATTCGTCTTCTTCTTTAA
TCCTTAGGCGGTAATACGCCTCCTTAATGTTAATTTTCGACATTACCTTTATTCTTACTACGCAGTCTATAATCTTAAAG
ATTAAGGGTAGTAAGTATTAGTTCTTTACTATAACCTTATTTAACCCTCTATAGTTAACGCATAAGCGTAAGCTTCTATC
CTTTTTAGGCATAAAAAAGAATAGGGGGCCCAATAAAGCTTTTTTAATAGGCAAATTTCCTTTCTATCGCTAGGGTAATT
GGGCTAAGAAACTAAAAATAACTCCTTTAAATTCTCTTTTTATAATAAAAAAAAATTTTATTTCTTATTAATAGAATATT
AACGTGGTTAAAAAAAAAAAATATATTTGGTATATTTTTGTAAACCTTTTTATATTCAAGAAAAAAAACCTTTTTAGGGT
TTAAAAAAAAAATTTTAAACCCGTGTTTTCTTTATTTCTCCTCGCCGCCCCAAAAAAACGGGCGCGGGGGGACGAGGCGC
GCCCTCTTAGTTTTCCTCTTTTTTTATAATAAAACACCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGGAAGGGAGAGAGATTTTGTTTTATTAAAGAGAGACGCCCCCCTACGTGAAGAAGAAAAGAAAAACTTTGTGTTTAACT
CTTTTCTGTGTTTCCCTTTACCCCCTTTACCCTTTTACCCCAAATAAAAAAAAAATTAACCCCGGATTTATTTTCTACAC
AAAAAATAAAAGAGGGGGGGCCCTTTTTTTTCTGGGGGGACTTTTTCCCCCCCTTGGACGGCCCAGGGTATAATGTTTAA
GTGTGAATTAAAGGTCTGGCCTTCTTAAGGTTTAAAAGGTAAGACCCGAGGCAAATTTTGGTTTTGGGTGGGGGAAAGTT
TATTTTTTTTAAAGGAAGGAACCCGTACTTTTAGGCCTATCTTGAGGAATGGAATAATCGTTTTTCCTTGTCTAATTTTA
TTACCCCCTTAGTTATTAAAGGCGGCAAGGTAGAAATGGGAGTGATAGAAGGTATGGCGGAGGCTTTTGAAGCCACCCCT
ATTCTTAAAGTCATAATAAAAGGCGTAATATTAAGCACTAGCAATAATGGTTATGGCCTTATCATAAAATCTATCTTAAT
CACCAAGGCCATAGCCTACTAAAATCTTTATTATGCTCGACCGTCGACGTTTTCTATATTGAGTAGCACTTTACTCTTAA
TATATTAAGCTAATAATTAGTTTAGTAGCAAGCGCTTATAAAAGTATTACTGGCTAGATATTAAATGTTCCTTAATCATC
CTATAGAATAGGTAGCTGCGCTATAAATAAGAGTTAGAGAGTGTATTAAGACTAGATATATGCTTCTTATCAAGATAGGA
TCTTATCAAGAATAACTATCTTAGTTAAATATCCTTATATAAGTACATAGTCCGTAAGCCTAGATTGATCCTAATTATTA
GAAATATTAATATAAGTAAGCTATTCGCCGCTTTAAACGCTTCGCTTTTCGCAAGTTATTATAGATAGCACTAAGGTTAA
AGTCATAATAGTCTAGAGTAATCGTATTAGTTATCATTAAAAGGCCTTCAACAGCATCGTTGTTATCTAGAAAAGGCTAA
TCATTGTAGTAGAGTATAAAGTAGTCATTTTCTACTTCATAAGTAGTAAGGTAAAGGGGGATCTAGCCTATCACCCTTGA
TCTGCTGTAATCTTGCGCCTTACGAGCGTTAGACGATAATATAGAAGTCATTCAAGGTTCCAATTATCCTTGTACCACTT
AGCTCGGGTAGCATAATAGAAGAAGAAATCGGATCTATTAAAGGTATACTTAGGTAGGCTAGGTAAGTTAGGCAGGCAAG
GAGGTATCTTCTTAATAGAAGAAAGCAGCCGTATAATCAATAGCTAATTCTTGCCTTCTACACTCTAAGGGAGTGCGGGA
GGCGCTCTTTATCGTAAGCGCACCTCTAGCGCACCAAGTGCGCAGGACAGGCGCGACCCCGTTTCTACTTGGCCCGTGCG
CTAGCACGTGCTGTGGCCTGTGCGCAGACTGCGCCACGCAGCCTGCGCCACCAGCACCGCTTCTAGTTCACGATGTGCAT
CTAATACGCTGTGCGCATACTGCGTACGGCTTGCGCGTAGCCTGCGTCGGTCCCCTTCCTGGGGCGGCGTTATACTAGCT
AACTAGCTAAATATTAGCAATTATATTCTATATTATCTTTAAGGCATCTTTTATTCTAAAAGCTCTATAAAGCATTTAAC
AAAAAGGTAGTTAAAAGCACTCTATCTAAGTCCGCCACCCTCTCTTTCGACTACCCCCTTCTTTTAACTAATAATTAGAT
TAATTTCACCCTCTTTATTACCCTGCCAATTAAAATGTAACGCACCTGCCGCAGCGCTAAAAACAGCTCTAGTTAGCTAA
TTTTTTATGCATCGTCTTTATAATGCCTGTTTATACGGAAAACAACCTAAATAACGCAAAAGAAAGCGTCGAAAACGGCC
TTAGTATACAAAAAGTAGCCGCCCTTTACTATATACCTTATACTACCCTTTAGTACCGTCTAGCAGGCACGTAGACGCGC
TAAAAGAGCGCAGAAAGGCAGTAGGTTCTTTTACTGCGCTTAGAAAATACCTTAGTGCACTAGATAAATATCTAGGCATA
GCTAAGGCTTGCTTCTACTTATAGCTAAATGCTTAGTATTACGTAGCTTTTACTAGCTATAGAAGGACGCCCTTAATAGC
TTAGAAAGTTATAGAAAACTAGGTTTTTTATAAAGCATCTAAAGATTAAGACCTTACGTAAGACCTTTATTAAAAATCTT
TATGCTAATAGTGCTTCTAAGTTAAATATACGCACGCTTTTTACTACCCTTTAATACTTAACTATTTATAACCTTTCTCT
TAAATACTAGTATAATATAAATAAGACTAGGCTTGCTAAAGTCCTTAGAGCAAATAGCTTAGTTATTAGTAGGGCTAAAA
AGAGCTTAAAGATTATAAAAGCAGTAAAAAGTTAAATTTAAGTAATAATATTTAAGTGCATTTTAGCTATTAGCAAAGCT
CTTCTTTCTTATATTATATTTACTAGCAAGTTAGTTTAGCAATAGTACTTTCTTACTTCTTTTAAAAAAATAATAATAAT
TAGTTCTTTATAGTAACTAACTTAGGCTAGACTAATAACAAACTTATAGTTAACTAGCTTATATCTATCTTTTTACCTTT
TACTAAGCTAAACAATATAAACTAGTAGTAGCTACTAGTTCTTAACAAATATAAAAGCTATATTACTAATAATTTTATAA
TTAAGTATATAAACAATAAGGTTTAGCTTATTATACTCCTTACTTACTCTTTCTACATTACCTAGCCTCTTAATATAAGC
TGCTTTTCGCTACTTAAGTTATAATACTAATTTTACCTCTTTAACCTCTTTAACCTTAATAATTTAAGCGCTACTTACAA
GTAAAACTCTATCTATTATTACTTAAAGGCTAAACAAGACGCCTTAACAAAAACAAATATTAAAAGCGGTTAGAAAGCTA
TAAGACTATAGCTAATATCTTTACACTAAGTGCTTTTAAATCCGTTCGTTTTACCATAAGCGCCATGCACTCTAGCCACG
CTAAAGGCTCCTAATGCACTTTATACAACTCCTCTACGCTATACTTAATCTAGCGATATCGTTTTTAATACGCCATCTAC
TAGTTAGGAGATGCTATAGCGGATTGCGTTAATAAAGGAAAAGAGTAATTTAAATAAGTCTACGCAGCGCCTCCTTCACA
AAGCCAGCCACGCAATTAATTCAAAAACAGCTACAATAGCCTTTCAGAAGCAGCGAATTAACGAGCTAAAGGCATTACAA
TCGGCGCAAAAGGTTAGTAAGCGCCGTAAAGTAAAGCTTGCGCCGAATAAGCGGTTTGTACCAATTCGAGAGGTTGTGGC
GGTTAGAGAGCGCGTTGCAAGGGAGATTCAACCGGAAAACACGGCTAGGGAGATGCAGGCGGAGTCTATGAACAGATTCA
TGCACGTTTTTCATTATGTAACTGGTGAAGAAGTCCAGGAAGACTGAATAAAAGATGTGCGTGGATTGAGCAATTATTGG
TCGAAAGGGGGGGTGGCGGACTTAAGCAAAAAATAAAAGTATTAAAGGCAACAATTAAAAGCCTACAGCCTTAGAAAAGG
AAGGCTGTGGCTATAAGCCTAAATTTAAAATTCGCTACAATCAAGGACATACAGAATAGCTAGGCCGCCATAGGAAGAGA
AGTAATTGAAGTGGGCGATAGCTCTGAAGGAGAACTTTCAGATGATATATAATTTGCATGATTTGGTTAGGTATTTCAAT
TGCTATAATTGTTTTTGTTTTTGTATTTTTTTTTATGCTATTAAATTATCACGATTTTTGGGTGGCCCAAATGGGGGGGT
GGCCCAAATCCCCATGGTCCCACTTACTCCGTACAAAGTACAAAGTACGCATTTTCTAGTATTGAACCTGCTCGCTCTGT
TCGCAGCATTCCTTATTTTTTCCTTCAATGAGTTGCTAAGTCGAATCCGTCACCGCAACTTTTGATGATTTGGACAGGCT
CCCGATGCCAAAAACAGTCACTTGATTAGTGCACTGGCTGCTGGCGCGGCAGCGCTGCCCGTGCTTCCATTTATCTGCGG
TCAACGTTCTGTTGGCCTTGACTACAAATTGGAGCGACGTTTAGCAAAGCGCTTTCTAAAATAGCTTCATCATTAGCTGA
AGGACGAGAAAATTGTCGGAGGGGCAAGGACTGTGCATCTTCAAGATTGGTTGTTAAAAATCATTATCTCGTTTGTAGGA
TGTAAGTAGCTCAACAGGATGATAACTTACAATGCTTTGCACAGCAGACAAGATTCATTAATCATCCGGTGCCCTATGTT
CTGCCATGTATGGAACTTTTCGCTGTATAGCTCAGTCGACGGATGCTATTTCATCTCTCCCCAATAAGACGATATATCGA
TGACGCAAATGTGACAGAAACGATACACGCCAAGCAAAGGTGACAGCGCATTTACACCGTCCAGGCTAGTCCTTCCAGAA
TGTTAATCTCGTGCAATTTCTGCCAAGAGATAACACTTTCGGGGCTTTCCGCAAGAGGAGGCAAGAAGATGGAAGACTCG
TCGAGTAGCAAGAGCAGGACTGCAGATGCTACGCTTTTCAACCTAAATCTTTCATACTCTGGGCTCGCTTTGTTCTTCTT
CGCTTTGCGATCACACCCTTTTTGACACAAGCCCAGCCATCTATCCACCATGGCTAGCTTCCAGCACGACGATAGCCCGC
AGAGGAAGAGCGACACCAATGTTGCTATAACGCTGGACGAAATTGTGCACCGCGAGCGCGATTTGGGTTTCGTCGATGCT
GTCAAATTGTATCCGGCCGCTGTAGTTTGGTCAATGTTCGTATCCATTGGCGTGGTGATGCTGGCGTTTGATCCACAGCT
TCTAGGCAACTTTTTTGCGATGCCGCAATTTCAAAAAGCTTTCGGCTATCTGTACAATGGTGAAGTTAGCTTACCCGTTT
GGCGCTCTTTATTACGACTGCTTTTGGCTACATTTTTAAAGCACGGACTGATCAAGCATTGTGTATCTCCTGGTTCAGTA
CATCATCAGTCAGTTGACTTCCCTATTTCTGTCGCTTACGGATTCCTTCTCTGACGCGTTTTCCCTGGTAGGTGCTGCAT
GGCAAAGTGGCCTCTCGATGGGCAATCCTATCGGCCAAGTCATCGGCCCTCTGGTTGCCGGCTATCCCATGGACAAGTTC
GGTCCTAGAAGAACTTTTGGTGCTTGCGTACTGCTGACCGCAGGGCTTGTCTTTATCCAGTTCTTCGCCCGTTCGTTGAC
GGCGCTCCTGGTGGGGGAACTTCTCAGCGGTCTCGTCCTCGGCTGTTACGTTGTCATAGCCCCAGCGTACGCCTCGGAGG
TCTGTCCAATGGCCCTGCGCGGCCATCTCACTTCCTTCGTTAACCTTTGCTTCGTCATTGGCCAGCTTCTTGCCAACGGC
ATCACCACCAGCACTAGCCAGCTGGATAACCACTGGGCCTACTCTATCCCCTTTGCACTGCAGTGGTTCTGGGTGCTCAT
CATCCTGCCGGGCATAATCTTCATTCCCGAAAGTCCTTGGTGGCTTGTTCGCTGCGGCCGCATGGCCGATGCCGAGTGTG
CCTTGCGCCAGCTAACCTCTCTCTCGTCGTCTTCGTCTAGACGTCACACCAACGATGTTGACGTTGCAGCTGCCCTGGCT
GCCATTGCCGAGACCGACCGTCTTGAGCAGGAGCTAGAGGCTGGTAGCACCTACTACGACTGCTTCCGCGGCGCTAATTT
GCGTCGTACCGAGATTGCCGTCGGCGTCTACTGCGCCCAGGTCCTCAGTGGGACTTACCTTGTCAACTACGGAACGTACT
TCTTCACTCTGGCGGGCCTGCCGACCAACCGTGCCTTTGACATGGGCATAGGATTCCTAGGTAAGTCCTGCCAGTTGTCG
TTAAATCAGCCTTCTTCTCTCCCCCAAAGTGTTTGTTATCCGTCGCTTGAGCTGACGGCCGACAGCGGTCGGCTTTGTGT
CCACCATTCTTTCTTGGTTTCTTCTTGCTCACTGGGGTCGCCGCACGATCTTCCTTGGTGGCTTGATTGCCCTGGCCGTG
CTTATGCTGGTCATCGGAATCCTTGATTGCGTTCCTGGTCGGCCTCACGGCGTCGCCTGGGCCGAGTCCTCTCTCATGCT
GATATGGAATTTTGCCTATGACCTAACTATTGGTCCGGTGTGTTTCGTCATTATATCCGAGTGCTCGGCCACCCGTGTCC
GTTCCAAAAGCATCTCTGTCTGTACTGCCGCCCAAGCAGTCCTGGGTATTGTGATGACTGTGGCCATCCCCTACATGATC
AACCCAGACGAGGCTAACATGCAGGGAAAACTCGGCTTCTTCTTTGGTGGCCTGGCCTTCCTCTGTCTGATTTGGACCTA
TTTTCGCGTACCTGAAACTGCCGGTCGAACCTATGAGGAGTTGGACATTCTCTTTGATCGCCGTGTTCCAGCGTGGCAGT
TCAAGGATTACCAGATCAACCGGCCTGAAGATGCCGAAGCTTTGTGAAGGTCAAGTTTAGCCTATTATATTACCGTAACG
TTTGCTCTTCAATATCCGGTTGAGTGTCTCCCAGAATACCCCATGTCTTGACAGAAGTATATCCTCTCGGCTTGCATAGA
TTGTCGACTATGAATGTAGGCAGTCTGCCAACGTATCAAGTCTGTTAAGTCTGTTAGCACAAAGTACATAATTGTTTGAT
TGAACACCACTACCCGCTTCTCTTCCGAGCTGTCTGGCAATTCGGCCGCCTCAGTTAATTATTGTGGTATAATCGTTTAT
CGGTTTCACGCAGCTGAAACACGCCTTTTTATGCGATTTAAGATGCTTCCCAGGCCATGGCTACTAAGAGTCTATGGGAG
ATAAGTGAGCGACTTTTGCATTGTTCGACTTTTTTCTCTATCTGCGTCTACATGCTATAATCTGAAGGGGCCTCTTTTCT
CTTTCCCCTCGCCGTGTTTGACAGATCACTATAGCCTCACTCTCAAGACCGCACTTGTTCAACCTCATCGATGATGGGAT
TTTTGGCCAATTTCCGCTTCTGCGCCTGGTAGAAGGTGCTCATGCGGTATCTGCTCTCACCATCCAGTGGCTTCAAGGCA
AGCAAAGCTTCCCTGCCTTCGCGCTCGATCGTCGCACCGATCTCAAGCGTCCGCGGCTGAGTATCGCAGCGGAAGGGCTG
TGGGCGCATGTTCAGGCCGTTGGTAAAGGCGAAGATGTCGACATCGATATCAAGGTCACTGTTGGGATCGCGGGCTTTTT
GGATGGTAAAGGCCCATAGCAGACGGGCGACGGCGATCCAGACGCCTTGCTCTGCGAGGGCCTGACCGCTTCAGACAAGG
CGGCCCCAGCCAAAGGTCATGTAGTCGCGATCGTTAGGAAAGGGACGGTGGTGCTCGTTCTCGGGAAAGAAGCGGTCAGG
AAGGAAGCGGTCAGGCTCGGGATATTCCCGTTCGTGGTGATGGATGGCCCTGATATTTCCCGGGACCCATGCGCCTTCGG
AAATCAATCAGCCGTGGTGATGGTCATCCTGGGTTGGTGAGTGCGGCTGGCCGCCGATGATGGCAACGGAACGCCATCAG
AAGACTTCCTTGAGAAAAGCGCCCACGTACGGCAGTTTGTCGGAGTCATCCCAATCAGGAGAGCGGCTGCTGCCAAAAAC
ACGGTCCAGCTCGGCCTGTGCCCGCCTCATGGGCTCGGGAAAGGCGCAGCAGGCTAGGACAAAGGTGACAAGCGTGCTCG
AGGTGGTGTCAGAGCAAGTGCCGAAGAGACTTCCCGTCAAACTAGAGAGCTCCTCTGTCGCCAAGTCGTATTTGAGGGCC
TCGGTGAAGAGGGCATCTGCAAAGGGGCGCGGGATGCCGACCTTGTCCTCGGTCGGTTCGGCTGACTGCTGCTCGACGGC
CTCCTGGGCGAGCAAGTGGAAGAAGTAATGGCCTCCCTTCTGGTTGCGATTCCTGATGCCACGCATCCACGGGACCCAGC
GCTGGAAGCGGGCCAGGATGGGAAAGGTCTCCATGGGCATGGAGACAGATCTTCCGGGCACGTTGAGGTCGGCGGCGAGC
TGCATCAGGGCAAATGACCTCGGTGATGGGATCGTCAAAGCGGGCACACGACGACCAAAGACGAGCACAGACACAACGCT
GGTGGCATGACGCTCCAGGTGGCGAACAAATGCGGCTGGCTCGCAGAGGAATTCGAGTGCCACAGCCTTGCTTACGTTGT
TCTGTACGTTACGGTAGCGGCGGACGGCCTGCACGCCTACACCGAGGTGCATCAGTTTGCGGTGGATGCGCCAATGGTCT
CGTTCGGCAGCTGAGCGCACCCGCATCGTCACCAGGTTCGTCTGACCGGTACCGAGCTCGCCAAAGACCACCATACGCGG
GCGTGACGCATACACCTGTGCCTTCTTTTCTAGTATCTCATGCGCACACCAGGCATCGTTGATCTAGACCGTCGGGTTGC
GCCCAATCCAAAACGTGATCAGCGGCGCATCTTACCGTCTCGATAACGACTCGAAGAAGATCCACGGCTTGTTCGCCGGT
AGTGAAAACGTTGCCCACCACAGGCCACGGAAATGGGCCCAGTGGCATGCGCCACCGCAGGTTTAGCATGCGCCACCGCA
GGTTTAGCATGCGCCATAGTTGATAGCCAGGGCCTTGAGTGCAGCCGCAAGCAGTGCCAGCAGCACGTTTCTGGCTTCAA
ACTCTCTGGCGCCAAACTCGATGAGCGCCTGCTGCAACTTCACCCAGCCCAACTGGTCAACCACACAGTCTGCAAACATG
GCTACCGGTCTTTGGCTGTGATTTTCTGTGTTTGTTTGTCTAGTTGGGTGTCTGATGTTTGGCACTGCACTCCATACTCC
AACTTCCTGAAGCGAGTCTTCGGTCCTAGCAACCTAATTTTTAATGCCAGATTTGCATTTTGTTGCCGTGCTGCCATCTA
GTTAGCTCTTTCCCAGGTTAGCATTGCCAGTGTCTCTCTTGGTATCTTCCCTGACGGGTTCCTCGATTTTACCCCTTCTC
TGTCCACAGAAGCAGCAGTGCAAGCGTAACTCTAAATGGCTGGGATAGAATCTACTCAGCATAAAGGTACCGAGAACTCT
AGATCTCCCACAAGCTTCCGCGAGTTCGTTAGACTCGTCTTGACACTAGCGGGCCATGCTATTCAGCCTGCCTGTGGGTT
TGTCAAATTGAAGACCCAGCAACCCCGCACAACAACTATTAGCTTTTCCCCAGACAAGGCGTCGATCCCGCTCCACCCAA
AATGCGGAGATGAAATGCTGCAGCAACTGGTCTCATGTATTGGCAGTTACGCCCGCCGTACTCCGTACTCCGCACGATAA
AAGAAACCCTCCATTTGCTCCACCTTCATGTGTCCACGTGTAGTGACCTGTCAGTTCTCTGTATGGGCCCATCATACGTC
GTAGAAAGGCAGCCTCATTTTCAAGCTTTCTGTCCCACCGGACCCACCTATAATAGTATGTGCGTGTTTACGAACAAGCA
GTGCCAGAGAACTGGTTTTACGGCAATCTCCTTGATTCCGTCGCCCTATACTTCAGGGGCTCAGCTTGGTATTTATCGCC
TAATATCAAGGTATTTCGGGTGGTAAGCGTCTCGAGAACCTGCTCGTACAAAATAAGGTAGGCACCCGTTTTCAGGTGTA
CGAGATACTCCTCGGCCGTAGTTTTGATATCAGACAACTGAATGCTTGGCAGATGCACCCCTCTTCTCCCTTCCTCAGCT
TCCTCGAAGGTGGAGCTACTGTAAGAGAATGGGCCAGAGGATCTATGTCCCGGCCTCCTTTCCTCTTTCATTTCCTCCCT
TCAGGGCTCACCTTCTTGTGTCTGTATATCATGCTTCCGAGATTGCTTGAAATATTATATATACATACACTACTATACCC
AAAGGAATACAGCTAAGATCATTCATGTCCACATCCGTTTTTGAGCCTACCCTTTCCAGTAGCAGACTTGAGGTCAAAAC
CCCTTTCTGTCGCGGAAAGAGGCCGCCAGAAAACTTATCTGATGAAGAAAGATTGGATCTTCATTTAGAACCACTGGAAA
TTTCTAGCCGCTTGCACACTAGTTTTCATGTGTCCGTTTCAGTATGGTATTGACTTTGGTCTGATTGCCGGTCTTTAGGC
CATGGACGGCTTCCTCGAGGTGAGTTTGGCCCTTTCTTATAAAGTTCCGCTCAATAGCGGTTGTCACCTTCTCATCATTT
GAGTGTTTGGTTATAAGGACCCTTCGGTACCATCAGCTTTAGAACATCCCGACAGAGCGCCAGCAGCTAAGCTCATCGTC
GATGACGCTGGGTGCTTTCTCAGCTCCTATGCCGCTGGACAGATTGCCGCATACCTCAGCCGTCGTGCTTCTATCTGGGC
AGTAACTGTTCCTTGCTGTGTCGTCCACATCATCATGATGGCGACGGCTAACATTGGCGGGCTGCATGCTAGACGTCTTC
TGATCGGACTTGCCAACAACATGCTCATGACGTCTCTCAACTGCACATTTAGGCCAGACTGTCCTACGCAGTTAAATACA
AACTTCATCCTCTAAAAGTTGCTGCCGTAGTGCTCCCTGGCCCTAAACCGAGGCCTCATGATCTCTGCGTTTGAAATATC
GACATCAATCGGCACTCTTATCGGTACTATTGCCAATAAGTACATTAACTCCTCTGCAGGAGTGGAAATCGTACCTCATA
CCTCTGAGTGTTATCTATGTCATGCCTGTGCTCCCTCTTCTTTGAGTTTTATTTGAAAACTGATTCGCCGCGCTGGCTGA
TACAACACGGGAAAGTTGAACAGGCCCGGAAGTTTTTGCTTTGGCACCGCCCATATTCCAATTTTAAAGTCGACCAAGAG
GCCAACGAGATTCGAAAGCCTAACAACTGGAAATGGCCCTGAACCAGGGTGCCGGGTTATTGAGTTAGAGACCTCATTAG
TCTACGTCGCACTCTGCTCGCAATTGCAGTCTTGAGTACATAAGGAGGGTTGAGTGCCATGTGAAGATCACACCTTTCTA
AGTATAATAACTCATATTTAATCGGGGTGTTTGATAGGTGAGTCTTTCCTCAGATCAATCACTTCGTACTTCTTGCTCGA
CCTCTGATGGACATCGTGATGGAGAGCCTACGGAATATGCTTTTTCAAAGTGGCCAAAATTGATAAACCGATGTAGAGTT
CCTGCAATCTCACTGCCGTCGGTGTCTTGGCTATTGCCCTCAACCCGATCGTTACCTGGGTAGGCCAAGGCGCGTATCTT
ACCAGTGGCCTCACCACCTGCGGCATCTCCCAGCTACTTGCAGCAGTCGTTTGGACCGTCAAACCTGGGTCTCAAGACAC
AGGAAAATAAGTTGTTTCGCTTTCACTTGGGTACATATGGGAATACAATGTAAGCCTTAACTCGTCGCAACCCGTGTCTG
CTTCAGTCTAGGCCGTACTGCTTTGAAAAACAGACTGAACTTTCTTGTGCTATTTAAAGGGCTGGTTGCTGCATATGATG
TCGGGTGGCGAGCTTCCTTCACAATGCCTCCGATCGTACAAATTCTGGCTGGCAAATGCCGCTGGATTTCTCTTGCGTGG
CTCGTTTCTTTCTATAGCTCTGAATTTTATTAACGGCTCGTCTCTTGACTGGGGGCCTAGATGTGGCCACATCTGGTTCC
CCTCCTGCATTATTTTAGCGTAGGCTTTTTGGAGGTTTCGCTTCACCCTGCAAAAAGAGCACGTCGTAAGAGGCAGCTGT
AAGAGGTATGTGACAAGGCAATCCAGGGAATCTGTACCAGGTATACAGGTACCATGCAAGCTCGCAGATCGTGGGCTATG
AGCAATACTTTTCAGAGCCGCCAATATCGGGATAGCTACCAGCGCCGTCTAGCTCCTGGTGCTAAAATTTTTCCCTAGTT
CCAAATAATGGCGCGCAGACCACCGAGATGTGCAACTCGTTTACAACCACAATGCGAATGGCACACTGCTGCAACACAAG
TATACTGTTATTTGCACAGAATTGAGCCCTCCACAATGCGTGTGTTCTCGAACGTCCAGACGTTGAGAATGAAAGGCAAG
AAAGCAGAAGCATGGTGTAGTTACCGACATACCAGCGAAAGCAGCGTAATGTCTTTGCACAGGTATAGGCCGCCGCTGAT
TTGCATCAAGTCTATGTTATGAATCTGGCGCCTTTTCACATACAGACGGAGGAATCTGGGACACGAAATCCCAAGGTACC
TGGCCGGCTACCAGAAGTACTGCGTAGTGGCCGCCCTGCATGGTCTCCGTGTAATATTTTTTCTGATACGCTTGCGGTAG
TACCACACACGATATCGTAATTGTATCTGGCCAACAGTGATGACGAGAACACATGCGGTAGCGGACTTCGGGTGGCAGCC
GGAGGAAGGGCGATATCTCACTGAAGCCACATATGAATATGACAGTCCGGTGTAGGGTCGCCGTGGCTGTTGTGCATCGT
GCGGTCTAGAGATGTTAGGTTGTGTTCGTATATTTGTTTTTTGATGATGGCGAGCTCGAAGCCTTGTTTCAGAACCGTCT
GGAGCCTGCCACCACGGCGATAGCACGCGCGAAATTTGACTGCTTTACAACATCAGCAGCCTTAAAATATGCACCCCGCC
AAGCTCTTCGAGCCCGCAGAGATGAACAGGTTTGGCCCTGCACAAGGCCTGGAAGGCTAGTGTCAAGTTGTTGTGGAGGC
CGTCAAGGTGTCTAGTAATCGTCATCGCCTGGTTCGGCCGGCGGACATAAAAGACAGACCTTTTTTTGCGTTGTGCGAGT
GGGAACTCGGTTTCCAATAGGCTACTTGCTAAGCTATACACTACGTACCAGGCTATCGCAAGATATATTGTCCGCCTAGC
TACGTCATATATGAAAACGTCACTAGCACGAAATACGGGTACGAGTACTACCAGAACTTTGAAGATGCACAGTACTCTGA
TCTCGTAGATGGTAATATACGGAGCAGCTTGTAAGATAATTGTAAGATACTCCGTACTCCACTTCGTACGGAGTATTACG
CAGTAAGATACATAGTAGGAAACAAGAAGGTTCTAAAGGGTGGGCCCAAATACTGTACGGAGTGCTCCCACCCAATCGAT
GGCGTAATATCTTAATTACGTACTCCGTACGGAGTACTCCGTGCTGCCCAGCCCAGGCGGCTATTAGAACTACTCCGTAA
AGAAACCCCACCTGTCAACATCGCATCTCTTGATTTTCATCACCTACAACAACTTGTTCTTTGCGCTTGCTTACAGGCCG
CCATTTTGGACACTTATTTTGGAAAACTCGTCGTGGCTACGTGCAATATGGACGACCAGTTTGGAGGCCGAACCGATGAC
GCTTTGTTTGCCGACGATTTTGAGCCTGTCGAGACAGCAGTAACTAGAGCCAGTTCTTTAGCCAAGACTGTCAAGCCAGA
CGCCACCCCGAAGCCGACCACGCCTCTTGCCCTGGACGCCAAACCGGACCTGAAGGCTGTGACTGCCAAGGTTGTGCCGA
TCAAGGCAGCTAACACCAAAGCGGCACCCAGCAAGGCTGTGCCCAGCAAGGCTGCGCCGGCGAAGTCCAGCCCAGCAAAG
ACAGCTCAGGCGAAGGCTGCCCCTTCCAAACGCAACGTGCTCGCGAAGACGAAGAACCTGCCTGCATCGCATGCTTTTGT
GGGGACAGATGCGAAGCAGCCGTCTTTGCCAATCTCAGAGCAGCAGGGAGTCGCTCCCCCACCCTCACTCGCCCAATCAC
GGCATAACAACAACCCTGTCAGCTCGCCTCGGCCGAGCGCCATCGGCCGCCCGGGTGGAAAGACCCCGAATGGCAAATCC
GAAAAGGCCCGAAAGAGCGAAAAGACAGGGATAGCAGAGAAAGGCGAGAAGGGCAGGAAGGACACGAAGGACGATAAGGG
CGAAAAGAAAAAGGACGAGGACGACGCCAACGATGACACCAAAGCCGAAGCGAGCATAGAGATTGACGGCAGAGTCAATG
GAAACACGCCAAACGGCGCAAAGCAGAATGAATCAAAGCCGGCAGCGGCACCGAAGCCGACGGGAAAGCCCGGGGAGGGC
AACATGCGACTACAGTCAGGCGCAAACCCGCGTGCAAAGCTGACGGACGCCGAGCTCAACGCGAAAATGGAGGCTATGCG
CATCGCGTCAGCGGAGAAGGCGCGGCGGTTTGAGCAGGCGCAGCGTGACGAGCGCGCCCACGAGATCGCGTTTACACGGG
GCATGGAGGAGGCACGCCGCCGCAAGGCTGTCGAGGAGGATAAGCGGCGCCGCAACGAAGAGGACCGGCGCCGCATGGAT
GAGGAGCGTGAACGCAACCGCGACCGGAAGCTCAAGGCGATGGGAATGAAGGAGAGCAGCTGGGACGAGGGCAAGGAGGC
GCATGTTGACGATGACCAGCGGCATCGGGGCAACGGTTTCCGTGGCGCACACGGTGGCATGCGCGGATCCAGACATGCGG
GTGGAATACCTCCCGTTGCCAACATCAACGCCCTGGGCGACAGCGCCGCCGCCTCAGCAGCTGAGCCCAGGGTGCTCCAG
CCGGGAGAATTCCGTGGCCGGGGCCGAGGTCGAGCACGGGGACGTGGCATAGGCCGCAACAGCGGCGGTCGCGGAGGTGG
CGGACGGGTGGCGTTTGACGACGTGTACGGCAACGGTGCCGGTGTGGCAGAGTGGGTGCAGGGACAGCCTGACCCGTCCG
TCATGGCCCCCCCCGGGTCCTCTGCGCCCGAGCTGTCCGTCGAGGAATTTCCTGCTCTACCAGGCAGCAATGCCGAGGGT
ACCAAGGAGCCAGCTGCGCCTGTTGCTACCATTGCCGCCCTTGCCGCTACCTCCATCATTCCGCCGCTCGAGCCGGCCTT
GGGGACGTGGGATGAAGAAGTCGCCGCCATCGATGCAGAACTGGCCGCTGCCGCAAAAAACGGCCAGTAGCGCGAGCAGA
TTGTAGAACCGGTTGGTTCTCCCGGTCCTGGTTACAGATTTTCGAGTCACAACTTTGGTAATATCGTATACCCAGAAATA
AAACTGCAAAGATACAACATCCGTATTCCCCTAGCCGCCAAAACTCCGTTCGATGCCAAACGCGGTCAATATTGCATAGA
AATGACGAAAAGTATAGGGGGTGCAGGCGGTATGAAATAGCACCACCTCACCACCGGGGCCTGTTCCTGGTCCTTCCGCC
ACCACCCCGTGGACCTCGTGACCGCCCCCAAGCACCGTCTCCATAGCCGCTCCCGGGTCCTGGCGGCGCGCCCCCGTCAT
CACCGTCGGCACCTACGGGTGGACGGCCCTTGAAGCGCAGCTCTTTGGAGAGGGCATCGTACGTCTTGCGCATTTGCGCA
TACCCCAGATGCATCTTTCCGTAAAAGTGGTCCGCCAGCCGGCGGTCATTGTCCAGCCGACTCAAGTATGCACCGCACAC
GTCGCACACCTGCAGTTTCTGGTGGCCCGACGGGCCGCTAGTGTCGCTCAGGGCCTTGAGCTCCTTCTCTCGCTCTGCCT
TGGCTTGCGTCGCTTGCTTGACGCGGAAGAACTCGTCCATACCGGGACCGATGAGACCGGCCTCACCGAGCACCTCCACC
TCGACGAGACCGTTGGCGATGGTGCTCTTCAGATCGCTGATCGTCTTCAGCAGCTGATTCGTCTGGCGAATCTCGTCCGG
CGTCTTCTCCAGCCGGCGCTGCGCCGCCTCTATGCGCCGGTTGCAATCTTCAATGTACTTTTGTAGGTCGCGCATGTAGT
CGTAGTCGAAGCCGTGCTTAGCCCGCTCGCTCGGCGACAGCGCCTCGTACTCCTCTTTCAGCGCGTCTGAATGTACCTTT
GGGCACAGTCCGAGGTCTTGTTTGGTGTTTGTGAACAGGTCGTGGGGACACGTGCCGGCGATGTGGGACCGGCATACCTT
TGGGTCATTCAGGGAGAGCTGTGTGCTGCGAGAGCTTATGCCGCCGCCCATAAGTTGCTCTGGAGACGTTTAGCAGACAT
GCCGATGTATGCGGGAGGCAAAGAGAGGTCACCTACCCAAGAGCTTTCGCTGCTCGGCCGCCATGATTTCGCAGTGGTGT
CTGGGAAGAGTGTCTTCTTGCAGGCGCTTCTCTTCAAAACAAGAGTTTGTGGAGAAGATTGAGGATGTGCACCGTTGGGA
CGTGCGATTGTGAGATTTGTTGTGTCCACCAGTGAAAAGACGCGGCGAAATTTTGAAACTGTGATAGCGCGCTGTGCCTC
AGGACAATGTCCCCGTCCTCCAGCCGTAATAGCAGTAAGGCCGATGAGCGCATGAGTCACGCAGCCAATCAGAGGTGGTG
TGGCGTCCAGCGGGTCCATGCTGGCTCCACGACCCGACCCATGAAAATAACACCTCTACTTCCATCACGCGCGACAAAGC
AATCTACTCCCAGCGTCCTCCATGGAGCGCAAACTCTAAAATGCGGCTTTTTCTTGGGATTCTGGCTGGCTTCACATGTT
TTTCCGTGCTTGCCTCTGCCACAGACTACCATGAACAGCTTTTGCTTCAACCGCTACCTCTATCGGCGCTCTTAGCGAGC
TTTAACTTCCGGTCCAATATATCTGTCTCCGAATTCGAAGCACACAACTTTCAATTTTTTCCTCGCTCCCTGGGCCAGAT
TCTCCAGTTCGCGGGCACAAGGGAACTCCACCTGCGCTTCAGCCTCGGGCGCTGGGATGCCGAAAATTGGGGCGCCCGGC
CGTGGGCCGGAACCAGAGAAGGAGGCACGGGGGTCGAGCTCTGGGCTTGGCTTGATGCCGAGACGGACGAGCAGTAAGTC
GTGTGGCCGGGTCAGTCGTCAAGCTACTAACATCCATCTTTTGTTGCAGAGCGGATACAAAGTGGCTTACGCTGACAAAC
GCTCTTTCCGGCCTCTTCTGCGCCTCGCTCAACTTTATCGACGGAACTCGGACGACGCGACCGGTCATGTCCTTTCGGCC
AGAGGGTGACCATCCGGACGGAACGATTTCGAACATGCAGCTACTATATGGTACGCTGCCGCGAGAGGTTGTCTGCACAG
AGAATCTCACACCGTTTTTGAAGCTGCTGCCTTGCAAAGGAAAAGCTGGGATTGCATCGCTGCTGGACGGGCACAAGCTG
TTCGATGCATCGTGGCAAAGCATGGCCATAGATGTTCGGCCGATATGCCTAGAGTCCGAAGGGGGCAACTGCGTGCTGCA
GATTGAGCAGACCATTGACATGGTGTTGGACATCGAACGGTCGAAGCGACCCCGAGGTAGGTTTCTGCCAAACCTGCGCA
AGGCTGCTGGCTGATCTCGGTGGTAGACAATCCGATTCCTAGGCCAGTGCCGGCAAACGAGCTGAAGTGCGACGCCTCCA
AGCCATACCACCGGGATGGTACCTGCTTCCCCACCAGCTTCGACGCCAACCAAGGCTGGTCGCTCTCACAGATCTTTGGC
AAGTCGATGAAGGGCACCTGTCCCCTAGCCGATATCGACACGCCGCCCGTCTGCATTGCCGTTCCCGGTTCCAGGAGTGT
GTTCTTGTCTGAAGGCGTATCAGAGAGCAGGAACGCCGACAGCCAATTACGATGCTACCACATCAAACCGGCGACTGAAT
TCGAAATTGCGCTTCCCGACGACGAAGATAAAATCCGACAGGGCATAGACATCATCCTGACGCCAGAGACGCCACTGCTA
TATGCCGAGCGCAGCTTGACCGGACACGGGGCCGACAGAGGCGGGGTACAAACCATTTTAACCAACCCGAGCACAAATGC
AGAGGTCGACTTTGTGTACATGGAGTCGCTCCCGTGGTTCATGCGCATTTACCTGCACACCCTGGAGGCGCGTATTGACG
GAAGCCCTCCTGGTAGCAAGGACGAAATCATCCAGGAGATATTTTACCGTCCAGCCCTGGACCGGGCTCGTGGCACCCAG
CTTGAGGTGAAGATGCGGGTTCCCCCCAACGCAACGGTTTTCTTGACGTATGACTTTGAAAAGTCCATCCTGCGGTATAC
GGAATACCCGCCTGACGCTAATCGCGGGTTTGACGTGGCTGCTGCGGCCATAACGATTTTGCAGCCACGGCCTAGCGGGA
CAGCCAGCAGGTTCGCGACGTCGAACCTCCGGACAACCACGATGCTGCTGAGCCTGCCAACTCCCGACTTCAGCATGCCG
TACAACGTTATTATCTTTACGTCGACGGCCATTGCTCTGGCCTTTGGTGGCATGTTCAACATTCTCGTCCGTAGGTTTGT
CGCAGCTGACGAAGGTCCAAACGTCAGCCTGCAATCGCTACTCGCCAAGCTCGTAGGTCAGTTCAAGAAAGCGATAATGC
CGAAGAGGACAGCTCCAGGGGCGGACAAGCCGGCCTCGGCAGCCCTGGCAGCTACGGCTACGGAGTATGGCGGACAAACA
TGAGTAGAGTCGATTTTGATATCATGTTATATATACACTCATACCATGTGTTGCATGCAAATGCATGCTTTGGCCTAAGC
TGACATTAAAAAAGTATAAACCAACGGTTACGTTCCTCTAACTCTTTACTAACACGAGCTGGCGAGAAGTTGAGGAGTAA
ACAGCCCGGAAAGAGTGCACGCCACAGAAACTGTATTTCTGCCAATCTACATGCATCAGCACACAGACGTAGTCATAATC
CAGGCTACCCCAATAGCAGCAACAGCCATACAATCCGAAATATTCCACCGAAAACAAAGAACAATAGGGGAGAACCATCC
AGAATGAAGGTATGACTAACAGCAGCATGGACAACATAACAAGAGGCCGCTTCGTGCTAGACAGTCTCAGACCAGATGGG
CAGGAAGATAAAGATCAGCACGCCTATGAAGGCAAAGAATGCGCCAAAGAGCAGACTCTGGACGACGATGCGATGCTGGA
GGCGACGCAGATGCGTGTCGGCGACGCGCAGCTTCCGGTCGAATATCATGAGACGGGAAATCCTCTTCATAAAACCGGAA
CGATGGGAAAGCATGCTGGCGCTATCGTCGAAGCGCTCCCAAGGCAGGGGCTGGCGATGGGTGAAAAGAAGGAGGAAGAA
GCAGCTGCCGCGCAGTCCAGAGAGGATGAGGCTGAGGCCAAGCCACCACATGGGCCACGCGGCGAAGACGTCGAAGCGCG
AGTGGACACCAACGTGGGGGGTTAGGGCGCGCAGCAGGACGCAGAGGACGCCGGCGATGGTGAGGGCAATGCCGAGACCA
GTGGCGACGCAGATGGTCTCGATTGTGCCGTTAGAGACGCCGAGACGGACAAAGTTGCGATGGGAGCAGTTGCGCAGCAG
CAGGTAGACGTGATCGGCAACGGCCTTCAAGTGGGTCGGGTCAGCTGAGCTTTGCAGTTCAGCGAGGGCGTGGTCACGCA
TGGCAGGCGGGATATTGAGCTCCTTCTCGGCGCCGGGCCTAAGGAAAATCTTGATGACGGCGCCCAGTTCGGCACGACGG
CCGGCGCTGGCATCCACGACGTTGAGTGTGGCACCCGTCTTGGCCTGTCTGGACGATGAGGATGGCGGCTTGGGCAATTG
AAAAGCGGGTGAGCAGCCGTCTGTGGCACAGTTGGCATGAACGCTGATCAGACCCGTGATGCACGCAAGAGTCTCGGCTG
AACAGTCAGCAGTTGCAGGCAGATAGCGGGGCTGGGCACAGAAGACTTGCCGATTTCGGGATCTGTCGAGAACACTTCTG
ACGGGTTTTCGGTCGCCTTCCTTAGGGACGCTGTGCTCGTCACAGAGCTGCTCAACGAGGCCGCGTCGAAGTCGCCACAG
AGGTTCTTCTTCCAACCCTCCTCATAGCTCTTGTACCTGGCAGGATTCAGGGTTAGAGACGGGAACTTCTCCGCGTGCAG
CAGAAATAGGCAACCATACCATATGTAGAACTCCAGGTTCTCGGGCGAGAACTCGATGTATTTTAGATACATGTAAAAGT
CGTAAAGTGACATGGGGCTGCCTATACAACGGGAAGAAATCAGAGAATAGGCGTCCAGTCGAAACCATCACAACGCTGAG
ACGCAGCTTACATGTCTTGTTCTGCAATACCCTCTCGAGCCTCAGACGTGCCGGTACGGCGGTTTTGCCGCGGCCATCAG
GACTCAGGTCTCGTTTTCCAGATACGACGGCGTTGGAGTACTCTTTGATGTCGCGGTACTCTAGCTTCTTATACCAGCTT
AGCCATGATGGAAACCTCATTATTGCGGAGAGCGTGGTTGGGATTTCTTCTCCACGTGGTGACGGGGAATATGGACCAGG
AGAGAAGTGTTCAGAATGGCTGCAGAAGAGGACGAAGCGATCAAACACAGTCGCAGACGGCTAGACGACGAATAAGAAAA
AAAAGTGCACTGGGCCTTTTGAATATGTCTGCACAAACAGCGAAAGCCGGCGAGACCACGGGGAGTGTACTTTGTTAGGG
GGGGTCCTGCACCCGAACTTTGGGCAGAGTTTGATTCCCCTCCCCCCCCCCCCTCATACCTTCCCGTCCGCCCACATCAA
ACAGACAGCTGCAGAAAGGGCCATGTGCTTGGACGCAAGGGTCGCGTTCCAGAGCGACAAGGGAGGCTGACAGACGGCTG
ACAGATATGTTCACTGTTTGTTTTGTCTGCGTGTTTGCCTGCTTGCTTCCCTGTCGCTACATGTTTGCTCTATTCGGTCT
CTCGCCTCCTCTCTCCTCTTGTAAATTTTCAGTCTGCCGTGTGACATTGTGCAGCGTTGGACAGCGTGGAGAACAACATC
GTCGGCTTTGGTCCTCCGAAAGAGCGATTTGATCCCGGCAAAGAGGGGGTGGAGAAGTGCTTCCAAGACACCTGCCCAGT
AAGCCTACTATGTAAGCTACCAATGTGAGTCTCAGTTTCGGGTGAACTGCGAGCATGAGCAGTCCGTACGCTGTGTAAGT
ACTCCGTATGGCTATCACAGAATCTGTATGTTACTTTATCTTACCCCTTGTCGGGTCGCAGGCCTGCCAATTTGGAGTAG
AGCAGTACGGAGTAGAACTGTGCATTGCACGTAGTGGGGCCCTGTAAGTCGATCAGCACTCATGAGCGCAGCAAGGAAGA
CAATTAAAAGAAGCAAAAGACTAAAGAGGCAAAGGGCCGTCTGCTAGGCTGTGCTGATAGGCCGATGGTACGGAGCAGAA
ACTGGAGGATTCTAGTTAAAAGTCTAATTTTATCTCAAGGCTCTCTGGCGTATAAACTATTGTGGCCTAGCTAGCTTACA
CGGCAGTTACTTCAGCACGTTTGCTCTGTAGGCAATAGAACATAGCTGGTCGCCAGAACGGCACGGTAACACTCGCAGTG
CTTGGGCGGCGTTCCTACTCCATTCCCTCCGCACTTTTTCTCCGTACCTCATGATCGACGCGCCGACCGCCAATAACATA
ACATCGCTGCCCAGCGTCGCATCGCCTCTGCGATTCGCCCGACGGGCAGTCTTGGCCCGCCCCTGAGCGATGCTGCCCGC
CCTAATCGTGGGGTGGGGAAAAGCAGAAAATTTCGAGTTGTTTCCAATACCTCACTTTCAGCTCGCCTCCGGCCAGTATT
AGTCTTCTACATTAGGAATTCCAGCATTATTGCCATGCATCATCAGCTACAGGAAGCAGGGGTGCCAAACGAAGCCCCTC
CTCCCAATTTATACATAGTATGTTGTCAATTACTTCCCGTTATCTTCTCTTCTCTTATTGGCCTCTGTCCTTTTATACCC
CAGTAAGTTCTGCAGTTCTGCACGTCCAGTACTACGACAGCCGAGGTCCTAGCCAGTGATGTCTCTCTGTCGGAGAGTGC
CAGCGCAACCCTTTGCACCACAAACGCCCCGACGGCTTTCCGGTGACGGCTTGTCCTTGTGGACATGATCCTACGACTAC
CCGTGCATACGAGTAGAAGTACGTATGCCACCCGGAGGGACAGGCTGACTACGACATACGACGTAAGAGCAATTTGATTT
GCTCGTCGCAGAAACGTGGCTCCGGTGGGCCCTAAAGCATTATCTGTGACTGGCCCTGACAGCCCTCCTCGCGTACTCGC
TTCCTCGCTTCTTCTTAATGTATGTCTGAGACGGGGAATTTGATAGCTGATATGTAGTCCACGGATTACTCCGTATACAA
TTAAAAATTCATTGCAGCTGACAGACACTCTGGCCGTGCCTAAGATAGAACCTAACTGCAGGCCGAGCGAGTGCTCACGA
GCGGGCGGCGGATTAGGAGGGGGGGGTTATAAGAAGAAACAAAGATATTCAATTAAATCGATTACAAGTAAACAATAGAC
ATCGGTAAATAGTAGTTAAATCCTCTTAGAAAGGCCAGGCCCCATGCCAACACAATACCAGATATATAAGATATATGTTT
TTGTCATCCCTTGTCTATTTACTGCGCGAAATTTAGCATGCCTTTAGCCATATGTACTGACTTCTTCGCCTGTGCCTTCT
ACTTTCGACCATTGCTCTTAAACCAGAATCCTGGATGTGCTATGTTAAGCAGAATCGACATTGCAATCATCGGAAGTGTG
TCTAACGCGATAAAGACACCCTCTTTTGATGCTAGGTGTCCATTAAACCCTTCGCTCAGCTCAGCAGCTCGCCAGCAGGA
ACGGATAAACAAGCAAAGGCCCGCCACTCCTGCATAAACAAGTAAAGTCAGCATTTCTATCACATTGCGTTTCTCTGCAA
CTGCTATTAGGTGTCTCACCAAGCAAGATCACATAGTGCATAGTTCGCGTGCTAGTATGCTGCATCTTCCGGAATACAAC
GGCCAAAAGAACACAGAAAACAAAAGTAAATAAAATCTGAGTGCCCAGGCCCGCAACCATAAGAGCAACTCCGGTAGGAC
TCCACGCATATATTGCTGCCAGAGAGCCTCCACAACCGATAAAACAGAGGCAGATAAAATCGCCCAGTATGAACATGGTG
AAAAAGAGGCCGGGGCCTAGACGTCCAAGTCGGGCAGCCAAATTTTCACGCATTAAAGTACTGATGCTGAGGTATAGAGC
TGACGAGAGAAAGGTAGGACCTAAGGTGAGGCCTATGATGTACCTGGCTCAGGATTCTGTCAGCCTCGACCGAACAATTG
AACATTGGCGTCTTTCCAGGCACGATCAAACAAACATTATGTAACCGTTTTTGTTATGTCTGTTGTGTGCCAGTTGAACC
TTGGCCACTAGCCCGAGACACTCTAGCAGTAGTCCGCATAGCATACCAATTGCGTGGCCGTAGAACCGCCAAAATCGACA
AGAAAGGAAGACTTGCACAAGCAGCATAGCGCCAAACAGTACGGCAAAAAACACATTTGGGGCAAGGATGGGTGCAAACC
GAAGGGCCCCAATGCCGTTTGGGGGTATAGAGGGGACATTGTTGCTGCTTAACGTTGCGTTATCCAACGGGACCATGGTG
GGTAAAATGTTGCCGGCTTGCACTTCAAGTTCAGACAGCATAGCTGAGTTTTACGAGAGGAAAAAAAACTGCATTGCATT
AGGGGTATGACTTTTATTTTATATGAAATGAGACAAAACGATTACTCTGAGCGCGTCTTGCACGTAACATCCGCCATTTC
TCCTTATAGTCTCCGTGAATATGGCGATTGCTGTTGGTGATGTAAAGTCCCAGAACACACCAATCACACTCAATTGTGCT
CAGTTAAGGGCCCACACAACTCTGTAGATATCTCCGTCAAAATACCGACATACTTCCGTTAATGTGCCGTCTTGTACATC
TGCCCGCAGTCCTCTTTTCTGTCTCCTTTATGCCGCGGGCGAACACTGCTTCTTTTACCTTTACACTGAGGCATATTTCT
GTAATCAAAGCGCCCTGATCTTGAACAATTATGCGGCTTCGGCGAGGAATGGTGCGCGAGTCTTGCGACTTTTGCCATCG
ACGAAGAATCAAATGTGACCGACTAATCCGCGGAAATCTCGGTCATAAATCGTGCTCGCAGTGCTCCTTGAGGCAAATCC
ATTGCTGCATAGACGATTCGGATGATATTCGACTTCGCAGGCGCCAGCAAGACAGTGTCCAGGTTGCTCCTGTGCCCATC
ATCCACGGTCCTAATCCGAATAATGAGAGCCGTTCTCTGGACACGACTCATACGATAGCTGCTACAGCACCCTCGATATC
ATTCGCATCGAGCCTACTCCCCCCCTCGCCAGAAGCCGCTTCCGTACTGTCGGTTCCTTCCTGTTTAACAACAAATTACG
ACTTCAGCTTACTGGACGACCCCTTCCAGCTCAGCCCAGACAGCATATTCTTTTTGGACAGCATCTTCATGGGCGAACAC
GACTCATCGTGGACCCACCAAATCAGTGAGACACAGGGAAGTCCTGCCCACACAGATGGCGGATTCGATCCACCTCCGTG
GCGTCGCTGCCACATGGATGAGGCTGTCTTTTTTGACGCCCTCCATGCATATTTCACGTTTGCCGCCCTATATCTTCCTG
TGCTGGTGGAAGATACATTCTGGAATAACTATAATGCTGGCCGGTGTAGCCTCAGCCTTATATATGCCGTGGTATGCCGC
AGCCTGGCCTTTGTCGCCACAGACGGCAAGTTGGATATTCAACAGCGAGTAGCATGCCGGTTCCAAGATGAGTTCCTGCA
GGCGCAGTTGAAAGCTACCGGCTCGGAAGAGGTTTGCCTGGACGATTTAGAGGCTCTTACGCTTATGGTACATTTCCAGT
ACGATAAGAAATGTTCCCGCTCGTCTCAAGTACAGAACCATTTAGCAAGCCTCTTCCTGACACACGAGTCCCTAGTACTT
ATGACGATACGATTATGCACCAGCGAAACACCCAGATCTGAAACAACGATTGGCGGCCAGTCTTTAAACGGCGTACTAGA
GACGGACCGCCGCACACTGCTTTACTGGCATGTATACGGGCTTGATGCTTTCCGTTGTCTGGACAAGAAGATCGCGAGCA
GGATCCCTGAAAGTGACGCATCTGTTCTTACAAAGCAGCTGCCCAAGAACAACTCCCGCGGCTATCTCGACGCCATCCTA
GACCTGTCTATCATAGCGCGCGAGTCTCTGAATCTGCTATGCAACATCACAGCGAGGCATACGGGTGTGAAGATCGACAA
CGTCACATCATTGTATCGGCGATTGGAGCAGTGGCGTCTTATAGACTGCCCACCGCACCTTCAGAGGCAGCGAGACAGCT
CAGGACGCTTGAAGCTGTCGATCGGACTTGCTCATTTCACATCCTCACCGTTGCCATTGTCGTCCCCTCCCTCCTTGCAT
GGCCATATCCAGTCACTCGAACACGTCCAACTCCATAGGGCTGTCATATGGCTCTTGGAAATAAACTGTTACATGCAGAT
TGAGGATTGCGTCTCCAGGTACGGCATTCAGGACAGCGTGGATAGTCTTTCCAGTGAGATGCTGGCGTTACGCGTGGAGT
CTGAGAGTGTCGGTTCTGTTCGTGATGCGGTCGAAGTGGCCAGGTCTCTTCTGGAATACCAGGCACGGGAAAAAGAGCAA
GGGAAGAGCTGTAGCGACTTGCCTTTTTCGCTGGCAGATTTGGCTCCCTCCATTATACGTGACTGCTGTTCTGGTGCGTG
TATATGGGCCTGCAACCGTGGCAAAATGATACTGGACATGCAACGTCATGACGCCCCAAATTTGCCTTGGCTGCGGTCTG
CATCACGGACGCATAGCGGCAGCGAGGTGGGCGGTGGCATGAGAGAAAATGAGCGAAAACAGACGTACCTCACAGCTGCG
ACGACGCTGAGGAACGCCGCTGCCAGCGCAACTTCGCACAGCGACACGCAACCTATTCTCACGATCTTGGACCAGAAAAT
CGCTTTACTCCAAGAATTCACGACTTTGTGAGATGCGACTGCAAGCTTTCACAAGCCAGTTTTATGTCTTCGATTTGTAT
CTGAATTGTATTCCAGAAAGGTATGTCATATCATCGTAAGTCTAACGACGTTTATCCTGTCTAAATACCCCGTGATAGCC
CATTACCGCCCGTCATCGTGAAGTCCTAATGCATTAAAACATGTACGAGAAAATGGAATGCCAAAAAGTTGATGAGATTG
AGGAGAAGTCAGACAAAAAGCCCGACATTCTGGCCTCGCTGCAGTCGAAACCGCGCGAAAACATTAACAGCCTCTTGCGT
GCCGTTATCGTCAAAAGGTTGCACAATCCACACTGATCGTCTTTTGGTGATATGTGTGCGGCCACCTTCCAAATCTATTA
TAGGGCACCAGTCAGAGTCCGGTCTATGCAAAATTAGATTGCAAGGGCAGCCTTGCGGGTCATACCTTTCAGGCCAGGAG
GCGGACGTGGCTCTCCTAAGTCTACGATAGGTGGTGCCAATCCGTCGAAGTCCTCGTCCGTCATGGATAGATACGACGCC
GGGTTTTCGGAAAGGTGAGGCATGGTCTGCAGGTCCACGAGATCTGGACAAGGTAATGCCACGATGGGCGTCGTCTGTGG
GGTCGGAGTCTGAAGTGGAGCCGATGAGACCGGCGGCTGCTGCTTTTGACCAACATCCTCAAGGTTGTTGAAATCATCCA
GCGCGGCGGCAGGCTTGGATGGGCTGATCTTTGAAGGCAGCGAGTCTCCCACAAACCCAGCCCACACGTTTTGCTCCGGC
TTGTTCCAACGGTTCACAGCCGTGTCGATGATGGTCTTTTCGGAGGCGGTATCCAGCTTTATGCCAAGTATCGAGCCAAG
GAAGATGAGGTGATGGGCCAACATCTGGGCGAGGTGCTCCTTCATTGCTAACCACAACGTTGGACTGTGACGCATTTCAG
CTCCTAGCAAGGCATGTGGGAAGGATGGTGACGTGGTAACTCGGGTGGAGTAGCCAACACCGAGAATGAGGCCAAAGACG
AGGAGGAGGAGGGCTCGGTGCGTCTCTCTGTCGCATTTGGACAGGAACTGAGGAGTCAAAATACGGTCAAGGCGGCGCAC
AATTCGCGACCCGCATAAGTGTCCGGCAACGCAGAGATCTCGGTGGGCAACGTGGCCGTTCCAACCGGTATGGGCGAGAG
AGGTGGTAAAGAGGAATATACGAAAGTCGGTTGTCAGGTCGGCATCCACGGCACGGCGAAGACTCTCAGAGTTTCCCACT
TTGTCGCAGAGTAAAGCAACGATGCTGCCGTCGGGAGGCGAATAGTCCGGGTTTGTCAGCCAGCGGATCAGTGTGTCTTC
AAAGATGTCATCCCCCAGGGACTGCGAGTGGTGAGGCCTGATCTGGTCTATCAGGGTGCGGACCGACATCGGGACCTCTG
GCGTAGGTCCAGGTCCGGCTATACACAAGACGCACGACGGTTAGCTGAGTATCAAAAGTGATGTAACAGCATAACGAAGT
GTTAGAGGTACAAACAGCTCTGGAAGATATCGACATCCACGAAGCGCGTTCGCACGCAATAACAGAAGGACAAAACCTTC
CGTTCATACCCTCGCACGGCAGAAGACAAGCATGGCTTGCACGGGTTTTCCTTGGAGCACTGTTGTTGGAAGGAACATAA
AGAGTTAGGGTTACTGCAAATGCATGGCATGGTGTTGGTGATGGTGCCTACTTGTATTTTCAACATTTTACACCGCAGAC
ATGCACGCTGTCTTCGCACCTCCAGAACTTTGGCCTTCTCTTCGGTAGATAACTTCTTTGTGCGGCGGCCTTGTCGTGGC
TGACGTGGTTGTGAGTGTCGAGCAGAGCGAGATCGGTTGCAGTTTGTGGGGTGAGCGTCATCGGACGTTGGGCTAGGCTT
GATGTTGTCTTTCGTAGTTCTTATCAAGGCAGGCACTGAAGACTCGGTGACAACAACCAGCTCAGCTTCGACTGAGATCT
CCTCTGTTTTCATATTGCTCTCGCTTTGTTTTCTCAGCGTCTTTCAGTCCTTTTGATTCCCGTCTTCAGGAGAGGGGGGA
CAAGTGGCAATATTAAGGTTGAGCAAAAGACGACCGAGCTGACGGGCAGGGATATCGAACAGGGGATCGTTCTTGTAATG
GACAGGCTAGTGTTTTAAAAGTAAAAATAAAACAACCAAGACAGGTGCGGCCTGAATCCGGGGGGTGGGGTTCGTGAGGC
CAGATGAGCTGTGTTCAGGAAGAAGGATGGGGCTCCTAGCAATATGCACAGACTGGTCCCGGAGGCTACAGCTGGGGAGG
CGTGGAATATCAAACGGGCTTCACCCAGTGGGCTTGCAGCGTGCAGGGGAGGGGAACTGTCCGAAGGTCGGCGGCAGGAT
GTGGGCGAGGCAAAGAGCCGTCATTCGACATGGAGCAAGAAGATCACCAAGCGTATTCGTAGACGCAGTCAGCGCATACC
CTCGGTGCTAGGAGGCTCGCAAGTACAGCCGAGCTGAAGTAAGTCGCTCCCGCGAGATAGCTGGGTCCACGTTGTTCCAT
GCAAGCATGCGGGCTCTCGTCTTTGTAGAGAGCCGTCGACGTCCCCGGATCCCTGCAGGATCTGGCGTTAGTGTGAACGG
GTGTTGGCGATCGTGAGTGGCTTGACCAGGGATTGCTCTCGTGGGGAGGACGAAGATAAAAAGAGAAATTTCGAAGGGGA
GCGCAAGAATTGAAACTGAGAAAAAAAACGAAGCAAAAATTTCCTGCCAGCGATGCTGGCAGCCACGCCGAAAAGCCAAA
CGGGTGATGCCATTCTGCCTAAACACCCAGGCTGCAAAAGAAAGCCTAGGCCCGGCTGGCTGGCTAAGTCATGCACTACT
CCGTGCTTGCAGCTGCGTCTTGCCTGAGAAATCGTACCGTATTGCATGTTGGCAGGCTGGTGGGGTAGCTGGACATGCTG
GGATGGAAGGATGGCTGGGGAGGACCTGCTGCCTGCTAGGCCGGCACAAAATGAGCCACCGTACTCCGTACACGTAGATT
GCAGGAATGCAGAGATCGATCGACCTTCCAGACAAGATGAACAAACCTGCTGCCGGCTCCACGATTTTCTTTCGTCTGCC
GCCTGGCGCAACCAGCCAAATTTTACGCTGGCCCCGCTGGCCAATCATGCACCATGTCGACTGTTTCTTGGCGTCCAAGC
CAGCTGAAGCTGTCCCCACTAGCGCCCTTTAGCGGTGCAGGCCAAGCTGAAAAATGCAGGACTGATGCATGCCGGTCCCA
CTTTCTCGGCACCCATGCAAAAGGCCCCTTCAAATCGAGAAAGAGGCTCGCTCCGCCATATCTTAATCTGGGTTTTAGTG
CAATATATGTACATACGCCATATATATATGTAAGCCGGGCTAGACCTCACTCCTGGTCTCATGATTTGCACAATGGCATA
TCGCCAATTCAGTGTACTTCACATGCTTGAAGATTGTGGAGGTGCTTGGATACTATGAAGGCATCATATAAAGGAATTCT
CTTATCACGCGACATCGCCCTTTGTCGCATTGCATCCGGGCCGCCATCTAACACTTACATAGTAGACGTTGACAGTCCTT
TCAGCTTGCGATACGATCTGACCGGCACCACTTAAGCCATACCATAGCCGGGTAAACTATGACGTATATAGCCCATTGAC
GCGGATGGCAGAGCGGGGATTGCCGCGTTTCTCACAGAAAAGTCAGCCGAGCAGGGTCAGAACCTCCCGTAGTCGTTTCA
CAAAAGTTCCATCCGACGGGAGGACTAACAAGCATGTCCCATCTAATAAATCGCAAGAAAAAAAAGAAATTAAATGCAAA
GCCCTTTAGGCTACGGAGTACTTAGCAATATCTGACGTCATCTCTGTTTTGTAAAAGAGGACCGACGCGTGCCATCACAC
GAATATGGTGAGCACAAAAGTTCAGCTGCTCGTGCTCGGCCAAGATATCATCACGGTACGGAGTATTTGTGTCACCCGGT
AACCGCCGGCCCGCGCCGTTTGACTTGGCGAAAAGTAGGAGTGACAATATTCAATACGAATTGAAACGTCCACACTTGCT
GGCTCGGCTGCAAGACATTTCTTTTCCAAGACGGGCCTGCTCGCAAGCTTATGGGAGTCTGAAGTATACGAGCAAGCCGT
CAGTCGTTCATTTCACTGGCAATTCGCAGTCTATCTTGACGTGCACCTGGTTGGACTTCAACCTACTCCGTGAAGGCTCA
ACTTGGTTTTTTAGTACGGAGTACTGCGCCAGTTAATTTACCCGTTTTTTAAGCCTCCACAGTCAACCGCCTATTACCAC
ATGTGTACGGAGTACGAAGTAGACAACGCCATTAGGTAGCTAGCGGCCTAGGGCTCGGGGGAAACCCGTACACATATATG
TTGCCGGGTCTGAAATGGCATTGAAAACTCTGGATAGTGTCTTTGGCAGCTTGGGGCGGATGGGCCGAAGGGTTAGGCTG
ATCTGAAGCCGAGAGGTCTTTCAAACAATGGCCGAAAGGACGAATAAGCTGCCACATGGTCTACTAGGAACCGCGGTTAA
CAAGCTAGCTGGAAGTTCTACATCTATTTGAGAAAGATGCTAGGACCTATTGTGCCGCACATGATCGCAGCTGCCATGCT
GTATGCTACACGTGACACACGTGACGGCAGCTTAATTACAGTTTAAGAGGGAAAAGCACGAAGACGGTATGATAATGCTA
CTTTAATATTAACATCTCTGTAGAACTTCGACTTCTTCCTAGGAATGTCGAACTATCCTGGCGGCGTCATTGCCATATGC
CGCTTCTGCTACATTGACAGTTGCTTTGGCAAACTGAATAAACGTGCATTGGCGGGGGATCAAACGACTGTTCATTGTCT
TCCACCAAATATTCCCTGGCTTCTCCCAACTGTAGCCCCCAAAGGCCGAAGCTGTCAGGTAAAAGGCCTTGTTCGGAATA
CCGGAATTGACATGCGCCCCCCCAAAGTCGTCGGATATTGTTTTGTACTTAGACATCCTGTCGGGCTGGGGATCTTTGCC
CTGGATCAGTCAGCCAGGATCCCAGGCTTCAAAACGGAGAATAATAGAAACAAGATTGTAGAAGAAGAGAGATGGCGGCT
TACGAAGCGAGGATCGTCGTAAGCTGCTCCAGGCGCCCTCATGCTTCGAAGAGCTACACCTCTCTCACCTGGCAGAAAAC
AGCCTTCGCCAATAAGCCAATTAGCAAGTGTAGCCGTCTCATAGTCTGCCCATTGCTTTGTCATGCTCCCAAAACAATCC
GAGATGTGTTCATTGAGGGCCCCGGGTTGGTCCTCGTATTCCAGGGGACTGGTAAACACGGTCACGCCATGCGTCATTTC
ATGGCCGACAACATCTAAACATTGAGCAAAATTGCACAGAAGCTCCCCACCATCACCATACACCATTTGGAGTTTGTTTG
AGTCCCACAAAGCGTTGTCGAAGTTCGTTCCAAAATGCACACTACTGATAGCATGCATGCCGGCATTGTCAATCGAGTTC
CAATTGAATACAGTCCTGTAGAAGTCGAGCACTTTGCCACAGTTGTCATAAGCATAATTCACCTGGTGGTCGCTGGTAGG
TGCTTGGAGCTCACGTCTTAGTAAACGTCCAGGGAGAGAATTTACGTCGGCGATGTTCTCGGCTGAAAATATGCTGCGGT
TTTTTGAAGGCCACCCACCCATTGATGGCATACAGCTGTCACGGCCGTGATAAGTCGTTCTATTTATGTGACATCCAGTG
TCCGTCGAAAATCGAGAAATCTGATTATTGAATCGAGTTTCGCTTGTCTCTTCAATGTTTGAGAGCGGCGGCGCATCACC
AGCTTCTGGAGGGGGGAAGGTTGTGGTGGCACTGAGGCACGCCCGCTGATAGCTGACTGCAGACCGCAGAGCGCGATGGA
TTAGGCCCCGGTGGTATGCAAGGCTTTCCGAGGCTGCTTTCCGGCAACTCTCGCTGTTTTGACAGCTAGAGGTGATTCCT
TGAAGAAGATGGGGAGGGACAATTCCACAGAAGTGCGAAGCGGACATAGATTCACAAGAATGGTTGGTATAAGGTGCGGA
ACGGTAAAATATTATGAGATGCTTAGGAGATAGGTCAGAATTGGATATCAAAGTATCTAAAGAAACGCGTTCAATGCTGT
GTTGCTTATGTCTAGAAAACAGCGAGTGTTCGCTCACAATATCAGGGTCTCCGTCGCAACTCCCTGCGGCATTGTTTGGA
CATGACAGAACCCGGATAATGAGCACCTGGGGAAGGAGCTACCTGAACGCACACAAAAGATACCGGGTTTGACAGCTCCA
TGTAAGTCAAGCTAATTCGGGTTCAAAGAAAATAGGCAGCTGTAGTCACAGAACTGCGGCGGTATCCATCTCGAGTCATA
CATCTTTTTTCTCAAGTCTTCGTAACATCGTCGCTTGCATTTGTGCCTTCTATGATCAAGCTGCACCTGATAGCTTCAGC
AGACTTTCGCGGCCTTGAAAGAGCTCAGGCCTTGCTTTGTGCAAAGCCTGCACGGTTCGCTGAACCAGCTCTCGGGTTTC
CTTCTCTAGCTGGTCCTCCGGGGGAGAGAGAACTTGTTCAAAAACTGGAATCAGCTGTGGTGTGAGCTGTTGAACAGTCG
GCTCATTATGATCATCTTCAAGCGAAAATTGTCAGCTTCCGTAAGATCAAGATGTTAGGGCCCAGCGACTGGGATGGGAC
ATACACAGATGATAGATGCACGTGTAGATGGGCTTGTTTTCTTCGTAATCCTCCGTGAGAGGAAGACGCTGGACAACAGA
GGGCAGGTACTCGGCAATGGGAACAACGTCAGGGTGAGCTGTGATCAGCCGGCATACAGCCGCCGCTGCGTTGTCGTGAA
TTCGGTGGCCAGTGTCATCAAGAGCAAGCAGCTGTTCCAGCTTTTCCAAAACAATGGGAAAGCTGGAAAGATATGTTTTG
CTATCCGTCGAGTTGCTGATGAGTTGACCGATTGCATAAGCGGCATTGCTCTTCGTCTCGAGGTCTTCGTCGTTCAGCCG
ATGCACAATGAGTTTCAGCAGTGTGCTGGTGTACGGTGTAACAGTGGAACCCATGCTCTCGGTGCAGCCGCCGATAGTGC
CGACAGCTGAGGATCGCTCATAGGACTCATTTGAGCTGGCAATTTTCATGATAGGCTTCTCAAAGATTTTCCACAGCTCA
CCAAACGTCGGTCCGATGGCAGTCGCTAACGCCATCACAACGTCAAGAGCCGTTTCGACGACGAGCCAGTCGTACTCTGA
ACTCTCCTCGGCGTTCTGCGCATCTTCCTCGTCACCCACATCTTGTTGGCACGGGTGCGCCCGAGTGATAATTTGTCCCA
AAACGGTGACAATTTCCTGTATTGCGTTTTCCTGGGCAATAATAGCAGGACCGCATGTTTCCAGAGTCGCAGCAACATTG
CGGTTGATATCCGTTACCACGTCCCTGAAATACGGAAACCAGTCAGTGTTCAGAACGAATAAATCATTTCGGCAAATTCC
ATGTGAGTACATAAGGGTAGTAGTGAGCCAGAGATCAGAAGTAGATTAAAACGGGTTCGCAGCATTCGCACAAGTGCGTC
AGAGTGAGCTGGGTATACCGTAAGGTGTTCATCATGAAGGTTCGACAGATTCGTGCTTGATGGGCGCATAAAGTCAAGGA
TGGATCATCAAGGAGGGGCTTACCGTTCAATTTCATCCTGCCAAAGCTCAAGGGTCGGCTTCGTAACCAAATCCGCCAAC
TTGGAAAGTAGCGGCGTTGGAGTCTGTGCAGGCGGGAAGCCGGGTTGCCATTTCAAACCGGTCGATTCCGCAGTCAGCTG
CCAGACCCGGGCATACGATCGCCAAAGCATGCCCATAGCAGCCTTACGAACACCGCTGTGGTGGTGCTCCATAAGGTCCT
TGGCAATGCTAACTGCCTTCTCGAGGTATTCCTGCATTTCCTCTTCGCCACACGCGTTGGTGATGACGTCACCAAGCACC
TCAACTGCGACTTCCTTTTCCTCGGCTTCGCTGTCCATACCAGCCCAATCATCGTCGTCGTCTTCGTCGTCCATCAGATC
TTCCAGATCGTCGATGTCGAGATCGTCGATGTTCAGCTTCTTGCCACTGGTGGAGCCCCCAGAAGCAATGATGGCTTTCT
CCTCTTCCGTGAGCTGAAGGACAACATCTTCTTCATCATCACCATCCAACGCGTCGAGCAGGGCCTTGAAGACACCTGGA
AGGAAAGGTTTGAATTCACGCCCATACACCTTAGCCAGAGACGACCAGAAGATGAAGCTACTCTCCTTCAACCGATCATC
ATCCAGACTGAGATTCTCCTCGCTGGCCCGCATGAGGTCCACCACGTACGGCTGAAACGGTTGTGCGCCGACAGCAACAG
CGATGCGACCAATGGAGTCGAGAACGGCACTGCGAAGTTGTAGCTCCATATCCTCACCCGTCACAGTGACAAAGGAGCCA
AGGGCCTGCATGCTCTTTTCAAAGTATGGCACGAACTCTTTCTCGAGTGATTCTGCAATCGCTCCAAATGCGCCGGCTGC
CGCGATCTTCACACGCGTATCTGGGTGGCTGAAGAGTTGCCCGATAGGTTCGATCATCAGGAGCGCATACTCCTTCATCA
CATCGGACTTGAGGCCATTAGACACAGAGTCAAATGCAGAGCAGACGGCACGAATAACCTGGCCATTCTTTTTGGCAACT
TGCTCATCCTGGGTCGGAATCATGGCAGCCTGTAGATTTCTGGAAAGGGCAGCCATGATTTCTTTGTGCTCAATAGCAAT
GTCATCGGGCATTTCTTCGGCCAAACCCGTGAGGCCGACCAAAGAGGCATGGCGCACAGTGCCGTCTGGGTCGTTCAAGA
GCTGAATGACGATAGGAAGGATCGTCTTCAGCTGGGTGTTGACGAAGTCCGGGGCGCCCTCGGCGCAATTGCCCAGGGCC
AGTATGCCAGCTTTGCGCAAGGCCGGATCTGCCGACGAAGCGTACTTGGGAAACTCGTCGAGTAGGGGAACAAGCACCTG
GCGAGGGGGGAGCTCGCTAGCTAGAGCATCAAGAAGGCTCAGAGCAACATGACCCGGTGTTTCGTCATCGAGCGATTCAT
CGTCACCGATCTCTGTCAAGATCTGCATTCCCTTGACAACGAGCTGCGCAGCCATATCGCGCATGGCCTGAATCTTTAGG
CGACGGTAGTGAACAGTCTGGGTCAGGAAAGAAAGAGCCTGAACACGAACGTCCTCATCAGCTTCTGTATTTGCGGCGAG
GTCGATCATAAACTGAAGAAGGCTCTTGAGATGATTGCCGATAAAAGCGGGACTGAAAACTAGGAACTGCTGGAGGACAT
CGAAGACTTGCTGAATCTTTTCGTCGTCACCAGCGTCAACGGAGTTTTTGAGCACAATGCCCATGAGCGGAACCAAGTCC
CGAACACCGCCAACGGCCTCCTCATCTTCCTCTTCGTCGCCCTCAATAAGAACAAGCAAAGCGCCAATGGACATGACTGC
ATTGATTTGGACATCTGCACTGCTGGGGTCCTTGATAAGCTGACCAAAGAGCTGAAGAAGCTTTTTGACGTGGTCCTTGT
AGATCACAGGGTTCGCCTCCACAGTGCTGTACATAATGTAGGAACCGATCTCGCGCTGTGAGACATCGCTGCTTGTAGCA
AGCGTGAAGAGTGCAGGGAGCAACTCAGGCCATTCACCGTCGTCAAAATCATGTGTCGCAATGGCAGCAACAAGATGCGC
GTCCGAGTGGCGGCACTTGGCATTTTGCTCCTTTAAAGTGGCGTCCATCAGGTGCTCGCGAACTGCCTTTTTCTGGTCTG
CCGAAGCAGAAGGCCAGTGCTTTGGCACCAGTCTAGAGGCCTGAACGGCCGCCTGCTGCCTGACGCCAACATCGCTGTTC
GTGCAGACAATTTCAATGAGCAGCAACAAAGACTCTGGGTGCGCATAATAGCTCTTTTGAAGCTCGGCGGTAATCGCCTT
GAGTCTTGTTGTGTCCGCTAGAATAAAAGAGTTGTAAGGTCAGAAATGGGAATAAATATTTTTGCAGGTGAAAAATCGAG
GGAGAAGTCAATCAGCCACAGATATGAAACACGCACGTATTTGGCTCTCTTGGAGCAGGCTAGCAAGCTTCTGCCCGTCC
ATACTTAAACACCCGAAATGAACAAAACAAGCAAGAAAGGTAAGCAGACAAGCAAAAAGTCTGGGTATCGTGTCAGGCGC
TGGGAGGTGTATGTGGCACGCTGAAGAAAAATTGGGATGAAAAAAAAACACTAGAAAAAAATTCACCTTAAAAAAAAAAA
AAAAAAAAAAAAAAGGCGGCGTCGATAAGATATCTCAAAATCTAAAACGCCAAACTGCAGTGCATTGACCGTCAATTCGT
ATAGCGGGGTAATTCCGTGGCTGTTAAAGTGTGGCTTGTAAAATGGGCCGTGAGATAGGAAGGTCTTGGTGCAGCCTGTC
TGACCAATCAGAAAATATCACGTGGACTGTCACCAAGCTTTCCAAAAATAAGCACTAGTGAAATAACGGCCATCTACTCC
GTACGGAGTATACATCCTACCAACAGCTTTAGGGAAATATATAGTAAATCAAGAACATACGGATACTTCATCAGCATTTT
GCGGCTGATTCGGCTAACGACCCCCCCCGGAGGCCAGACTGGGGCTGGCCGAGAGCTAGAAAAGAATTTACTGGCTCCAT
ATGCATGTTTCGGCACGTTTTCGCATTGATATTGCAAGTAAGCTACGCAGCGAGTACATCTAATGAGCTACCAATATGCG
CATCCTTCAATGTCCCAGCCCTCGCGCAGCAAGTATCGCAATTTACTGTGGACTACGCTTCCGTTGCAACGACGTAATAC
GGACTCAGCCACTTCACACTGCATATTGAAACAGTTGATAGATGGACCCGATTTGCTGAATCTAGAGCTGCATGTTGTAG
TCCGGAGCCATTGATTAATAGATAAGGCACGAATCCCTTTAGCTGACCCGACAGCTTTAGTTCCTGCTCTCAATCTCCTC
TCTCCATCTTGTCTTTAGTTTTATTTTCAGCATTGCCCCCTTCGCCTGCTTGAGACGCTAGAAATATGATAGGCTTGCCA
CTGAAGACTTTGAGGTCACGGTTCAGGGCGGCCCCGACCAGCCTTCCACCGGCCCCAAGCACTGAAACTTATGGGGCATA
TGAATTCACCGGCGTGCATACCGAATCTCGAGGTTTCTGGCCACTCGATACCGAGAATCCTATCACCACCGGTAACCCTT
TCACCGCCGGCAACCCTTTCACTACCGACAATCCTTTCACGACGAGCATTTCTACACCAACCGGCAACCCCTCAAGTACG
CTTGCGCTTTCTACCGATCAACCGAAGGGAGCGCATTTAAGTTCCGGGGAGATAGCTGGAATTGCAATCGGCTCTGTCCT
TGCTATTGCTGCCATAGTTTCGCTTGCTCTGATTCTATGTTTGCGAAGACATGGACAACGTCGGCGGCAGATGATCCAAG
ACGAAAAACTCGCGGAAGTAGACAACGATGAGGAAGTGCTGTCGCCACCACAGCCACAGTTACTTGTACTGCATTCCGAG
ATGCAAAGGGCCGAAGCTGTTGGCGGCCCAAAGAATAGTCATTTGTCTTCTCCAAATGTTCAAGATGACCCACCAACATA
TGAAGAAGTTCAGCACGGGTTGTCGCAGCACGAAGACCATTTTGCTCCGGGCGCAGTTAGCAATGGCTTTCAGCAATATA
TATTTCAGCCCCGGACCGATGATGGGCCTAAATTGAATATTTGACCAATGCATACTGCTGTGGTGGGATTATCAGACTCT
GATTTTTGTTTCTTTTCATCTGGGTCGATGCCCTAGGCGTTCGAGACCGTGTGTACCGAGCCTAGAAGAGTCAACGTATA
TGCTCGTTTTTAAGGTAGAACTTTGATTATTGGTTTCCATCCTCTTTTTCTGTCCGCCTGAAGGTGAAGTAAAAAGTCGT
TAGAATTTTTAGTCGCAGGAATATCCCAGATACTGACGTATATAGAGAGCTGGCATTTCTCGTTGAGGCTGGCTTATTGC
CCGTACACTGTAATCAAGGATTGATGCTCGTGTGATCCAGCCAGAGACGGCGTACTCCGGGTCATGATCAACGCTGGTGA
GACCACTTGGCGCAATCTCATGACTAATAAATGAGCACAGCTCGGGATGCTGCTTCTGGGGTATGTACCCGCCAGCCTTA
GTTTACGTCGTAGATAGCATTAACTGGCTTGTTCGTATCACATGGACAAATATCAGTCGGCACCAGGATAAGGTCTAAAA
ACTTTGTGACAGGCAAAACTTGCACATTTCACCATGTAAGCACTTTGACGGCAATTTAACCCAATATACCAATATATGGA
CGCCGAGAGTCTTGCGGTCTGCACCTCACATGCCAAATCCACGGCGAGCGTTGTTGCACATGCGTCCCGTGAGTTTGTCT
CATTCCGGGGGTAGCGACTCGAAGGTGAACTCCAATGTGATGTAAATTGTACCTCTCCTGATAATGTGTCTCTTATTCTT
TCTCTTCCCCTCAAACTGGCCAACTTTTCAGTGGTGAAAAAGCCGAATGTTTTGCTCAACAAATGTGATGCCTAACTTTT
CAGCAGTTTCAAATACTGGTATATCATTTTGACTACCGCCGGGGGCCGCGATGTACTTAGCCCCTGACCGAGCCGCCCGA
TAAACATTGTCCGTGAAGGGAAACTTTCGCAGCATATTAGTTAGACTGGACCTAGTATGGCAGATTCGAAGAAAACTCAC
AAAAGCGTCGCTAGACACAGCCACATCTGTAAGCGTTGCCAGCCAGCCCTCGCGCTCCTTGGTCGAAAAAGCCTCCGGAA
CTACCTCAAAAACCTCTTCGAATGCCTCACGTTCAGGGCCATCTTTAGGTAGCTGACCGCCAACAAGGAGATCAATAGCG
TTGCTCTTCGCAGGGCGCTTTGTGCCTTTCTTCCACCGAATGCCAAGCACGCGTGGATGAAACCGCAACCACCAGTTGTC
GGCCTTGTCACCTGCCAATCGCGTGCAGTGGATCCGAGACTGTTGGCCTGCACCCAAACCAATCACCTGTCCCCGAGCTG
CATAGCAGACTGAGTTGCTCTGGGTGTACTTTAAGGCAATTGTGGCTATCGTGAGGTCGCGTAGGGCTGCATCAGACAGC
GGGCCGGCCGCATCCTTTGGTGTGATGATGGTGTTAAAGGACTTGGGCGAGACAAGGATGTCGTTGCGGTGTTGAGCCAA
AGTTACACCGAAGACTGTGCGCGTTTCGCGGCCGGTGGGCACGTACTCTGGGTCGATTTGCAAGACCAGGTAACGACCAC
CTTTTTTCTTTTTGAGGATGGCCAGAGCGTCTGGTTCGTAACCGGGGGCGATGACACCGTCCGATACCTCCTTGCCAATA
ATGGTGGCTGTAGGAACATCAACAACATCACTAAGGGCGATCAGGTCACCAAAACTGCTCATGCGGTCGGCACCGCGAGC
GCGTGCATAAGCCTGGGCAAGAGCAGATGTCTCGATGCCCAGAATATCATCAACCATGTAGACTTTCCTCTCGTCGGCAG
AAAGCGGGGTACCGATGGCAGCACCTGCTGGCGAGACGTGCTTGAAGGAGGCTGCGGCAGGAAGGCCAAGCGCAGCCTTG
AGCTCCTTCACCAGCGGCCAAGCATTGAGGGCATCGAGCAAATTGATGTAGCCGGGTGACCCGCTAAGCACAGTGAAAGG
CAGGCGCCCCTCCTTGACGTAGGCGGCGGCAGGCTTCTGGTGTGGGTTGGCACCATACCGTAACGAGAGGTATCGAGAGC
CATCACCAGCATACTGCTTGCGGAAAAAATCGGAGATTGCAGCATCGTAGTCAGCAGTGTGCTCGAAAGCCTTTAGGGCG
TATAGCTTGCGGCTAGATTCTTTGATCTCGCCGGCCTCAAGCTCGTTGATAAACTCGGCGTAGTCAGCTGGGTCACTGAG
GATTGTCACTCTGGTGTGGTTCTTGGCAGCAGCGCGAATAAGGGTGACACCACCGATGTCGATTTCCTCCACAGCCTCGG
GAACCGTCACGTTGATTTTTGAGACAGTGTCCTTGAAGGGATAGAGGTTGCAGATTACATAGTCAACTTTCTCGATGTTC
TGCTCGGCAAGATCCTTTTCGTCAGAAGCAAGGTCGCGTGCTAGGATGCCTGCATGTACGGCAGGATGCAGCGTCTTGAC
GCGGCCAGCCAGCATCTCAGGAGCTTTAGTGATGGCAGAGATGTCCCTGTAAAAGGAGCACCCCAAAATTAGCAGGCTTG
CAGGGGATGTCTAATCAGGAAAGGGGACATACTCAACCGGAAACCCTGACTCACGAATCATCTTTGATGTTCCTCCAGAT
GCCAGGATGCGGACATTGTTCTTAATTAGCCCCTTGGCCAGGTCCAAAAGACCTGTCTTGTCATAGACAGAAAGAATGGC
TATGCGTTGTTGGCCCGCCATTGCTATTCCTTTTTTATTGTCGAAGCTGCGATCTGATTAACCGAGAAGTTGGAGGTCCC
AAACAGCACCTGGTATAGTAGACCGGCTTTCAGACGTCGGATGGCTAACACGAAACTGAAGAGATTTTTTCCTTCACATT
GTTAACTCTTTTTGTACTGGTGATATTTTAACCGATGAGGGGTATTCATAGCCACTGACGTAACAACGTCCCAGGCGGGG
CAGAGATAGCATAAGGCGCTAGGGCGACATCAACCCGCCTTCGTTACGGTGGCGATACTGTAGCATATACCCTCTGCTCC
CTCCTGACACATTTGTCAGGCAAACGTTTTTGTGGAGTAGCTTAGATGTCTGAATCCAAATTCTCAACATGATATCAAAT
ATTTTCTCCAAAATTATTTACTCCAAATCGCTTGTATCACCCTGGCTGGTGAAACCCTGAATCTGTTTTGACGGCTCCTA
AGCTCACAGAAGCGGCTTATTAAGCCATGGCTACCAGCGTGACGCAAATTTGTTCCAGCTACTCATCACGGTTGAGGCGG
TCTTTGCTTTTTTACTGATCTCACTTTTGTCAGCTAGGCGCTCTTCAAGCACGAAACGTCAGTAAGCAAAGCAGTGGATA
CGCGCGAAACCATCTTATATTTTACCTACTGGGCGGTGGTCAGCACACGATGCCGGCCGGTGCCATCATCTTCCATGTGT
AATATGCCCGCGTAGACAATATTGACCCAGGCCGAATCCTTCACTTTGGCCGCATCGATGCCGACGTGGGTCTCGCCTAA
TTTGAGGTCGGTCGGGCCGAAGAGCATGTTGACACTGATAAACGCCTGCTGTATTCAAGACTGCACACTGCTGGCCTTGT
GCTGGGTGCCGCAGTGCGATACTTGCCTGCAGCCAGAGTGGATGGCTTCGGCGAGTTGAAGGTGTCGCATTACCTAGATT
CTGCAGCATGTGATTTTTGGGCGCGCACTGGGGGCCGCTGGCAAAAGCCTAACCAAAGAAGTTGAGGACGACTACATCGC
CCGCGCGATGCCTGTCGAAATCGAATGATGGGACGATGCTAACGAGAACTTTTGGCGCAATGGTTTTGAGCGGTTCGTCC
CAAACAAGCCCCCGTCTGGGTCAGCGCCGGGCGGAAAGCTACGTTTGGTCAAGATTTTGGTGCCGAGGTCTACCGTGTGG
TGGAAGACACGTTGAGACAGCAGACTTGTGTGGCACCACTACAGTCACCAAGGTCTCGCGGAGCAAGGGCATATCAAGGA
TCTCGTATGCTCTCCAGTAAATGGTGCCACACTGGCAATACGAAATAGCGAGCAATATATGATGGATAGCAGTAACGAGT
GTTCCGTACGGAGTACACTCCTGAGGTAAGAAATACTTCCAGTACAGTCATTATGTGCGTAACGCCTGGTTCATACTATT
CAGTTAATACAAGCAAATGACCGCTACCATCTCGGTCCCATCCCAGGTCGGCCTACAGCACTGATACGAAGTCTTTTTTT
TCGTGGGAGAGGTAACTGTGCTTCGAGTGGAGAGTCCGGACGAGGAATTCCAGGCAGACCCTCATCTGTGCCGCTGCTTC
GATCAAGAAGAATTTCGCCGCGTTCATCCAAAATGTGGACATCAATGCTGTCATCCAAGGAGTGTAAGGGGCCGTGAAAT
TGCATATCATCGAAAACCTGCCGATGAGGCTTGGTGCCATGCCGACCACCAGCCATGGATGCGCGCAGGGCTCGGTTCTC
GTGATGATCGGTAGCAGGTGGACCAATTGGCGACGGGTCAGCTGGTGTATAAAACAGATACGAATCAGAGCTCTCAACGC
TTCCGCTACACCCATCATCAAGCTCCATCGAATAGTTCATAGAGCTTTGTTCGCCGTCAAAGATGTGAACAGACTGGCCC
CCGACGGTACTGCCACCTTCAAAGTGCAAGGGGAGGTCCCTGGAACTAGCGGAACTTCGATCTGCTGATTTTAGCCGCAC
TGCTTGTAGCTCAAATGTCGAGTTGCTACTGCAGCGGCGAGGTGGCCGCGGTACGGCCAGTTCCTGCTCCTGACTTTTTT
CATACTGGGATATGATAGCTTCCCGCATCGTCATTTTCTTCCGTCGCAGCGCTTCCAGGAGAAGTTCCTCTTGTCGAGTC
ACAGTCATGACGTGACGATAAGTGCTACTGCCACTTCGGCTAGAGCCAACAGTGCCAAAACTGTGGCCCGAATACACAGA
ACCTTGATCAAAGTCTGGTCGCAGGCAAAACTCAACACTCGTTGGTGAAAGAGGCGGTGTCATCTGGTCAGATGGCAAGT
TGCCATCTTGTGTTGAAGGCGGTGTGCAAGAAGCACCCTGTGCGGGAACCAAAGTGATAGCCCGAGCCTCTTGGACGGTG
TAGCTGGGCGGGACCAGGGAGCTGGTGGTGTTGCTAGACGAAGCCGAGGCCCTGGATGTGTGCGAAGAGGAACGAAGGGA
AACGGCAGTATGTTTCGCAGTGTGGGCTGTAGAGACCGAAGCAGCACTTGGGCATGGTGGCTTGGCGGCCCGTGGCTGTC
TATCCGCAGACGGAGATGATTTTACTGAGAGAAATGACATATGGCTGTTTTGACCACACGATACAGGCTCTGTGCTTCTA
GGTCGGCTCCTCCATTTCTTCGCGAAAGATGCGCTGCGAGAATTCAGAGATTGGTGATCGTCCGAAGCCTGAGTGTCCTT
TTTTGTTGGCAGCGACTTTCTGATAGCGGGAACGAAGACCTTTTTTTTACTTAGAAAGCCATCCTCTGAATCAGATGAAA
GAGAAAGGACACTGGTTTGTTGAAGGTCGGCATCTAACAGACTCCGCGACGTCTGCCTAGAAGCTTTTGAAGTCCGGGTC
TGGCGGCTCGAGACACTTTCTGAACAATCAACCGGCGAGTAGAGACCCGGTACGCCATCCTTATCTGTTCTTGGTATCGA
TACAAGATTTGGCATTGCCATGTCCCTGGCAGAAGACGTGAAACTGATTTTTTTTGGAAGTTGGAAAGCATAGTCAATTT
GGGATATAGCCGCTTTTCTGAGCCAGTCCTTTTCCAAGGGCCGTTCTTCAGGCATGATTTCCGGCATATCCGAAACGGAG
ATGTGCTCCTGTGCAATAGTATCCCGGATAGACATCTGCTCGTAATGTTCGTAGAGGTTTTGCAGCCCGCCGGCCTCCTG
TTCAGACATGCCCTGGTGTTTCGGTTGCCCGCACTTGAAACCTAGGTGATTGGTGGGATCGCGGCGTACTAAGCCTTTGC
TGGGCCGTTTCTGTAGCTTCTTCTCGTTGCGATAGTCATCAATGTGTCTAGGCGCGTACTCCAGACGAGAGCTAGATAGA
AATGAAGGGGATCGGGTCACCACATCGGGCCCCAACACGAACCCCCGCTCGGATGACGATACAGCTAATACCGGATTCGA
TGGCTTCTGGCGCGGAAAAAGGTTCGACAGGTCGAGCTTAGGCGGCCTTGACTTTTGCTTGTCGTCGTTGGCAATAGTGC
CACTAATATCGAGAAGATCACTAGCCTTTTGCGGTAGCCCCTTTGCCATAGCAGAGCTCGATGTCTGCTGTGAAATGATC
AGAGGGACTTTGGACTTGTCATAATAGGAGGTGATGGTGGAGCTCGACTGTTGCCGACGAAGACTGGAAGCATCTGTAGT
AGACCGCTCATCAGGTGTATTTCTGGCGATGTCGCCAAACCAAGGATCTTTTTTATTTCTTGGCAAAACACCAGACTCCT
CATCAAATAAAGGCTGACAGTACGTCGTGCTGTTGACAACCCTATTTTCGACCAAGCTTGACAAGGCTCTGTCGAGGACA
CTGTCGTCTTGGTCGACACTGCTCTCAGAGAGGGATATACTGATACAGGAATCCGACCTGGCGTCCCAATTTCTCGCAGC
ATCAGCTTCTTGGCTTGCATAGGCATCAACGTTTATCTCAGCTGTTCCCAGAAATTTCTGGACCTTGTTCAGCGGAGGCG
AAATGACTGAAGCTGCCGCTTGTTTCTGCCTCCGCCTCGGTACAGGGAAACTAAACCGAGGCATGGCTCTGAAAATATAC
AAGAAGGCGGGAAAGGCCTACAGCCCCTTTGCCGTTTCCTCTCACTAAAGGCGTCGACGGAAGGGTCCTAAGAGCTCGTA
AAATATATCAGGCGACCAGTCCGTATGCCGTTATCAAAGCCACGAAAAATGGCGATTAGCCGATCAATGTTTGTCTTGGC
CACCCACAGATCACAGAGGCCGGGCAGATGATGGTCAGGCTGCGAAGCTCAAGTTTCTGGTCGACCGGTAACTATGCGGT
AGCGCTACAAACACGATTGGCAATGTGAGGCCCGGTCAGATTTCCATGTCGTCTCAGGCTTGACGGGTCAGAGCTGGTTT
TGGTTGCGCATCGTTGTAAGAGAAGTGCGTCGTGGGCAGAAAGACACGGACACTATGCGATTGCCGAGAACGTATCTTAC
GAGGACGTGCTCATACGAGTACGGAGTACTCGCAGCACAATATTTTAGCGATGCGGTGTGTCGGTTAGTAGGGGCTGGAA
GGGGTCTTGAAATGTAATTAAAAAGAAATTGGGCACACGATAGACGAGGCGGAGGAGAGACTGGAGGTGGAGAGACGGCC
GGTCGTAAAGCCCAGCAGGCGAAGCAAGAAATATCCGAGACACGTGCTCTCCACAGCCGGAGACGCAAACCAAATCGGCA
CGACAAGAGAGGACAGAAATGAGAGAGGGGAAGATACTTTTCTGCGTTACATGCAAGAATGAGAACAGCGACTCGCTAAT
ATTCTATTCGAATATTCTCTCCTCATGTGGGCATTCTCCACCGACATAGCATCAGCTTCCTTCCCGTGACCCATCTCGGC
CACGCGACCCAGTATAAAAAGGGGACTCATCAATACGGGACATGGGGGACAGAAAGGTAATCTCTACGGGGTACGGCCAT
AAATGCTTTGCTGATGATTTGTTGCGTGGGTGGCATCCGGAGGACCCACAAAAGCTTGGCCCCTGGCAGTCTGCAAGCCA
CCCCGGAGAGCCGCTACGACGTAAACTGTCAGGCTTAAGATACGATGTGTACTATACTCCGTATGGAACATGTGAGCACC
TAATTGATGCATAGTGCGCATACAAGCGATGCGCTGCTGTAATCGTACGGAGTACTCGTATACCAGTGTGCCAATATAAC
GTGTGGGACCGGTTAGAAACATACGCTACGCGACATTTTTACTACCATGTAAGATACTTACATAGTACAAGGTTTCTTAC
GTACGAATGGTTTTCGCACGCCACGTCTTAGCGTTGCTTTACGTACTCGTACTCCGTACATACCGTTTACGGATAGGTCG
AGCGTTGCATTTCTTATCTTACCACTATTTTTGAATCGAATTTAGGGGACGTATCTTACGTGTGATAGTACGACGTACTC
CGTACGGAGTAAGTCGCAAAGATCAGGTAGCAGGCATTGCGACAGCCAGAGCCCTTAATCATGGGGAGCAATAGCCACTA
CGACGTAAATCCACTAAATTATAGCTGGGGGCCTACTCCGTACAGAAACCTTCCCAAAAACAGAATAGGGTTCAAGTGGG
ATACGAGCACGGAGTTGGAAACGGATTAATAGCCAGTGGGTCCATGAAATCAATGCCATATTCTCATTCGTATCTTACAA
GGTAATATTACATTCACAGCACTCCGTAAGATACTAACGGAGTACGGAGTAAGATACATAATTGCACGAAGCACACCCCA
TAATACAGCCAATGCAAATCGCAGCAAGGAACCGGGTTTGGCAAGCAATCCGGTATGGTTTTCTGCTCTCATTTGCCGTC
CGCATAACCCCGAGAACAAGCCAGTCAATGCTAGCTGTACAATCTTAAGTTGGCGTCCAGAATAACAAATGCATTAGGGT
CTTTGACAGCTCTCGTGGCATCAGTCTAGCTACATATTTCAATCAGCCAAAAGGACGAGGCAGCCGGATAAGCTACGAGG
TGTACTCCGTACGGAGTCCAGATATAAACTTTTCCAGGACTACTGCAACCAAGCTGATTTACTTGATCCAGCAGAAAGTA
GTATATGACTGCATGGTTTCATGTTGTGCTGTTGCTTAGAAGACAAATAAAGAATCTGAAAATCTAGTGGCATTGCCCGA
ATGTTCTTTGGAGTATCCCCAGAATCAGTGTCACGCTTACATTACTAGTGCTTTGCAGATATACGGACAAAACATAGGTA
ACGCTGCCGTAAGGCTGAGTAGAGGGGGATTCCTCTTGATTACGGAGTATGCCTGTGCAATAACGTAGCGCTAAGGAGCA
CATACTGCTGACCTGTAGCCACGAATACATATCTTACATATGTACCAACCGTACAGAGTAAACAGCAAGATATGAGATAG
CAACCACTCCGTAAATGAAATGGCTTATCTTATCTATTACTTAAGTATTCTCCCCACAAGAGGGCTGAGACAATATGGGA
AAGAAGAAAAAGGGAGGGAAAAAAGTGTGAAGCAGTTGCCGAATGGGAGGCGCGCAAGTCGCCACAGCTACTCCGTAGAT
AAACTGCACCGTAATCGCGCTCTGATACGGAGTACTGAGTGGCACTTCCGACACTCTTTCTGTCTGTGTTCGTGAAATAG
ATGGTAACGTATCATTAACAGATATATGTTCAAGGGTTGGGTTTGCAATTGGTTCAATGGCTTCCTTGTCCAAAGGCTCT
CTCGTGTCTAAGATGCGTCCATTCTCGGTAGTTAATATAATCAGTATATATCTTGTGTATAACATATCCAGATTTGCTAG
ACGTTTTGAATGTTATTACCATTGTTTGGTGGGTGGTAGACAGTTGGGCGTCAGGCGAGGAGTTACTCATATCTTACATT
TTTTGGTTGGCGTTCCCGACGTTGCCGACCGCGACAAGCTAGGCCGAATAGCGGACCTCCCGAAAAGTCGATGACGGCAT
ACGTATATACGCCGCCCTGAACTTTCATTCTTTATCTTCTCTTCCTTGATCACTTTTTTTTGTTTCTCGATTTTTCTACC
CAAGATCTGCTGGCGAGCCCTTTTCCCTCGTGAGCTTACCACCTTTCTAGTCAAGCTTGTCAATTCGCTCATTCCCGTCA
TTGTATGCATTTCAAGCTGACTCAGCGTTGCTTTACTCTGATACTGTTTACAGCGATAATCGTTGCAACCTTCGCAACAA
AGCCCAAGCGCGCGCTTTAAGAGCAGTTTCTCTCCCATACGAAGCCATTGGCGACAATTGGCTGGACCATGGCGGCTCTT
TCAAACAAAACACCTGATTTCACGACGAGCGACTATGTCAAGTTCTTTGGAGCGGGTGCCCTCGCCGCGACGCTGACACA
TGGTGTATGAAATGGCCGAAACCCCTGCCCTTGCTTGACCCACTCTGCTCGCTTCCTAACTCAATATACATAGGCGGCAA
CACCTATCGATGTCGTCAAGACCCGCATACAAGTTGACGATGCCATGAAGGGTCTCAACATGGTCCAGGCCGCCCGCCGC
ATTGCAGCTGGCGAGGGTGCAGCTGCTCTGCTGACGGGATTTGGTCCCACTGCTGTTGGCTACCTGATCCAGGGTGGAGG
AAAGTTCTTCGGATATGAGTATTTCAAGAAGCGTTACATCGATCTCGCCGGTGGGCTTGACCATGCTACCAACCACCGCA
CGGCCATCTACCTGGGCTCCAGTGCCAGTGCAGAATTCTTCGCCGATATTGCTCTGTGTCCCCTCGAAGCAACACGCATT
CGCCTCGTGTCGCAACGTGGCTTTGCCACCGGCCTTGCCTCAGGCTTCATTCGCCTCGCTCGCGAAGAGGGTCTACGTGG
CTTCTATTCCGGCTTCGTTCCGCTACTGTTCAAGCAGGTTCCGTACGCCATCGGCCAGTTCTCTGTGCACGAAGCCGCCA
ATGAGGGCATCTATCGTGCAATGGGAGCGGAGCGCAAGGCCCGGTTAACTCATTTGCAGTCCACTGGTGTCGAGTTGACG
TCTGGTGTCATTGCCGGTGTGGCTGCAGCGGTACTGTCACATCCAGCTGATACTCTCCTTTCCGCCATGAACAAGGGTGC
TGGCGATCCCAAACAAGGTGTTCTCAGCCGCATGTTCACTCTTGCCGGTGAATTTGGACCCAAGCGCCTATTGCTCACTG
GGCTAGGGCCGCGTGTCTTTATGACGTGCGGCCTGGTGGCGGGACAGTTTGTCATTTATGCACAATGCAAGGCGCTGGTG
GGCGCACCGCCAAGCATTGAGATTCACAAAGAAGAGAAGCTGGGAAAATAGACAGTTGGTATAGACACAGACATTTAAAT
AGGTGGATACCGAGTTGATATTGCTACATATCAAATTTGTCCCAATACAACTCTTATGACTTAGTTGAAATGGGCGATCA
GTTCCTGATTACATACATTTGCATGTTATCAAGGAAAAAGAACTTCCAATCATGTCAGTAATTGCTACGTCACTCGGACG
AGAGTTTGATTGACTTACGCATGCACCTGCTCCCGCATGTTATGAAAATGATACATTTGCTAAATTGTGAGTTCCAAACA
GCTACCTTAACGTTTTTCTCTGACAGGCACAGGACGTTTACAGAGTACAGCAAGACAAATATATGACTTACTGATGTAGC
CTCTCAGATTGCTAGTTCAAGCCAGTGAATGCATTTGCCACTCCCAGTGTCATGCATTTATCCCCACATAGAAATGTATA
TAAAGGCCCAGAGGGTTTCCATAGCTCGTAGCAGTATATAGTGTAGTGTTTCTTACGCTGTCCGTAATTACAACCCCGCC
GGTTTTGAGCAGAGTTCAACAAACACGTTCCAATACAATTTTACAATCAAAATGTCACGCAAGGACGGCTACGACCATCC
CAGGCCAGCTGGTCCTGTCCCTCCTCCAAAGCCTGATGGAAAATAGTTGGGCGAGTGCCGAGTTCTGTGTTTGCCTCCTT
GAAGACATCACATAAGATATTGATATCGTATTGAGTCAGGTTTTTCAATGACAAAGTTGTGATTCATGCTCGAAAATAAC
TCATAAGAATAACGTGTGATAATCCGCAGTAACCCATTTATCTGCTTCCATCTAAAAATGTAGGCTTGAGCATCCTGCCG
CTATAAGATCTCACAATAACGGTATCCTCTGTAGTAAAATGAATACGATCCAGACGCTTCGTGTGCAGCACTCAGTATGA
ACCGTTAGTGTCTCACTTAAAGTTTGTAGACCTTATAATACATATGTTTGGACGGGTAGTTAACCTGAACAGAGTTTACA
ATAGTACAGCAATGGTGCGGAGATGTGCCAACCAAACGGCACCTTGTACTTAGAGGAAAACAATAGGAAAGACAAGTGTC
ATGATTTGATGGTCCGGTTTTCTGAAATATTGACCATCCTTCAGATTGTGAACACTTCCGGCCTAGTGCCAGAGCCGGGT
GACAGCTCCCAATATTTCTTCAAAAAAAGAAGTATGTGACTACCAGTACACAAAAACCTCAACTTATGCCAATTCCTTGT
AAGCTACTCCCCATTCTGCGCTGCAGGAACGCCTGAACTATCAATAAGAAGCCCTGCGACAAGAAAGGACAGGACGATAC
AGATGTAGAGAAAGCTTCCCAAATAGACAGTATATTCTTAGTGCTGTTGTCAAGAACGTTCGTGAGTGTTGTGAATCTCT
GAGGGCACTCATGAATAAATTGCTAAACTCACCGAGCAGGAGCTGCAAGAACAGGCTTCGCAAGAGCCGGAGCAGCTAGA
GGCGCACGAAGAGCAGGAGCTGGAGAGTTAGTATTATAATACCTCAGATAATGATTCGTAAAGCCACTTACCAAGGAGAC
ATTTCAAAAAATATAGTTGAAGAGGAGCGAAACTGCAAGCTTCTGTAGTCGTCAGGGTGCTTTGGCTAAGAATTAATTGT
CTGGAGATTATAATGGTGAAGGAAAAGATATGAAATACCTCAAAACTACTCCATACGAGCTGCGGAGTCGGTATTATATA
CACTATGGGGCTCTGGGAGAGTACCCGTAGACAGTCAGAGGTGGTACCACACCTTTACTACGTACATGGGAGCAAAAGCC
GGTCATACGACATAAGACGTGATAAGTAAGACACGGAAGCGAGCGTGGGGCTTTGTTCTCGGCGACAAGTTGGGCATCGG
CGTGTGACTGTTAGCGTTAGTGGGTGCAATATTATTTGAGCTACTGACCTGTTGGTACGAGGAGCCTTCATGTTCGTCAA
GCGGTCATTGAAATAAAGGAAGGGGGGTATATTTGGTTCTATGATTTCGAAAGCAACCTGTGACGTGAAGCCTATGGATT
AGATAGTCAGGCCACGTAAATCATCAGTCGACCAGATTGTAATCCCACGAAGGCAAAGTTTCGAAAGCTCAAAGATTTTT
TTACCACTATTGATTTGAGAACAATTACATCATGAGTGAAATAAGAAGGATAGGGCACTTACCGAAGGAATATGGACGTG
CACTGCATGAACTACATCACAGCATGTGAAGGTAGGGTTGCTATAACCGGACCTCAATGATATCATTGGTTGATAAACAT
GACCATGTTGCGGCACTGGCGGCAGATTGTTTATGATTCCGCACTCACGGCAGCTGCATACTTGCTTTGTTGGCCGACAG
TGTCGGCGTTGTGAGCGCCAAGCGCGGTTGCCTGAAGAAACGTTGCATCTTTGGCTAATCCAAAGCTGGTATTACTTAGA
TGTAACCAAAACTCCTAGTGAAGTGAGAGGGTGAGAGCGTGGGAGGGCAGCTTGGGAAACAGCACGGGATAGCACAACGA
AAAAGAGAACCCATAACGTAAAGTCATGTTTGAGATTCGCCGTGTGAGAGACAGTATATGCTAGGAGAAATACTTGCAAG
GGCAATAGTGATATCGACACTTCCTCAGACGTGGCACCTGATCTGATAGAAATAAAGGAGTGACTATAATTGATTGCCGC
TTTTAGCAGGAAAACTGCTTTTGATGCCTAAATAACTTCTAGCTGGTATACTCTACTCCCTGTTCCTTTCACTATCCTTC
ACTAGAAGCGTAATTAGGACATGAAATGCGGCGGGAAACCTGCAGGGACGTCTGAGGGATAGAAAAAGGAAGACCGAGGC
AAAAAACCAATTGTGTGGGGGGCACAGCTTGGTACGATAATTGTATGAATTGGGAATATGGGAAAGGATTGAGCGAAGTG
TGTGAAATAAAAACAGCCAGAATTGTAGATTCAGTAACGCATCGGTCGAAAGGCGATAAAGGACTGGGTGACGCTAATAA
TGGACGACGATTATGGAGAAGCCCTATGGAAGTGATTGGATATACCAACATAATTCCAGAGCAGAAACAGTGAAAAAGAC
ACCAGAATGTTTCGAAATAACAGAACTTTAGTCAAATTAATTGAAAGCTGGGTGCTTGACTCCAACGATCAACTGATAAA
GAAAACAACACAGAGAAAAGAAGATAGGCGTTGAGAGGGGGACTTCTGCAGTCACACCAAGAAAAGACGACGCAAAAATG
GCAAAGCTAGATAGGTTTGCAGATTTTGCACGTTTCTTCCTCACTTTAATTTATATTGCTTGCTAGCCAGCACCGCTTCG
CTGGTACTTTCGACATATGAGAACCTTGATGGCCCAGTTCAAGCTGTAGCGCAAATTATATGGATTGAGCGGAAAGGATG
GCCAGCATAGGAGCAGGCACATTTCATTTATCTATGGTTCGGTCAAATGCCTATAACATTACGGCTGATGAGCACATCTG
CCACGACATTTTCTTTGGCAAAAGTGCAACTTCCTGTGGCCTTGTAAGGTAATCCTTTTGTTTTTGATCCGAGCGAGAGA
ACGAAGAAAAGCACCACGTACTTACAACGACTAGGAAGGCTTTAGAATATGTGGCCGAGCATCTTAAAAAGCTACCCAAT
AACCACGACCGGGGGAGGGTTTCGCCCTTCCGCGGCGCGCTAGTGGGAAGAGTAGAATTGAGCGGCGGTGAGATCGACGA
GGTCATGTTCAATTGTAAGGTACAGAATCCGCAGTTCTACTATGTACTTCGTACTACGTATGTAGCTTATGAGAAGATAT
TACGGAGTAAAACAGTCTATGAAGTCGCAATCTCAGTGGAGTGAGCTTTTGACAGAATTATAGTTTCTACAAAGTACTCC
GTAAGATACGTCCTACCTATACTCCGTAGTGTACCCCTCTTTATTTAGCGTGATAGGTATGGCCGAGCTGTTCGGGGCCA
TGCCGTCCTCTTTTAGGTTTAATGCCTGCATCAGTCGGATCTTACTGTTCAAGAGGCGAAACCGATGAAAAGATATGGTA
ACTGGTATTCGTCAAGGGTGGGCCTCGTTGGTCAGAAATTCGTAGATTCACGCCATCAAATTAAGTCTAACCTTGGTCAG
ATTGATTTATCTCGAAGGAACCCTCCGTGAACTAACCAAAGAGGTTTTCCAAAGCGGTGGTAAGTAGTGGTGATGAACAA
TATCTTACATGGTAATATGCACCGAAGCCGCTGAGTTTTGCGGACGGAGATACTTAAAATAGGGAAATATCTTATTTTTA
ACAGACTTTCCTTCATGTTCTTTTCAAGTGTCTCTTCAAGTTTGGCTAGTCCTTTCTGACTGGCTCAAGCGGCTGTATCT
ACATGTCTTGCTGCGGCGTATTTAAATGGGCGAAGAATCTTGAAAATTGAGGTGCTGTGAGAAGAGAGATCGGTTTCAAT
GCCGGAGATCTTGAAAACAATACTCTATACCTGGGGACTATGCCTCGAAGCGTTAGTGCCTTGAAGAACGCTTCTTTTTT
ACTCTCAAAAAAAAAGGTCAAGTCAGCTTCCAATTATGATTACTGTTTGCCTCGAGAAGATTTGTCGTTTAGTAACTTTG
CCTCTCCCAACATTGTTTGTATCAACTGGAGGTTCGGATTCGGGTAGCAGTCACCTAACATCCGTAAAACATTCCCTAGT
AATAAGACAGCGCCTTAAGTACAGAGCACAACGCAGGATTACAACACAGTAAGCCATCCAGTGCCATTTGACCTACTAAA
ACAATCAGTAGACTCTGAAGGGTGTTCCGTACAGATCTTACTCGAAGAGGTCGAAGAGGGCGCAGAGGTACCAATTACTG
CGCTGGTTTCTAATGGTAAGATACGTTGCAAAGTTGAGGCCACAGTACGGAGTACGATCAGTACGATACCCATCAAGGTT
CTCATCCTTCTTGCAGGAAAGCGGGGCAAATATTGCGATATGGGAAAAGCTACGGAGTACTTTGGAAAAGCGGTTGGGAG
CAACAAGAAGTGGTGAATATGTGTACCCTCCACTGGCCCCAAGTCTAAGTATAACTATATTGCATTATAGGCTATACATG
GTAATTTCTTACCGTATGCAAAATATTGAAGAGGCAACAATTTGCTGAAAAGTAAGCTGGACCACTCATGCTCAATGCCA
ATGCTCAATCTGGGAAAACAAGCTAGGTCTGCGCTATAGACCATGGCTCGAGGCCAACAAGGTTCAGCGCTTAGTCTGAA
AGAGAATGACTTTCGTTTTCGTTCGTATCTTTCTTCGTATTTTTATATATGTATATATAGGTTGGGTATCTATAGTTTGG
GTACGGTTGATATATTCTATACATCTTTGCATGCATCATACACATCGTGCCAGAGATACACCTACTCTGCTCGTACCCTC
TCTATCAACTTTTGTCATTTTTCATCGAAGCCTCGTGCGTACCGTACCAAATTGTACGTATCGACAGTTCTATTTTATTA
AACTTGTGAGAGGCTCCCCTTCAATCTTTTTGCTCTTTTGTCACATCCGGTTCCCTCAGCGTGTATTTTCGGGATGTCCT
ATTTTTCACGGCAGCTGTTTGCGAAAGCCTAGTATCTCTTCGTCTAGATGGATTGCATCCGACTCAAGGCGCATTTTTAG
TGCAGTTTCTGACAACAGCCTGGTATAGGATTGACTAAAATTACAATTTTATACTGAAGAATCGATTGCCGAGAAGGCAA
CCGCATGCTTTAGATTGCACACAATGGCCGATAACTCGACTCTCTTCAACCCGTCTAATGTCGACCTCAACACGGCTGAC
CCGATGGAAATTGTATGTTTTCTCAAGTCCGGAGAAAATGACTATGATGGCCGTCTCGGAGCCAGGATTTCGGCACTTTT
TGTCATCCTTGTCGTCTCATCATGTACCACAACTTTCCCTGTCGCAGCTACACGTGTTCGCTGGTTCCGTGTCCCACTCT
ATATTTACCTATTTGCCCGATACTTTGGAGCTGGTGTAATCATTGCCACTGCCTTCATCCATCTTCTGGATCCCGCATAC
ACTGAAATTGGGCCCGCCTCGTGCGTCGGAATGACTGGTGGTTGGGCCGTATACTCATGGCCGCCCTGCTTAGCTATGGT
CTCTGTCATGCTCACATTCTTACTGGACTTCCTCGCTGAGTGGTTTGTTGAAAAGCGATTCAGGCTCAAACATGGCAACG
AGGATATCGTCGAAAGCACTATCACCACCGCTAGCGCACCTGAACCCCGAATTTCACAGTCCCACCAGCACCTCCATTCA
TCCGACCAAGACAACACACCAGCAAAATCTGGCTACAGCAACGAGCATGGCGTTGATGCGAAAGTTGACGTCGAAAATTT
CGGAGCTGCTGTTGCACAAGATGACATTGCTTTCCGTGAGCAAATGGCTGCATTCTTAGTTCTCGAATTCGGTGTTATAT
TCCATTCTGTCATTATTGGTCTCAATTTGGGTGTTGTGGGTGACGAATTTGATACACTCTACCCAGTTATCGTCTTCCAC
CAAGCATTTGAGGGCCTAGGCATCGGTGCCCGTCTCAGTGCTATCCCGTTCCCACCAAATTCAAGCAAATTTGTGGCAAT
TATGCCATGGCTTCTCTGTATAGCATATGGCCTGACTACTCCTATAGCTATTGCGATTGGACTGGGAGTACGGAACACGT
ATAACAGTGGCTCATTTACAGCAAACGTTATATCAGGTGTCCTAGACAGTATCTCGGCTGGCATTCTTATCTACACCGGT
CTCGTGGAGCTACTTGCTCGTGATTTTCTTTTCAACCCTGAACGGACACGCGATAGCGCTCGCGTTACATTTATGCTCGT
TTGCCTATTTTTAGGTACAGGCATCATGGCTTTGTTGGGCAAGTGGGCTTGAGGCTGGTATACTTTAATGCTGGTTCGTC
CCTTATGGATGACTATGATATAGTTGTCGTTTACATGTATGAAGTATTATGGCATCTAATTTCGCTTTGCTGTATCACCA
GCCTACTATATAGCGTTGAACGCCCTGCTTTCGGGTGCCTGTTAAACAAAATCACTATCTATACGACATGATTTGCAGTA
CGCCGTAACTTTGTTCTTTTTCACAAAGATTTGAAGTAAAAACGCGCTTACCGCAGATATCCTTACGGTAATACCCGCGA
TTAGTGTAAAGATATTAGTGGCAACACTCCGTACGAAGTACAGAAAACGTAAACAAATGGCAGCGGAAAAGAAGGTAATA
TGGTAATTTCGATGTTCCGTACATATTTATACATGCATCAGAGAAAAAGAAAGGGAAAGAGTTTAGCTGCATAATAAGGC
TTCAACTTGCTTATCTGAAGAAAAGTGCTAAATGCACCATAATTTTGAAAATTTATATTTGTACCGTAAAATTTTGGCTA
TCCGTACCGTACGGAGTACGGATTACTGCAAGAGGCCCATATAATAATTTACAGATTAGCCAATTAGCCCGCACCTTTAG
CTTGTAGCCTATTCTTAACAGCTATACTCCGTACTCCGTAGCTATTATTACGAAGTATAGCACTGAACTTACTGCCAAAA
TACTACACTTAATCTCATATAATCTAGAGCACTATACTAGCATTTCAATGCTTAAGATATTGTTCCATCCCGGCTTTAGT
AGGAGTAACTGTAATATAAAGATGCTTCTTAAACGTACCTTCGACAGCTTGGGCCTGGCAGAAAATACAGCGTAAGCTGT
ATGTAGACTAGTGCACTTTTTTAACGTATCTTACTATGTACGGAGTACCATTTCTCTTATTAGTGGATTACGGTGCAGAT
ACTCCGTAATACACAAGCAGGCCAAGAAGTGCCTGAAATAATTTTGGCTGTCTGTTATACGGAGTACTTCCATATTTTGA
CTAGCTCCTAGACAATCACGTGTACTTATCCGTCAAACTACAGGTACTCCGTACAAGCTAGGCTGATAAGACAAAACATA
AGATAAAGAAAATCTAATGCTGGAAATTTTCTTGTTTCTTGCGTTCTTACAACTAAGATAATCACACTCAAACCTGCAAT
AATGCGGCCACTTACAGAAGCAGAGACGCAAACCGTCTTTAAGAAGCTTGCCGACTACACAGGTGCTTCGCTCAAGAATT
TGATTGCTCCGTTAGACGACTCTCCCGACGCCGACCGGCATGTGTTTCGGCTATCTCAAGGTCGTGTGTATTATGTTTTG
CTGTCGTTAGCCAACTTGGCGACGTCTGTAGCGAGAGACAAGCTACTGTCCCTAGGGACCTGCTTAGGTACTTGAATCTA
GTTTACTGGCTGTGACTACCCGTCTGGGTCGTGGCACGTGTCGCTGACTTTCTTGTTTGCAGGCAAATTCACCAAGTCGG
GCAAGTTCCGGCTCCATATCACCGCATTGCCAGTTTTGGCTGCCCATGCACGATACAAGATTTGGGTCCGACCCAATGGC
GTCATGCCATTTCTGTATGGGGGAAACATTCTCAAGGCTCATGTCGGCCGTTACTCGGAAGACTGCCCAGAGCACCAGGG
TATAGTGGTTTGCACTATGGACGACATTCCGATTGGGTTTGGCGTCACAGCACGCAGCACTTCTGAGGCGCGGCGACTGG
ACCCCACAGCGATTGTCTGTTTTCGCCAGGCGGATTGTGGTGAATATCTTCGAGACGAGGACTCACTCTTTGCGTCTGGA
TGACCTTGCTCGCAGCTCGACAGACGTGAAAATGACCAAGGTGGCTACAAGACGGATTGAATATAGCACGAAACAATTTG
CCAGTGGCCCGCATAAGGTTGATACCCAGGGACACGATTTATAACACAGGATACAGGGATGCAGGCTCATTCAAAGAAAT
AAAAGGCTACGGAGGCTCGGGGAGCCTGATTGAACAACACAATAGGAGCAGCTTTTTTTTGTACTAAAAGCGACATTCAT
ACTGTTGGTCTGGTATGCCGCTGTTGAAGATTTCCAACATATACAGTGCTCTGTATGTGTGAGCTTCACTGCCAAACCAG
GATGGAGTACGTAACGATATTATCTCACAATTAGCATAGCATATTAACAGATAAATCATCACGTGGATGGAGTTCGAAAT
GCGATATTTTGTATCTTACAACTATTCCGTACTGCACTATGTACTCCGTAGTGTCTTTGTTTCCGGCAAGGGCAGAAAGA
TACGCAGTCGCAAGCCGCAAAACTTGCTGCATCAGCCCCATCTTTAGTAGCCAATCGACGACGCCGTTTGGGACATCGAC
TGGTCGCGACCGGCGGCAATACGTCATGGTCCTTTTTACTGAGATAACTCTTGCTGATAATACGATGCCCTTGGTTTATC
TCTTGGTAACTACTTGTATCTCAAATATCCTTCCTTTTCACATATTCGGTAACAATTACAGGCCTGCTCGATAACTCAAG
ATAACAACAATTTGCCTCTCTACGACGGCCATAATGAACAATTTTTTTGGATCCTCCGCCAGGAGCGACCATGATGATGA
CCGCAATGCTACACCCGTCTCAGCGTCTCGTGTTAGCATAGAGCAGACACCAGACGAAACTACACGCCTACTGCCTAACC
GTATTGACGGTCACGGTGTTAGCAACGGACCAAACCACGGCTACCTCAGCCCCGACGACCCAGCTGTATCACCATACAAC
CTTTTCTCTGTTCGAGCCACTCGCTATCTCACCATTTTCTTGTTACTAGTTACTGGAATTTGGTGGATACTGGTACTTAT
TTCGCACTTCGTTACTCCTCCAGGGTTTCAAACACGCGGGTCTCCGTTTTACTCCTTCGGGTATACTATAATCTCATTGA
CGAATCTCGTCGTGAGCTTGCTTTTTTTTGCAGCTCCTTCGAAACTGGTGCGAGTTATTACTGCAGGTATAGCCTTCCTC
CTTCTCATCAACACAGTCCTTATAACAGCAGTTACTCGGACACGGATTGAGGAAGGTTGGGTCGGAATATCGAGCGTGAT
CTGTATGTGTATCGTCCTAACATGATTAAAAAAGGAGGTACGCTAACTGACCTTGATATAATAGGGGCGCTTCTGATCAC
CATATGGACGATCATTGCAGATCGCACTGTACAATGGGGTAAGAGAGAGGAAGAAGAACGGCTGACAGGACGGCCAGAAT
CGAGGAGAACGTTTCTCGAGTGGATCCAGGTGTCCATCTCAAGCATCACTCTATTTGCTCTTCTCGTCGCCTCTATCCTC
CTGACTTGCACAGTGATTTTGCGTGCACTCGACTCCGGATTGGCTCCTCCCGGCAAACGGTTTTTTGTGGATGGTGAAAA
ATACGAAATTCATGTATATTGTCACGGCAGCAAATCCAAGGAGCAACTGCCTACGGTTCTGTTTGAAGGTGGTGATGATC
CGGTCGAAAACGGCTTGTGGCAGTTCGCTGAAAACGCGGTGAAAAACGGATCGATAAACCGGTATTGCTTTTCTGATCGG
CCGGGACTTGCCTGGGTAAGCCACCTTCCCCCCCCTTCCTCCTAGCCAATCGGTACAGGACGAAAAGCTAATTTGAGGAA
GAGTGATGCGGCACCCTCACCATTTTCTGCCGGAATGGCAACGGAAGCCCTGAGCGAAGCCCTCGCAAATGCCGGAGAGG
TGGGTCCTTGGGTGCTGGTAAGTGCCGGCGTGGGATCCATCTACTCGCGTGTGTTTTCTTCGCGCCACGGTGCCGAAATC
GAAGGGATGCTGCTCATCGACCCACTGCATGAAGACCTCCTCGATCGGCTCGGCGCATCTAGCCAGGGCTTTTTCCTCTG
GCTTCGAGGGATTCTCTCACCTCTCGGTTTGGATCGCATTCCCGGCGCCCTTTTCAAGGGACGCAACAAAGAAGACCGGG
TTTGGGGCCGGGCGGCATACCAGAGCAGCAAGGCCATATATGCTAAGCTGCAAGAAAGTCTTGTGGCAAGCTCGCTAACC
AGGCGCGATGTTGCGACTAGTCGTGTCATTCAATACCAGGACACGCTGCTGGCAGTGATCTCGTCAGGGGAGCAAATCCG
TCGGGATGACGTTTGGGAGAGCAAGCAACGCGACCTTACCCATCTCACACACAATCTTTTGGCATGGGACGTTATAGACA
AGGCACCACATCAAGTGTGGAACACACTCGAAGGTCGTGCTGCAATCGAAAAGCGCCTCAAGAAGATGGTGCATCAACTA
CCCAAGCCCATTGTGGATGGCCAGTGAGAGAGAACGCGGTGGACTCGGGAAAGGAAGAAGAAAGTGACAGTTGCGCAGTC
TTCTAGGCGCTAAAAAAGAAAGCCTTTTGTTGCGCCTGTCAGCCTCGGACCTGGCACCACTCCGTACATCCATTTGCAAT
TCGTCAGGGAGACAGGAAACGGGGACAGTGGGGGGAGGGGAAAAACAAGGACCGGTACGGAGTACGGAGTACGGAGTATC
AAAAACGGTGAATCTTTGCAGTTGCTTGAGGACTTAAATAACAGAAGAGGGGCGGCATAAAGGAGGATCCTCTAGACAGG
GGTGAGGGGAAGAGATGGGGGGAGAAAGGAATGCTTATGTCGTAGGTCAAATGTCACATTGTGTGGTTATTGTAATTATT
CTATTTTATTGTAAAGCTTCCGGGTTCTTAATCCTTTTTATTAATATTAACAAGGTAATATGAGGGCATACTGGCTGCTC
AGCAACAACCATGGAGCAACAGAAAAAGAAGGGGAAAGGCAGGAGCGTCCAAGGTCCGCGCACGGGCCAGGTAACGGGGC
ACTAGGCGTCTTTTGGATTAGCCCCGATATGTGTCGCTTCCCTTTTTCTCATCTCCCCCCATTTCTCCCAAAGCTGTGAA
GGGCACTCCGCCCCTCGACTTTACTTACTGCGCGTTGGTCATCGTCCCAACATCTCATCCCCGTTGCTTTGGTGCTTGTT
TACCTAGCGAGCCAGTTTTTAAAACGAAAACTCAACTACCGGAGTGCCGCTCCTGCACGAAAGAGACCCGTCGGTGCAGC
TGGCTACTATTGTTTTGCCAACCACAATTGTGCATGCGACCGGCTTGGCTTCACGTTTGCCGTTGCAGCATCGAGAAAGT
CAACTCAGCCTCGACATTTGGGCCTGGCTCCCTGCGTCGAGGAGGGCGGCAGCTGTGAGACTGGAAAACCTCTTATTGTA
GGTCGGGTCGGCTTGTCGTACCTGACCCTCTGCTTCTCTCCGCTCTCCTCTGGACCTGTACCCGCGACTCAAGTTCGACC
TCGACATCAATAGACGTCACATACGCGTCTGGCACTCTTCATCGAACCTCTCCCCCTGCGCGCAGCTTTTATATCTCCGG
CCCGACCAAAATCTGGTGGTTGCTATGATCGAATTGGCCGTGGTATCGCATCAGTTCAGTTTCCGATCTTTGCCGCACCT
TCAGACGGAACGGGAGTAGTCGACCAAGAGACACCAAACAGCTCGCTTACTATTGTTCCACTGAGTCATCCCGGCGGTGG
CCTACTTCAGTAACTGCGCACATTGCTTAACAAGCGTTGTTCTCGCCCAGTCCCTGAGATGGACCCAGAATACGAGGGCG
GTCCAGCCAGCGACCGCACATATGGCCATCCCCAATTACCACCGAATAATGCAGGAGAATATCCTATGGAGAGGCAGCAT
AGCAACGTGAGCCAAGGCCAGTCGTGGCAAAATAGCGGAGGCTACGGGCCTGTACCCGGTCGTCCGCCGGTGTCTCCTTC
TCAAGGCGATCGAGGTCGGAACATGGACCGGGGACGAGACCGAGAATTGGAGCCAAGACCAAGTAGTGATCGAAAACATT
CCCAACAGGGCAGCTCAAGGACGGCAAGCGGGCTGCCACGGACCTGTAACAAATGCGGCGAGCCGCTTACGGGGCAGTTT
GTTCGTGCCCTAGATGGAACATTTCACTTGGACTGCTTTCGGTGTCAGGTGAGTCACTATCTGCGAGGCTCCTGTGGTGG
TTAGGTCGGAGGTGGTGTTACCAGCTACTCATATATCAATCACAGGACTGCGGCCAAATTGTAGCGTCAAAATTCTTCCC
GGCGAGCGACACAAATGATGGCCCTCAGTATCCACTCTGCGAAACAGACTACTTCCGACGACTTGGCTTGCTCTGCTATC
ACTGCGGCGGGGCACTCAGAGGGTCCTACATCACCGCCCTGGACCGGAAATATCATGTTGACCACTTCACATGCTCGCTC
TGCTCGACAGTCTTCGGGGCGCAAGACAGCTACTACGAGCACGACGGTCAAGTTTACTGTCATTACCACTACTCGACGCA
GTTTGCTCAGCGGTGTAATGGGTGCCACACTGCTATCTTGAAGCAATTTGTCGAGATCTTTCGAAACGGCCAGAACCAAC
ACTGGCATCCAGAATGCTATATGATACACAAATTCTGGAATGTCCGGCTAACTGCGCCTCACGACGAAGATGGACAGCCT
CCCGTAGCAGAAGTCGACGAGACAGCTAAACGCACTCTTGTGCGTGAAGAAGAGGAAAGGATGGAAGATAAGGTGTATCG
TATATGGAGCGTTCTGTCTACTTTTGAAGAATCGTCCGCTGCCTGTATATCCGACATGTTGCTGCACGTCAGCAACGGTG
CCTACGTGGACGGCGTGTTGGTGGCCAGGCGGTTTATCGGACACGTCGAAATTCTGTTCCGCTCTGCCGACAACCTCGAA
ACGGCTATAACGAAGTTTGATTTAAAAAGTACGTGCAGCCCTGAGATTTTCGGTCCCCTATGGGTACATGTCTTGCTGAC
TATCATGCTTAGGTTTGTCTTACGGGCGTGAAGCAAAGTTGCTCTGTAAGAAGATTGTGGCCTTCTTCTCGCTACTTTCC
AAGTCGCAAGATGCTACGACTACGAAGGTTGGCGTGACGCAGGAGCTGCTATCTCTGGTTACCAGCCTGGCCCACTATCT
CAAACTCTTGATCCGCATCTGCCTCCAAGGGGCTCTTCGCATTGAAAAGGAACGGAACACGTCAGAAAGCCTTCTTGGGT
TTCTCGACGATGTCAGCGCCCTGGAGGCTATGAAGAATGAACCAGAGGAGGGGATACAGCAGATGACTGCCAAAATGGGG
CCTCTCGCGGCGAACAACTCAGACCACTGCGCGACCTGCCAAAAGTCCATTGAGGATGAATGCGCTAGGAACGGCGATAG
CCGCTGGCATCTTGCCTGTGTGGCTTGTGTTCAGTGCGCGACTCCATTGGGCGCCAAGCTGGGAGATGCCCGGGCTAGAT
ATGACGGCTCCATACATTGCAACAGTTGCGAGCCATCCGATTCAGAGAAAGCCATACCCTTAGATCGGGTCACCAAGCTG
CAGCAGTATGTTTTTCTTCTACGGGTGGCTTTGGCCAGACTGCTGGACATTCTGTATTCAAGCGGGGCGCTCTTGCAGTC
TTCGGATGCGGCGGCTGCAGCAGCGAGAGACGAGTCCACGCCGTCCTCTGATGTGCAGTCGCGAAGAGACGTACAGACCT
CGACAAGTGGCGACCCTAATCGGCCGAGAGAGCCGTCTGCTTACGAGAACACGCTCAACGACGTTCGAAGGCTGCGGAGC
ACCCGTTTAGACAAACACCTGTCGTCGAGTTTCAAAAAAACACGGACATCCCGCGTGATGGACGGGCCAGAGGGCTCGGC
TGCGCGGCCTGGCTCTTCCGGCGCAGAAAACGGACCGGCAAGCAGCGCCCGTCCCGGAATGCAGATTGTGGAGGACCGTG
TGGACGAGGCTGCTGCGGACACAATGCTTGGCCATCAAGACTACCTCACTCTAGACGACATACCTCGCATCGTAGCGGCG
GAGCAGGCTCGCGAGCAGCGACCTGGCGGACTCAACAACCGAGACTCGGTCATGGCCAGGGGTGGTCAGCTGACGGCATA
CTCCAACGACCAATATGCCGCCGATGAACGGCAGGGCAAACCTACTGCGGCCGGTCCTACGATGATCTCTCCACACAAGC
TTGGGGGGCGGAAGTATTTCTCTGAGCTGTCGGGCCTTGAGTATTTCATTGTGCGGCATCTGGCGGTGATGACTATGCAG
CCGATGATCGAGAGCGAGTTCTCGCTGGAAGAACTGTTGGACTTCATCGAGTCTAGGAAACCGGCGACATTCTGGAACAA
GTTCGGCAAGGCGTTCAAGAACGACAACAAGAAGAATGTCAAGAAGAAGGGCATCTTTGGCGTTCCACTCGAGATCATCA
TCGAGCGCGACGGGGCCGACTCCACGGACGGCGTCGGGCCTGGTACCCTGCGTATCCCGGCCATCGTGGACGACATTGTG
TCGACGATGCGGAAGATGGACCTGTCCGTCGAGGGCGTCTTCCGCAAGAACGGCAACATCAAGAAGCTGAGTGAACTGTG
CGAGAAGATCGATCGGGACGGCTGTGACAACGTCAACTTGGGCGGCCAGAACGTGGTGCAGGTGGCGGCTCTCTTGAAGC
GATACCTGCGGGACCTTCCCGACCCATTGATGACGCACAAGCTGTATCGCCTCTGGCTGGCCGCGGCCAAGATCTCGGAC
GAGGACCGGCGACGCCAGTGTCTCCACCTGACCTGCTGCTTGCTGCCCAAGTGTCACCGCGACTGCCTGGAGATCCTGTT
CTGCTTCCTCAAATGGGCCGGCTCCTTCCACCAGGTGGATGACGAGAGCGGCTCCAAGATGGATATCCGGAATCTGGCCA
CCGTCATCACTCCGAACATCCTTTTTCTCAGCTCAAAGGTGCCCGCTCTTGACAGCGACCCGATATTCGCTATCGAGGCC
GTCTACGTACTGATCAACAATATTGAGGAGATGTGCTTGGTTAGTTTGGCGTGTTTCTTTTATATCTTTCTAGCTCCTTC
ACATTCTAACTGCGTCAGGTTCCGGACGACCTAGTCGACGTCCTCAACGACCCGATGCTGTTCAGCAACAACGGCGAGAT
CACGACAAAGGAAATCCTAAAGCGCTTCGGCGACCGGACAGGCAACAGTGCAGGTGGCCGACCATACGGCCAGGTGGGCG
AGGTTATGAACCGACACGACTCGACGACACGGCCGCTTGCGAGGCGCGTCGAGACGGATCCTTCGGTCTGGAAGGAAGAG
ACCAGTGTGCGTCCGGTGCAGGACGTACCAAACGGCAACAACAGTAACTTCCCGCCATACAGCAGCGGTCCGAACCAGAG
CTCGCCGACCAGGTGGCAGGGCCAGGACGAGCCGAAAGGCGTCACTCCGCCCTTCCAGGCGCAGCACGAGCTTGCGGATC
CGGACGGCCAGCTACAGGGTCCAGACCGCACGACTAAGCGAGAATGGCGGAACTCTGGCTGGGTGCGAGGAAACAATGGT
CCCCCAAGCAATGGCTCTGTTGGTGTTGCTGGCCATGGCTAGCCGGTGTTTTTTTAAGGGAGCTGGGAGCTGGTGCGTTG
CTCTCGAGCCTCAAAAGCCTCAAAAGCTTCCACCAAATTTAACCCTGTGGTTGAAAAGAGTGGGACGACACACCACTACA
GGCATCGCACTGGCGTTTTCACTTTCCTCCTTTCTGCTGCGCCCTCCTGTCTTGTCTGTTTCCACCGAATCTTCTCGCCC
CTCTCGACGAAACAAACCCTGTCATGACAGTCATGGACCACTGGAAAAAAAGGAAAGAAGGAATGAACAGTATACTGCTC
GAAAGAGCAGCAAGGCGCTCGTGGACAATAGCTGCTCGTGGGGCTTCCTTGCACGCTTACGTGGATGCAAGCCAGGTGCT
CTTGTTTTCTTTCTCTGCTGTTTTTGTTGCCGGGCGGCCCTGTATTTAGCCGTCACCTCCATCACATCTTCTCCTTCGTT
ATTTTAGACGTCGGTAATTGGGTCCTCATGTCCTGTTGCTCTTCCTTTCCGTCTTGTTTCCTCGTCGTATCCCGACTTCC
CAGTCTCAGAGGCTTGCTTTGTACGGGGGGTTTTCTTTTCTCATATCGCTCTCTGCGGCGAGCGAATTAGCGAATGGCCC
TCACCTGTCTTGGTTCTGTTATTTCATGCCTCTTTCTCTACATAGCTTGGATGAAGGCCTTTCACGCGTGGCGAAGATAT
CTTTCTGCATTTTATTCTTCCAAAAGGTTCGGATCGTTTTGTCTTCCTTCTTTCGCAAAGTATACATGGGCACGGCGTCT
GTCACGGATCTTCCTCCTACTTGCCGCCAGTCTCGGCAACTGCACATGGCTTCCAACCGTATAGTATCAATGAATAGTCA
TAAAGACCCAAATATGTAACCAGATAGCCAAGCATCCTGACAAGATCGCACCCACCAGTCTCTTGTCTCCCAAATTTGTT
TAGCCCTGTTGCCTGCCGTCATCCACAGCTTCATCCCGCCCCCTAATCGGCCATCAGCATAGTCGATGACGGCACGGTGG
ACATACGCTCAGCCGTGAGCTTCAAAGATACGCGCAGCAGCTCGCTCGCCACATCCGGATGCTCCTTTTGGAGCCTCTGC
CACGCCTCACGGGTGAGGACCCACACGGTACAGTCCATGTCGGCATACGCAGTTGCAGTTCTGGCCGTCTCTGAAAAGAA
TGGCAGCTCACCGCACGTAGTCCCTGCCACAATGTTTTCGTGGTAGCACTGCCCGTGTGCGAGACTGTACTCGGCCCGAA
CGATCCCCTTCTCCAACAGGAAAAAGCCCTCTGCTACAGCACCGGCTGAGAATAGCATGTCCCCGGCCACGTACTCAAGC
CGCTGAAAGTAGCGACCTGCCCTGAACCAGAAGTCCACGTCCTTGTCGCTGACATCCTGGAAGATCTGCAGCATCAGCCG
CAGAGGGTCGCTGAAATTCTGCCATCTGGAGCGCCGGCGATCCTCCGTATTGTCCAGCAGCTCCCGTGCTGCAGCCTGCA
GGTGGTTTCGGCGTGGCGAGCTTGCCAGCATGTCGAGTGAGGGGCCAGCACCAGCCTCGTCGATGAGCAGGTGTCGACGG
GACGATGAGCCAGTGGTAGCGATCGCGCCATTGGCCCCGGAGGTCGTACCAGCCTTCATGCCCTCGCCCAAATGCGCCTC
TTGGCTTGCATACAACGTCTTTAGCAGCTCGTTTTCGCAAAGCTCCAGCGCGGTGTTGATCTCCGGTAAGAAGACCACCT
CTATGTCATCTTCGCCCAGCCCGACTGCGCGCAGGTCATGACCCAGCTCGCTTTCGGCATCCACACCGCTCACCACAAGC
TGGATGCCCTTTCCATCCAGTAGCCGGCTGATCGTGTTAAAGGCCTCCCCAGCAGAGTAATCTAGCCCCGTCACATGGCG
CAAATCGAGAATCAGGTAGCGGATAGGCTGACGATGGAAAGAATCGTCCGAGATGAGCTCCCGTATTTTGTCCTCCACCC
CCACGATGGTACCAAAGAAAAGGTAACCTTCCAGTTTGATGATGCAAATCTGACAGCCAACTATACGAAGATAGTTTTGC
TGAGATGGATTTCTCCGGACTGTCGAGTTGACAATGTCGCCACTGTATGCTGCGCGAATGGCAGACACCTGGGAGGTCTG
AATTATCAACGACACAAAGGCCAGGAGAATGCCGACTCCAATGCCGACAACAAAATCGTAAGTTCCCATGATGAGAACGA
TAGCAATGACCTTTGCAAATCAGCTGATGTTGATTCGACATGGATTGAGAATGCAAGTTAAACGAACCGTCACGTATTCG
GCACGCTTGAGTTTTTTACGAGGCTGCCATACAGCCTCAACAAGTAGCTCAAAGCCGAGGTCAAATATCAAACATCCGAC
CATCATGATCGGTATGAATCCAAAAGTCTTGGGCCCGACCAGCATAACACAAAACGTAAAGGCTGCTAATTCAAAACCAG
CAAGACGGCTGTCGCCGCCCGACCGCATGAAAAACAGCGTGTTGGCGTAGACAAGGTAGTTTTGTATGCTCCCGAGGGCG
CCAGGCAACATATTGGAAAATCCGTGCAGCTTGAGCTCGTGGTTCAGATCGGCATGATCTTCACCGATGTTGAGTGCCAA
CGCTGGGACGTTGATAGGGACGTGAAGAATTCCAAAAAATGTCAGTGCAAACATTGCAGGAACACATCGGGCAATGGCTC
CCCAGTGCACCTGATCAAACTCTGCCACGAGCTGTAGTTAGCTTTCTGAAACAAGAAACACCGGGGGACAAAAGCGGTAC
AGCAGTTCCTTACTATAAAGTGTGTAAAAAAACCACCATGGCTCGCCAGCCGGAGGTCCTTCAAATACCCAACCATGGCT
ACGCAGCCAGCTCTGGTTGAAAGAGCCGGCTACTGCAACAATGAAGTAAAAGAGAAAAGGAATAGCGATGATGAACAGCG
GCAAGAAGTACTTGTTCGAAATACGCTTCTGGCTCCAGAAGAGAACAATGGAGAGAGCAAGTGGTGTGCCCCAGAGTGGA
ATGGTGTCTCGCTGGACCAGCTTGTGCAGAGTGTCGATATCGTAATTGAGGCTGCCTTCTATGCGTGCTGTAACCTCGAA
GCCAGTAGCCACAAGAAACCAGCCAACACCACCAATACAGCCAATGAGGATGTGCCGGGGAATGAAGCCGACAATGTAGC
CAAACCTGAATCGGCCCATGCAGTAGAAGACTAAACCCGTCACCACCGAACTCAGCGCATAAGATGTGATCGTTGTAGCA
ATAACTGCATCAGGCCTGTCTTCCCCAACAATGTCGGTAATTGTCAAAGCCATATTGTGAAAAAAGGGAACTACTTCAAT
CTGTAGCGCCGTGAGTGTATGCTCTAAATCAACTCCAATGGGGACAAAACCTACCAACTCGGATCCAATTCCGCCCTTGA
ATATACTTCCAGAGGAAAAGACAAGCTGTGATACAATGGTGCTGACATAGAAGATAGAGATTCCAGCGGAGCCTAGATGG
GCAAAAACCGGGCTTCCCAAGGGGAAAAGGATCATTCCTAGTAGTTGAAAGGCACGCAGTGTAAATACACAAAGAAACAA
GATAGAACAAGATATTGGGGCCAGTTTAAAACATGAACGTACCATAAGAAAGAGCATCTAGGATGTTCAACAGCAGGCCC
ACAATGACAGCAGGTAAGCAGGCGACAGGGGCGACAACCGCATTTTCCCAAAAAGTTTTGCGATCGCAGCACTTCAAATT
CGTAATTGCGCGGTAGACTCTTCCTGTTCGTCTTCCACCAGATTCGTCAGTTTCACTTGGCTGTTTCAGCATCCAGTCAA
AGATGCGTAGAAATCCATGCCGCCTGTGGTTCTTCTGGCTTTCGGGATCATAGCTTAGCCTCGGACGACTGTTTGCCAAC
TCGCTCGGTTCTTCTAAAAGAGGTGTCGTTTCAGTCGCTAGACGGTCGGACAAAGAGCTGTCTCCGAAGTCATCGGCTGT
ACCGATATGACAATCTTCCACTATTGTCGGATGTGAAATATCTTCTAGCGCTTCATCGCCGTCTTCCTCATCAGAAAACA
CGTTGTCGTTGTCTCGAAGAATATTCTCCTCTTCAGACAATCGAACATGTTGAGGAGGTGACCTCTTCAAGGCGCGAGTG
AGTAAAGATGGCCCTTCATCAGCAGACAAATCCGCCTCATCTCTCCATGTATGATTCTCATCATTCTGGTAGCCGCGCTC
GGGTTGGGCTGCTTCGATAATACGTCCCGTTCCTCCGACTGCACCGCCTGCAATTGTTGCTGGTCGGAACTCGGTGTCTT
CGGTGTCAACATCAGACGATAATGTTGTGTGAAAGGACAGCGAGCGATTTCGATCGAGAAATGAAGGATTGCGTGTATCG
CTTTTGTCCGCTAGCTGGTAGGTCGCCAGCTCAGCTGTCTCTTCCCGTACAGACCTAGCATATTGAGCCGTGCTAACGAG
AGCTGGATCCGATTTGATTAGCTGGCGAGGTGCTCGGAGCAACTATATAAAAAGGCTCCTACCTAAATTGTCTCGGTGGG
CAGGGTTGATAAAAGACCGTGTCGGTTCTCTGTGTCCCCCTGACGTGATAGAGGAAGAAAGCTTGGAGTCCCCGCCATGT
GATGGCTGTTGCTGGCTTGACTGGCCCTGTGGTATGCGAGAAGAACTGCGAGATCGGCGCCTTCGAGTGCTCGCTGCCGG
ATTACTTTGCAGTGAGCCGATAGACTCGGCTCTCCGTCTAGCCCATGGCGGTATGGCGAAAGTCACAGGCGTAGATGACA
TCGCTAGAAAGTCGAACAGTCACTTAAGAAACCACGCTGAGCAAGCTTCCGGTTTGTTGCTCTACGTTTTTTCTTCCCTC
TGTCCTGACCAATTATGAGCGCCAGTCGCCTATACAAGGGGCATAGCCGTTCAAGACGGCCGGCTTGTGATGAGAGCACA
AGACGACAATACAGGCGCAACGAATATTGAGCAGTATAGGCAGGCTTCCCAAAAAGTGACAAATCGTGCTTTTAGGCACT
GTGCTTATTTGAATCCCACGCTGACCCAAGAGGCACACAGGAAAACTCAAGAGAGACCGTAAGACAGGCGAAAAGAAGGA
GAGCTGTTGGATAATCTGGCGACAAAGATGGAAGGCGTGAGCTTGCGTGGGAGCAACAGGCTTCACTAATACAGGGAAAG
GTAGGTCGCACTTCGTGAGTTGAAACAACAATGAGAAGTCTGAGAAAAAAAAAGAGGAGGGGCGTGTACTCCGTACTTAC
TTTGCCAGCTATGGTAAGATAGCTCCAAGCAAGGATGGATCGAAGATCCACCACGACATGTCTAGAAGGCTCCATTTTTT
TTAGGCCAGACTTACTCGTACTAGCGTGTGCGCAATCCCGTAGAAATACGGAGTACTGTACAATCATTTTTTCCCGTTTA
GCGAAAGAACGGCCGAAGATGAATGCTTGTCACGCTTTCAGCAAGCCTTGTTTGGCAAAAAACAATTATTATTATTACGG
ATACTGACTAGTAAATCAGGATGTATCGTATGCATACGGTGCATATGGTGATTCGATATATTACGTCGAGTATGCTGGTT
TGCCATGACACCGCGCAAGTTATCAAATGACAGGAGAGCAAACAATGGCGTGTCCATTTGCGCCAGCCAGACACACACTG
GCGAAATTGCACATCAACTTCGTATTACTATGTACTACGGAGTACTGCGTACCTGCTGATATAATATTGCCTGCGTTGAC
GTCAACGACTTGGGGCGAGTTTAGCACTGTGCATTAGAGCGTTCAAACTGTGCAAAATAAGGCTGGACTATCGGCGGGAA
AAAAAGTGACCATGTGAGCAATGAAAACTACATTAATAGTTTACTAACCAGTCTGCCTGCAACATAGCTACAACTGCATG
CAGACCCTTGTCTTCCGAGGATAAGCTCGAAAAAGTGCATGCAGAGAATAAGGCACCCGTATGTGGCATGTGCCCATTCG
AGTGGATGTCCTCTACTTCGCACGCCTCCATATCTTATTGTCACATTGCGTATTATACGGCGTGCTTGATGTGTGTGGAT
GTTCTCATTTACTGCAACTGTTACAAATGCAAGCACCTGTTTGCCACAAACGATACTAACTGTGCATGTGCAATGTATGC
CACATTTCGTGATATACTGACCGGTGAGCAAATGCAGCTGGCTGGGAAACACCTGTGCATCAGGTTGTACGAAAATACCA
CACTCAACCGATTTTCACACCTTCAGTGCAGTTAATGGGGGACCACACAGACGGCTTGGTTCGCACCAACGATAAAATTT
GTGCTACAAACCCTTTCGCTTCTTCAAGTATAGCATGGCGGTGCAGGAAGTGACGCGTCGGCAAGTATTCGTAGGTCCCG
TGCATGTAACGCAGGAAAATATGTGCATAACACTGCCCGGAACCTCATGGAGCCAGTAAGGCCGCTGCATCTCCACTCTG
TTCCCTTCCTTTTTCTTCTTCCCTCGGAAATCAGATTGAAAGTCAGGCTTGGAAATGGGAGCTGGATAGGGACATAATGC
CGGCATCGTATAAGTTGTAGAGCCCGCCCGGGCTTTCAAGACTAGCACCTTCTCAGCTCAGCTTTTGGAGGTATCCTTGT
GCAATCAGCCTCTCGACATCGCCTTGTCGGACGTAAAACTGGCTGTTGCGACTCAGTGTGATAGATCTGGGTTGGCCAAG
AAACGTCAGGGACAATGCATCACACAGTGCACCACTCTTTGTTTCAAAGTTCTTTTACTTAGCTGTACTTACCCATATTC
CGTCTGAATTTCTCCAGCGTCCTTCAAAACGCGGACGTCAATAAACAGGTCGCGGGGAGGCTCCAGGCTGCCGGTCAGGT
CGATGTCCGTCCACTGGCCTTTATAGGCAGCCAGTAGGTTCGAATACTGCCGGACGTAGTCTTCCTCCTGGGGGCTGAGA
CTGCTGCTGCCGTTGCTGCTGCTGACACCGGCGCTGTATCCGTCTCCGGTGCCAGTCTCGCCGCCACCGATGGCGCCTCC
ACCGCTGCCGGCCCTTCCTCCACTGCCACGGGCCCCAGACGGGCCGTCGCGTATCTGTTGTTCTGAAAGGTCCACCACGT
CCGATCCATTCCACACCAGCTCCTCCAGCTTGTCTGTCCGCGTGCGGTGGTATGCCAATAGGCACCTTTTATTGCGACGC
ATAGCGAGATGATCAACGAGAAGCGCACATGCTTTTGCCGGTTCGGTTGTGGGATCAAAAGATCCTTGGAAAGGTTCGAG
CAGCTGGGCCACGTCCTTATCGAGGTCGCGCACTTCGCGCGTCACTGCTCGCACAATTTCGGTCTGGTAGGGTGGCAAGT
GTGCCAAGTTCTGCGTCCGTTTGGCATGTTGGACCTGACAAACAGATGGGCGTAAGCTTAAATTCTGCAAAGGCTGCACG
CGATGCGAGACAATGAACGCGTCACCAGAGATACGCACCAGTTTGTTGCCAAGATCGCCATACATCTGGGGAGAATGTGC
AGGTTGGCCGACACAGTACAATGCTCAATTGGGGGGTTAGTACGCAAGGTGCTTTAGCAACCGTCGTCGATATATGTACA
GTATACTGTGGGACGAGAAAAGTAGTGAAAAAAAGTTGGGAAGAGCCCGCGTCTTCAGCCAATCCGAATGCATTTAGGGT
TGCCTCTTTGGGCTTCCACTATTCTCATACATAGTACTCCATACGGAGTAAAGCCTAATTGATAACATAGCTCCTCTCCA
CAAATCCCAGGCGGCTCATTCTAGCATCAACAATTTCAGCCTAGTATTTTACCTGCGTACTCCCCAGTGTCGCCGAAAAG
CACACGGGTGCGGGACTTTTTTTTTTTTACGCAAAAAAATTTCTTGCTGTGTCATGTTTCGTTTTTATTTTGTGAAGGAT
TCAATCCTTGATCTGTCTTTATTAAGCTTTTTTTAGCTACGAAAAGCAATCTTCTGGTGAGAACTCGTCGCAAACGGGGC
AATTCGCCCCTTTACACGCTTCTGCATGGCGACCTGTGCACGAGGAAAAAAGTCGTTAGTATTAACAGTCATGGCTTGGA
GGCAGAGATATGACAGAACAGAGCTTACAATATCGCTGGACTGAACGTAATCTTCGAAACCGGCAATCTCATCCTGGAGG
TCATCCAGAGAGATCTTCTCGTCCTCGACAACCAGGTTGATTTGCAGCTTCTTGATGCCGAAGCCAACAGCAACAAGCTT
GGAAGCACCCCACAGCAGACCGTCCTTTTCGATACCGCGGACCGACTCCTCCAGAGCCTTCATGTCGGTCTCATCGTCTG
CAACAGTTAGCTTTGATCCAGTATGGCAACGCTGGCATGTACGGCACTCCAGCAAGACAGAAATAAGGGACGGTTCCTTA
CCCCAGGGCTTGACATCTAGCGTCACGACGGACTTAGCGGCCGGCTTGGTCTTTCCCTCCTTCTTCTTGCGGTACTCTGC
CAGACGCTCCTCCCGCACGCGTGCGGCCTCAGCATCCTCCTCCTCGTCGTCGCTGCCAAACAGATCGACGTCGTCATCCT
CCTCCTCAGCAGCCGGGGCCTTAGCCGTGTTCACGGTCACCGTCGACTCCTCGGGGCCGTACGTAGTGTAAGGCTTGGAA
GCATCGCCGGACAGCGTAGCGAACTCCTCCTCGTACGAGGCAATATGCTTGTACCACCGCGCAGCGTGCGGGTATTTGGC
TGTCTCTGGAGAGGACTTCAGTGCCTTGAAAACGGCGACGTCAGCCTGGCTAGTGGCATAGCTATATTTTCAAAGCAAAG
ACCCGGTTAGCCATTAAAACGAATCGCGAGCGCCAAATTTGAAGGTCGTATATGAAATTGGTATCAAGAAGATCAGAGGT
GCAACTGTGTTGCTATTGGGGTCGTCATGTGTAGGTCTTGAGTCTACTCAGAAACACGGACCAATATGTTCTCATCACGG
AAATGTATCTTGAACCAATGTGCTGACAGGAAATTGACAGGGCTTCAAGAAACGCAGCTAAATCTAGACAAAAAGGAAAA
AACGTACCCAGAAATGTACGAGCGAGTGGCCAGCCAGCTGTTGAGCACTGCACGCATTGGTCAGATTGACTGCTCATCTT
GCGCTGTTGCCCAGACGAAGGTGAAGCCCTTCAGACGGCAAGCTACTTGTTCGTCTTCAGAAAAAAAGACGGTATGGAAC
ATACCAGCAACACCGGCGTCAGTGGTAACATCGGGAAAACCCATTTTGAAAGAGAGGGAAAATAGCCAGGGTATTTGTAC
TTGGAAAAGAGGGAAATTGCGAAAAAAAAAATTTGAGGAGGCTGGTGATGAGATGGAAAGTAAGTGGTGGGGGTAATAAA
TGGTGGGACTTATGAAAGAAATGTTTTTCCCCCTCCAAATTTCTTCTGGCGCTTCAATTGCCCCACATTTCCCACCGGCC
AATGGCCAATAGTATTTTACACAGTAGAGGTGTATTCCGTACTCCGTATATCTGGCTGTGAATACTGCGAAACATTAGGC
AATTGCTTAGTAGTCTATCAATACCGCGTGTCGTGAATCTCATTATAGTATTATGTTGTGATAGTGTAGGATAGGGTAGG
AACCTATTATTGCATAGAACGTAATTTGTTTCTACGGCAGCAAAAAATTGCATAACGTAGTTTTGCGGCTACAATCCCTC
ATATATGCATATATGCATATTATGGTATCGTACGATAAGATAAGACAGAGTCGAAAAGTTGGGAAGCTGCTCGAAGGTAC
TCGACAGCATCACCACGCCACCACAGGGTACATAAAGAAGGGCCATGAGCTTCTGCTGGGGCGCTATAGTAATGATTCTT
CCCTCTCCCTAAAGACATAGCTTTTTGTTCAAGTCTCCAAGATTCGCAAACTTAATACATGGCAACAATGTTTGTCAGAA
AACAGCTTCTCGCCGCTACGACACGAGGACGACTACTCAACACATCCTCGAAGGTGGCCACCCCTCTACTCCGAACCACT
CCTTATCGATTATCCATATCGCCTAGACATATAGCTGTCACACGCAACCCAGCTCGCTTATTTCCACTCGATACTTCTCG
TTTCTATTCCAATGGCAGACCTCATCCTCCAGGCGGCACACACCGTATGGATATGGGTGGTGGGGAGGCAGAGAAGCCGG
CCCTAGAGCAGTTCGGTGTTGACCTCACGGCGAAGGCCAAGGACGGAAAGTTGGATCCGGTGATTGGACGTGACGCCGAG
ATCCAACGTACCATCCAGGTGCTTTCTCGCCGCACGAAGAATAATCCGGTCCTGATCGGCAATGCTGGAACGGGTAAAAC
AGCCATTCTGGAAGGCCTAGCCCTGCGAATCGTGCAGGGCGAGGTCCCTGAGAGTATCAAGAACAAGCGAGTTATCAGCC
TCGATCTAGGTTCGCTCATTGCAGGTGCCAAGTTCCGTGGCGACTTTGAGGAGCGGCTCAAGAAGGTGCTTGGCGAGGTG
GAGCAGGCCAATGGCGAGGTAATCCTCTTCATAGATGAATTGCATACCCTCCTTGGTCTCGGCAAGGCTGAGGGATCGAT
AGATGCATCGAACTTGCTGAAACCGGCACTTTCCCGCGGCGAGCTCCAGTGCTGCGGTGCTACGACGCTCAACGAATACC
GTCTAATCGAAAAGGATGTTGCACTGGCTCGGCGGTTCCAGCCGATTGTCGTCAATGAGCCTTCAGTCGAAGACACGATC
AGCATTTTGCGCGGCATAAAGGAGAAATACGAAGTGCACCATGGTGTGCGCATCACCGACAGCGCCCTTGTTGCTGCTGC
GACGTTTTCCAATCGGTACATCACGGACCGGTTCCTCCCCGACAAGGCTATTGACTTGATGGATGAGGCTGCCAGCTCAC
TGCGGCTGCAACAAGAGAGCAAGCCCGAAGATATCATGCGTCTTGACCAAAAAATCATGACTATCCAGATCGAGCTTGAG
AGCCTACGCAAGGAGACAGACATTGCCAGTCGCGAGCGCCGTCAGAAGCTGGAAGATGACCTTAATAAATACCAGGAAGA
GGCCAAGGCGCTTACTGAGCGCTGGCAGAAGGAGCGCGAGGAGATCGATGGTATCAAGAAGGCGCAGGGCGAGCTAGATC
GCGCACGAGTTGATCTCGAGCGGGCGCAACGCGAGGGCAACTTTGCACGCGCGTCCGAGCTGCGGTTCGGAGTTATTCCC
TCCCTTGAGGAGAAGGTGCGAAACAGTGACGAAGAGGCAAAGGCCAAAACCAGCAGCGCAGAAGACGAGGCTAGCGCGCC
GCTCCTCCACGATTCGGTCACGGCCGACGACATTGCGACTGTGGTATCCCGCATCACCGGCATCCCCGTGTCCAAGCTGA
CATCGGGCCACATTGAGAAGCTCGTGCACATGGAGGACATGCTGCGAGAGTCGGTGCGTGGCCAGGACGAGGCGCTCAAG
GCCGTGGCCGATGCCGTGCGGATGCAGCGCGCCGGCCTGTCAGGGGACAACCGGCCGCTTGCCTCATTCTTCTTCCTAGG
GCCGACAGGCGTCGGCAAGACGGAGCTGTGCAAGAAGCTGGCCGCTTTTCTCTTCTCGACCGAGTCTGCGGTGGTGCGCT
TCGACATGAGCGAGTTCCAGGAGAAGCACACAATCTCGCGCCTGATTGGTGCTCCGTCAGGCTACGTCGGCTACGACGAT
GCCGGCCAGCTGACGGAGGCCGTGCGGCGCAAGCCGTACGCGGTGCTGCTATTTGACGAGTTCGAGAAGGCCCACCGTGA
CATCTCGGCCCTGCTGCTGCAGGTACTGGACGAAGGCTATCTGACGGATGCACAGGGGGACCGGGTGGATTTCCGCAACA
CCATCATTGTGCTGACCTCAAATCTGGGCGCAGACATCCTTGTCGGTGCTGACCCTCTGCATCCATATCGAGAGACGGAC
GATGGCGACGTTGATCCGAGTGTGCGCAAGGCAGTGCTGGACGTCGTGGCTGCCAGCTATCCGCCCGAGTTTCTGAACCG
TATTGATTCATTCATCGTGTTCAAGCGCCTCGCAAAGTCGGCCCTGCGCGACATTGTCGACATACGGTTGAAGGAGCTAC
AGGAGCGCCTGACAGACAGGCGCATTGTGCTGGACGTGCCAGACAGCGTTCGCGGCTGGCTGGCAGAGCGCGGCTATGAC
CCCAAGTTTGGTGCGCGCCCGCTTAACAGGTTGATCACGACTGAGATCGGAAACGGGCTGGCCGACAAGATCATCCGCGG
TCACGTGCGCATGGGCGACATTGCCCACGTCCAGATCAAAGAAGATGGCTCTGGGCTGGACGTGCATGCTGAGTCGCCGG
CACCTGTATCAGATAAGACAAGTGCGTGAGAGCTCAGAGGGCGGGGAAAGAAATGTGACATTAAAGTAGGGGCGGGGGGT
GCTTCTGGCGTTATATGGCGTTTTGTGACGGGATGGAGCAGAAAGCCTTCTCACGATACATAAGAATCCCACTGTATTTG
AATAATGTACATTAAGTTATCACATAACTTTATCACATCGACGTATTGCTCCGAAAATAAGGCTGTTGCCAGCAGTTTGG
AGTAGTAGGAAAATAAGAAGGCATTTTATATTTCAGTTTTCACGCAGTGCAGCCGTGCCAGCAATATCAACAATACATTT
CAAACTTTCTCGCCTTGCCGATTCAAGTACCTGTCCACGCAATGTGAGAAGAGTATTAGGGGGAACCAAGCATAAATTAA
CACAATGACCACCACGCGAGGCATGTAGAATTTAGAATTCGATTTCTCATGGGAGGCAATACTGTACGAAGATACACAAG
AGACATATAGGGAGAAGGACTGAAGCAAGCAACAACAGCCCGAAACAACGCCAGCCGACGACATCAGAATGTGCAAGCTA
GCCGGAGGAGGAAGAGATAGTGAAAAGAGAAAAACAGGCGCGGTGGTTGTTTTATTGCAGGAACCAGGACCCGAGACGGT
TAAGTGTATATATCGAGCGCAAAGCTGCCGAGGAGCCCAGAACAAAGATAGCGCATGGCCAGTCACAATTACGCGGCTGA
CTCTCTCATTCTTTCAGAATATACGCTTCAGCTGGGCACTCGTAATAAGTCGATATTTAGTTGTTCGTCTTCCGCAGAGT
GGTGGCGAGCCAGTCGAGACCCTCGTACAGACCGTCACCAGAGGTGGCGCATGTCGACTGGATGTACTATTCAGGGAAAA
GAGCCGTCAGTCAGCATGGTAGTCTCCCGGGAGGCATCTGTGGTTTTATGTCGATTGGGTGGGTCAACTTACCCATCCGC
GTGACCGCAGGCTGTGCAGACCCAGCTTGTCTGTAATCTCAGCGGCGTTCATGGCGTTCTGGTAGGGATTAGGTCAGCAC
GGAGTCGAATTGGATCTAGGTAAAGGTGGACAGGGCACATACAGGCAGATCCTGCTTGTTCGCGAAGACCAGGAGGATGG
CGTCGCGGAGCTCATCCTCGTTCAGCATACGCTGCAGCTCCTCGCGAGCCTCGCCGATACGATCACGATCGTTGGAATCA
ACGACGAAGATGATGCCCTGGGTGTTTTGGAAGTAATGTCTCCACAGGGGCCGGATCTTGTCCTGACCACCGACATCCCA
CACGGTAAACTGGATGTTCTTGTACTCCACAGTCTCGACGTTGAAACCTAAATAGGCAATCGGTTAGTGGGTGCACAGCG
ATTGTGGAGACGCGAAGAAAGTCTGCGCATGGCAGCATACCAATGGTAGGAATGGTGGTGACAATTTCGCCCAGCTTCAA
CTTGTACAAAATAGTAGTCTTTCCAGCAGCGTCAAGACCAACCATCAGGATGCGCATTTCCTTCTTGCCCAGGAAAGCGC
TGAACAGCTTGCTGATGCTCAGACCCATAGTGACGGTTTTTGGCGGCTGTTGAGCTGATGTGGTTTAGAAAGGGAGAGGC
ACAAAGTGCAAGATCGGCTGAGTATAGATCAGGCTGTGCAAGATAGTGGTTAGCTCAGCCAGGGCTCGATTTTCTATTGG
TTCGCGTGCCAGTGAGTAGGTAACGGTGCAAAAGGAGAAAGTGTATGTGAATGACAAGAGAAAAGGGAGTCGTCCGTATT
CTGCTGGCTGGTCTCCTATCTTATAGGCGCCAACGTCGCACGGCCAGGTGCGGTAAAAGAACAGCTGTTTGTGACGCAAA
AAATGCATGCCGGTATGGTGAGATATGGAGAGGCTTAGAGGAAGGACGGCCGTGGAGGTGGAATGCCTCAGGCTGCGGCC
ACCAGTCCCTCCTCAGCATCCATCACGAGCTCGGGAGTCAATTTCGAAGCCAACAGATATATCCTCTCTAAGCTGTCACA
TGAGAGGCGGTAGGGCGCGATGGGTGGTGCTAGTGGAGTGCGAGGGTTGAATACAGCAAGCCGTGAGGCTATGGCTGGCG
CCTTGACGCGGTCCCCGGTCTTGAAGAAAAGCATAGAGCTTCTTTCTGGCAGGGAGGAGGGCGAATAGGAGGGTGCCATC
ATATAGGGTGACCCAACGGCGGTATAGCCTTGCGACACAGCCAGCGGCAGCTGGTGTGAGAGGAGGGTGTGGGAGGATGG
ACGGCGAGAATGCGGTCCGGGGAGGCAAACACATGATGAGGTAGAAAGGCAGGAAAGAAAGGAACAAGATGAAGTGAAAT
GGCTAGGGATCAGGCATCAAAGAGGCAGCCAGATGCTTCACATCTGATCTATTGTGGCCACTTGAATCTTCTTTATGGGA
GCTCACCTCGAAAATTCGTTCGGTTCGGCCTGGATTCAGAAATCGCTGTTGTCTTTCGGGACACACGACGAGGGGCGGAC
GATGGGGAAGAGGACAGGCGGGCGATTTGTCGCGATGTGGCCAGAAGTGGGATTTGTCGGTGTAGTGTGATTTTGGTGGG
AGGGAGAGGAAGGGAGGGAGAGAAATAGAGTGCGAGGGAAAAATAATAATAATTGGGACAGCGGACCAACGCGCGAGTCA
GGGAAGGATTGGAGCAGGCCGTTCAGTGGACAGCGCCGACCGCCAGCTGCCTGGAGATAGGAGCAGGGGCCGTGCGGAAT
GCATATGCACATACGAGTGATAGCGCTTCTTCAGCAGGTGGCTGAGCTCTGGCTGGTTGTTCCCAGCACTGTGGTGGCGG
GGTACTTCCCTCCGGTCGGAACATTATCGGCCCGACCGCAGCCCCTTTTTGTTTTCGCTGGATTACGGCGAATGATGGCC
TACGGAGTACGTCGTAAAGTGCCCTGCGAAGAAGATAGCCAGGGGGCGAGAGCACGGGCCCACATTGTATCTCAGTGATA
AGCAGGTTCCACAGCGGACCACTGACCCCAGCACGTTTCGCCACTGGACTGTGGCTGCTAGCGCCAATCGCGAACTGCAA
GCTGTCTTCCTTCGAGAGTGGTGAGAAAAAAGGACACGACAGAAAAAAGCGGTGGGTCCTTGGGCACGCGAGCAACGATC
ACGAACGATTGCTATCCGACTGTTTTGAGAGCGCGCCGCTGCAGCTGCCTGTTCCCGCTTCTGCTGCCATTGCACCGCAC
CGCAGCATCACTGCACCACAGCATCACCGCAACCCTTCTTCTGCAATGGCACGTCTCTTCTTCGGCCTGTTGGCCGCTGC
TGCCGCTCTGCTGCCGTCGGTCGCCGCCCACAACATCCAGCTGCCTGCGCATGGCCGCGAATGCTTCTTTGAGGAGCTCC
ATCGCGACGATACGATGACGGTGACCTTCCAGGTGGGCGACCGCGAGTTTGGCGGCGCCGGCAACCTGGACATTGATTTC
TGGGTAGGCTTCCCTCTTTGCCCTCCAACCCCCCCCCCCCCCCTTCCGTGCTGACTGAGGCTCGTCTTGTGCAGATCACG
ACCCCCAACGGCCAGTATGAGACCTTCCAGAAGACGACCTCAAACGGCGACTTCACCTTTAGCGCCCATTTGGACGGCAA
GTATCAATACTGCTTCAGCAACGAGCACTGGGGCGCGTCCAGCAAGGAGGTCTCCTTTAACGTGCACGGCATCGTGTACG
TGTCCGAAGCCGACAGCCCCAAGGATCCGCTCGAGGCCGAGGCTCGCCGCCTGTCAGACCTGTTGGCCCAGGTCAAGGAC
GAGCAGTCATACATTGTCGTGCGAGAGCGCACGCATCGCAACACGGCCGAGAGCACCAACAGCCGGGTCAAGTGGTGGAA
CCTGTTCGTCATCGGCGTCGTCATCGGCGAGTCGGTCTTCCAGGTCTGGTGGCTGCGGCGCTTCTTCGAGGTGAAGCGTG
TCATCTGAAGGAGCCAAGCTGAGCTGAGCGGTCGCTGAGACCGTCCGGTGACAAACCTCGTTCTGCCGAACACGACTCTC
TTTCTGTACTATCAATATAAGATACGTTAGCATTGCACAAGGATTTCAGATCGTTCCTACGTCTGCGGGTCGTCGTATTC
GCTTCGTACGGATTATAAAAGCAGTGTCTCGTCCGTTCTCGTCACATTCGATCTCGTCAAATCTCTGGCACATAACCTAA
CCAAACATATATGATCCAACAGGTACTATGCATAATAGGACGGGCGTCCAGTGTAAAACAGGTCGTGACAAGATTCCACC
ACCAAGAAACCCAAGCACCAAAACGATGTTCCAAATAAAGAGCCAGCGTATGTTGGCCGACCGTTCCAACGCCGTACCAA
CGCCGAGAGAGTATGCAAAACAGAGTGCAGGCTGTTCGGCCAGCACGAAACCCGCGAATAAAAGGAAGCAAAACACCGCT
TCGTCAGGGCATGCATCATGGCAGTCACGACGATGGGTCCGTCTCCGTGGACGGCTTCTTGTTGTACTCGTCGCCCACAT
TGCTCTCAACCGGCAGTTCCACCTCCTTGATGGGGTGCAGTAGCATGGGCGGCAAGCACATGCGGCCCTCGCCGCCGCGC
ATCGTATCCACCGTCGTGTCGTTCAGGTTGGCGTCGGTCTCCTCTTCAAACGCCTGCCCGCCATCGTTGTTGACCTTGAG
GCCGAGCCAGCGGCGATACAGGTTGCGCGAGAAGCCAGCGTTGTAATACCAGGTCAGGCCAAGGAAGTTGTGCTCGCGCT
GGCCGAAGACCGAAGTGCGCGAGCCGCCAGAGGCGCCGTTCAGGCCGCCGTTGAAGGTATGAGCCATGTACTCCGTAGGC
CATTCGCGATCCACATACACGGGGTGCGGCACATACACGGCCTTGTAGCCGTGCTGCAGTGCCGCCGTTGCCGGCCACAT
CTCCGAAAAGGCGTGGTGCTTCATAAAGGCGGTCTCGCGGTGCATTGTGCGCAGGAGCCGACGCGACATGCGAGAAGCCG
TGATGATCTGAGCGCGGCGCGGCGGTTTACCGCCTTGAGTTGTCTCGTTGTAGCCTGTAATATCGTCGGCCAGTAGCCAG
GTTGTGCCTGCCGGGTCGAAGAGCGGGTTCAGCGTGATCAGATCCGCCTCCTCATCCACGCCCCATACGTAGCGGTCCTT
CTCGTATGTTGTCGGCGGCACCGGGTCGGCGGCCGCCTCAAACCAGTCGTTCGGGTCGGCTGGCCGCACGGGACCCCATA
CCGTCTTGTCGCTGTCCTTTGCGTCCTTGTCCTTGCCCAGAGCAGGGTTCCACGCCTTGCCCGCGCCGGCCGCAGCGACC
TCGGTCTGCACGCGCGCCATCTGGCGGAAGTCGTCCCAGCTGCCATGCACATCCGGCATGTAGAAACGGGCGTTTCGCTC
CCACAGGCCCTTGCGCGGCTGCTTGGCAGCCCACTTCTCCATCTTGGTGAAAAGATCCAAGTTGTGGCCTGTGTACCGGA
TATCCATCTCCCACTGCCAGAAATACTCGTACTCGGGGTGGAGCTGCGCAAAGTGCTGCATCGCCATCTGCAGGCCGCGG
TACACACCGTGTACGGGCAGATCCGGGCCCCGGGTGAAGTGGTCGTGGATACCCTGGTACAGTGCCAGCATTTGCGTCTC
GGTCCACAGCGTGACAATCCCGCGGAATTCGGCCGGCACGGTGTCCACGATCCGCTGCTGGTAAATCTCGTCGTCAGCCC
AGATGGGGTTCTTGGCGTCGTCCTTAACCTGGACCAGAAGATGGACGTCATAGCGCGAGCCTGATGCCAGCGAGAGTTCC
GAAATCAGTGCCCGCAGGTTCATGATGTCATCCTCGCGCCACACGAATTCATCCCAACACCGAACGACAACAGCAGTACG
CGGTGCATTGCTGGGAGGGTGTACTGCCGCGGGGCCCTTATCGGCAGAAGCAGGAGCCGGGGCAGCCGGGACGGCCGGAC
TGACAGGAGCCGCAGGAGCAGGAACAGCAGGAACAGCAGGAACAGCAGGAACAGTAGGAGCAGCAGGAGCAGCAGGAGCA
GCACTGTTCCCTCTGGCTTCGTCACGCGCAACAATGTGGACACCTGCAGCGTCGTCACCGATATAGAAACCGTTGGGTGG
TGGAGCTCGCGCGGATGTGGACCGAAACCGGTGGGCATTGGCATTGTAACAACGCCTCTGGACATCAGCCCAGTCGACAG
TGGAGTAGTCAATGCGCTTGGTCGACTCCCAGATGGCGTCGGAACCAGCCTTCTCGCCGTACTCGCCGGTGCCGAGACCG
CCCGAGCGGACAGAGTAGCCGTAGCCGTAGGGTCCAAATCGTCCGTAGCGCTCGAAGCAGATATCTTCGGGTAGCGACAA
CAGTTCGTACGAGCCGAGGATGTTGCGGGGGAAGCCGTTGGGACGGCCTTCAAAGTAGCGCAGAGACGGGACGCGGACGG
TTTTCTGGCTATCGATGAAGCAAGCCACCGGAGGAGCATCACCACCGCCGGCCGCTGCGGCCCCGTCGGCCAGGACAGAG
CTCTTGTGCTGGTCGAACGGGAAGCTTGGTGGCAGCGGACCCTTGTTGTTGTTGACAGCAAAGCCAGAAGCAGCGTGCAG
GTGAACCCTGGGCGGTGTAGGCACGTCTTCGGCCGTCGCATCGCCAGGAGTGGCGGTGACGTTGTAGGGCTGCTCATCTT
CAGCGCGCGGGTACTGCGGCACATTATCCTTTAAGGCGACCAGGTTGCGCACGCCGCCGTAGTAGCGGGTCAAAAAGTCA
AATGACTCCCAGGCGGGAGGCGGAGCAGCCGGACGGTCGAACTGGCCGCTGGAGATCCGACGGTTCTCCAGCTGGCTGGC
GCGGACGAGACTGAAGATGAAGAGAAGAATGGTGAAGATCATGGCCGCACAGAGATAACGGGTCACCTTGTTTGGTAGGC
GATACAGCCGAGCCCCGATACCACCCAACCGCCGCCGGTGCCGTGGCAGACGAGAAAGTTTGCTGGAGGCTGTAGCAGGC
CGTTTAGGCAACATCAGCGAGCTTGCCGTTGCAGATCCCGAGGATTGGCGAGAGCTCGGACCGCTGGTCGCACGAGCTGA
TGCCACGGAGGCCGCGTAGATGCTGTCGCCCTCCTCAACCTCGTCGTCGTCATCGTCATCGTCGTCGTCGTCGGACGAGG
CTTCCGAGTCTGAGTACCGCTCCTTAGTTAGTGTCGTCGGACTCGGCTGCTCGTATATGGGCAGCCGCTGGCGGGCGTCC
CGTGGCCGAAGTAGGCCCGTGGGCAGAAGTCCCATGCTGGCGAGGAAGAATGCACTGGGCTCTGAGCAGTACGACTGGAA
TGCTGCGACGAAAAAAAAAAAAATACCCTTCAGGGTTCAGGAGAAGAGGGCGGACAATGTCGGCACACAGGCAAAGACAC
GGAGCATTCGCGAGATCAGGACGATCGGGAGAGAGGGTGCAATGTTTGGAGCGAGAGAATCATAATGACGGCAGGAAATT
GCTGTCAACGGGAAAAGAGCCGAGTGACTAAGAGATAAAGGAAGGGCCATCTCCCAGCCAACATTAGGAGAATACTCCGT
ACGACGTACATCGTAGCAGGAGAGCACTAGTTTCTCCCATTAGTCCCTTGTTGTTTGCACCCCTTGTAGGGCTATAAGTG
ATGTCATTGGCTATTGGAGGGGCGCTCCTTCTTCCCATTCTACATACATTACGGAGTACGGAGTAGTTGCTTGAGCAACC
ACACTGCACAAGCGACAGTGGGGTTTTCTCACCCAGGGGTGACTTCCACGCTTTATTCGCATTTGACTTTTGAGCCGCCA
AGCGCAAGATGGGTTTAGCTGCTGTTATTACTTCCCAATCTGGCAAGCTAAGACCTGACTATTCAGTGCTCAAGTCTAGT
TCTGCTCCGGTCGCCGCACTCTCCTTTGTAGTAGTGCACTTGCCACACGTAAGATATAGTCTTTGCTGCCAGGGCAAGGT
TATGATACCAATGCAATGCCTGAATTTGTACACAGTATGCAGCACGTGCATGGCCATCGAAGAGTTTACTTCCCCGGACG
CCGATCTCGTGCGGCACATCTTGGCGGACACCTGCCGGCCATAAAAAGCCTTGGCCGTGCCTGCCCCAACGAGGCTGTGA
TAACCCGGTCTCGACAGGTGTGCTCCTGTTTCTTTCCCGTTTCGCTATTCGTGTCTCCTTATCTGTCTGCCTGCCTCTCT
TTCTCGTCAGGTACTTTGACGAATCAACGTCCCTCACGGCATTCATTCGCTCTCTGCTTTTTATTGACTGATCGCCAAGC
GGGGTAAACCCGTGCCCGTAGATAGGAACAGTCCTTGTACGAGTACATGGCAGTTTTCTCTCAGCTCAGCCAGCCGGATA
CCATTCCGCCCCCCACTGTGCTCGCAGCCAATGTCCAATCTGCTGACCGTGTCTTGAACCTCGTCATGTGGCTGTCACGA
GCCCACATCGCTCTTTCCTCGTCGAGACCCTGGCCGACCTCCTCCCTATACATTCGCTGCTCTCTTCGCTCTCACTTCTA
TCCACCTCCTCCTTACTCCTCGCAACTCAACCACACTTCATGCAGCGACCCGCCAGCATCTGCACCAAACCCGATTACAC
CTCACACTCTGCTGGCCCGACGCTCTCGGGTTACCAGTTGAGTGGCTGGCGCCTCCGACTACGGACAGCCCGTCCTGCAG
TAGTCCTGTATCAGCTTTTGTCTTTCCCCCTACTCTGTGCTGTTCTTGCCTCGCACTGCTCGGCTTCGTGGGACTCGTTC
TATTCTCAAAAAATTGCTGCTGCTTTCTCCACTCGCTTCAGGCCAGAACACCCTCGCCTGCTCAGCTGCATCCATATATT
ATTCGACCATTGGGCATTAGGCATTGCATTGTTATCACCGTTGCCACAATTTGCTGCACCAGAGACTCTGCCCCGCTGAG
CGTCCCATAGTTGTCGTTCATGTGAGAGCTCGACGAGGAGCTTATAATCCAGGCCGTTCTTCCTGATCTCTATCTCTTCT
TTTCCACCTTCCTTTCATTCCCATACCTATTCCTTTCCGTTGCCCTGATCTGCTTCTTCGGGCTACCTCATCACAGCAGG
TTCACTGTCACATCTTGACTATAGGGCTCTATAGTATCCGTCCCTCACCCCCTCTTATACCTCTTGTCCTCTCCCATTCC
CTTTTATCAGCGTGACCATGCCAACGCTCACAATGGCATCATCGGATGCGTCTTGCTCCTCCTTTACGGCGCCCCCGAAG
CCAGACCATTCCCCACTGAAGGCGTTACCATCTGTTTCGGACCGCACAGCCATTGCCAACGATATCATGCTGAATATGGT
CATCCGCCAGAACCCTTTCTCCATCACTCTGGACGCTCTTGCTATGCTGGTGGCTGCTCTCCTACTCGTCACTGGGATGC
ACGTTCTGCAGCCTAGCCTGCTCGAAGTCATCATAATCGCAGTGCCTCTGGTCTTACTTGTCCGCAATGATTACATTAAC
TTCCTGCTTCTCGGCCCAGGCGGCACACCACCTACCTTTTCTGGTTATCTACGCCTGCTCTGGTTTCGCCTCTTCGCCCT
GCGGGATGTTTACCACAGTCAGCCACCCTCAGATACGGTTCTTGCGCCCGCCGCCGGCATACTGAAAGAATTACCATATC
GCCCTGGCCCGCGTCCCATCGTGGCCGGCCTGGCACCACAGCGCCAACTGAACCAGCCAGCCTCGGGCAAATGCAACGTC
GCCCTGCGCTCTGCCGTCGAGGACCTAACCCGGCAGTACCCCGACAGCCTCTGTACAGCTACATCATGCATCGAGAAACA
CGGTTTCGGCCTGTTTGCGCGCCACCCCGTCAATGTTTGGGGTCAGGGTGAGGTTTTCCATATTCACGACTCGGAGAAGT
CTATGCACATGAGCCTACACCCGGACGACATCAAGGAGGTTCTCGAGAAGGGCTGGGGCCAGCGGCATCCACTGGCCTTC
AAGGGCTGGGTTAAAGCACCGCTTCCCATTACTTTCGTCATGATCTATGCTCCGCGAGGTACGTATATTGGCGTCTGTAA
ACTATTTCAAAACTGAGTCTGCTGACTGACTATCCTAGATGAGAGTGATCTAAAAATTATCGCCAAGATCGTTGAGGCTG
CCATTTGGTACACTATAGCCAAGGAGGTCAGGCTGGAGATTCCACCTTTGAGCTCTCAAGAGTCTGCTTGATGGCTTCTG
CTCCCGAGAGCGCCCCCTGCGAGACAAGGCTGATTTAGGTTACAATACCGCTGCGTTTCACCCGTACGTTTCTCCTTTGC
TTTCCAGAGAGCGCTGCAGGAGCCTCGCCGGCCCGGTTCTTCCGCATTATTTGATTTTCACAGGTCTACTATACTGAGCT
TCACAGCACAATGGCATAGGCGCAGACCCCGTGGGTGTGGGACTGGCGTAGAGGACGTTCAGCTTTAGTAGACTAAAAGG
AATTTAAATAAAATACAAGCTCGCAGTTAACCAGGTTTTCTACAAAGCAAAACAAAACTATGTATTATGCTATAAACTGA
CAGCTTACGCTGGAATATCTTTTCTAGATGTCCAAACTACTTGCCTGGAAAAGCGATGATAAGCAGTCGCGCCTGTGCGA
GAAATAGGCTCCTCCTGTATTCAGTCCTCTTCGGATTCGTCCTCCCCATCGCCACTCTTTGCTTTCTTGTACTTTTCCCG
TCCTGTTGCAATGCTCGCCTCGACCACTTGACCGGCAAACGCTCGCCCATCCATCAGCCGCACGCATGCTGCTGCTGCCG
CCGTTGTCCGGAACTTTACGCTAACCACGCCTGCTGCCTCCTGGTCGAATAGCACCACATTGGTCACCTCGCCCAGCTTG
GCACATTCCTCCCGGATGTCTTCCTTGATGTCCAGCAGAGCTGCCGCATCCTCTTCAAGCTCTTCCAGAGTAAACATGTG
CTTCAGCACCACTACTTTGTCCCACTTAGAACTGCGGATGCCGCCGCTGCCACCGCCACCGCCACCATCTCCGAAAGGCC
GCTCTTCGTCACTGCTCCAGTCTGCCAGCTTGGCATCAAGCTTTTGCGTCTTCTTGATGATCTTCTGCTTGTCCTGGTTG
CCTCTTGCTCCTGCTTTTGTTTGACCCTCTCCCGCAGTCGAGGTCCGTTGCCCGCCACTTGCTGTTCCTGCAGCTGCCAG
TCCAGAGCACGAATTGCCCCCCGGGGCGCCTGCCTCGCCGTAACTTGTCTTCTTGTAGCTTGCGTCAGCTGCCTGCACGC
GCATGCGCGGGGCGTCTGCTGCAGTCGGCGAGAACCGGAACTCTGTGTCGTCCAGTAGCATGATGGCCATGTCCACACTC
TGCGGCTTGAAAAAGACAACGAGCGCGTCTCCCTTGAACTGGCCGTCGGCGTCTGTGTATAGCTTTATGCGCGGACGTCC
CGAGTCGATCTCCTCTGCGATCACCCCGCATTTGCGTGAGAATAGCTCTGCCACCTCGTCGACCGTCGCGTCTGATGGGA
GGCCCGTGACGTAGACAGCCGTGTTCTGCCTCGGCTTTGGGGCCGTCTGTGCTGCCCGAGCCCTCTTACTGATGCCCAGG
GCGCCGCCGCTGCTGCTTGCGTCATTTCGTCGCTTTCCACTTGTGTCTGATGGCTAAATTTGGAGAGAAGAACAGAGGAA
GAGGCACCAAGAGGTGAGGAGAGGTGGAGTATGGGTCAGTTTGTCACGAGCTCCCGGTTCTTTTCTTCGTAAGAAAGAAA
GGACATAAAGGAAAGAAAAAATCAAAAGCACAGTTGGTTTCATCCAGACGGATGCCTCGGACAGAGAAGGGTGGGCTGAG
TAAGAAACAGGGCAGTGCTGGTGATGGAGAGACAACTGCAGGTAAACGTCGAGTGCAGCTTACCTCGTGGCCGTACGCTT
GGTCTTGCTTTCGCTTCTGACCCTGCCTCGCAACGCCATTCTTTTTAGGATCGCGGCCATCCTCCATTGTATCTCTATCG
CCGTACGCGGCCAGTTGTGCGGCCACGGCCATGTCGTTCTCGTCGTCATCCGCGTGCGGAATCCATCTCTTCAGCGCCTG
ATCAAACTCGAATTCGTTCCCGTCTTCTTGAACTGCAATGTATTTGCCGTCGAGCTTCGAAAAGGAGATGCGCTCGTCCT
CATTAAACTTGGAAACGTCGGTGGGAAATGACCACACTTCGGCCATCGTATCTTCTTCCATGGCTGACCGGTGTAAATCG
GTCTATTGGCGTATTGGCTCGGTATCTTACTGAATTCTTACAAGGGACGCGCTTTCGTTGAACGTCTTTGCAATGTCTGC
TGCTAAGAAGAAAGTGCATCTGCTCCTAAAGTGAGCTTCCAGTGTGAAGAGCTCTGCTACTGGCTAGGGAGAATAGTGGG
TACTGTATATATGGAAATGCATACTGTTTAAGACACTGTGGTCGTGCTAGATGCATACGATGTACGAGTACGGGGTATGC
AAGATCTCATCCACTTTCTCTGCACAAGCCAAATCAGTGATCTACGTATATTCGGAGTGGGACGGAGTACTCCGTACATA
GCAGAACTTTACTACGAATACACCCTTGCTTGTACTTCTGTTGCACTTGGGCCTTGAGCCATTTAGCCTGCCCCTCAACT
GAGCTTGTTTTATCTCTGCATGTAAGTTTCAGTCGTAAATATTCCGTACGAGCTCTCGTTCCGCTACTGCTTTTGTTTCT
CTAGCTTCTCCTGAACTGTAGATTTGACACCTTCAACAAATGCCTCTACAGCCTCGCCGCCGCCTAAGGGCATGGCACCA
CCGGGCAGAAATCCGTGGTTCTTGACGGGAATGGCGAGAGCATCAGCTATGCTGGGTAGACCTCCATCACGGATAGCCAT
GGTCAGACTCGCCAGGCTCTGATGAAACTGCGGAGTGCGTAGCACTTTTTCCAAAAGACCCTTTTTCTCCGCGATACTCA
TAGCTACTTTTGCAGCGGCCGCTGCTTCTGCTGTCGGCTCGACAATGTCGCCATCCTCGATTGCATCTTGCTGGCTAAGA
ATGAGTACCGTTGGCGGCAGGAAGCTCAGCAGACCGTCAATATACTCTTCACTCGCACTCTTAATCATGGGGATCGTCAC
AGACGGTTCGAGAAGATCATTCAGCAACGGGTAGAGCTTCTCTCGCCGCTCTTGGCTCGGAATACCTTGCTGGCCAGATA
GAGAGGCAAGTAGGTTGCGTACCATAGCTGCAGCATCCGCAGGGGCTGCCGATGAAGCACTGCAAAGACAAGAGTTAGCG
AAAGCCTTGTCGATTCAAATTTGAAAGCAATGATGAAGGTAGCATCTTTCTGCATATGAAGGCGAAGACAGAAACCCTTT
TGTCTAATGTACATGGATGAGCAGTTCCGTGGCCAAGTCTGTTCTTTGGTGGCACAGCTTTCCTATCCCCTGTTCCTACT
CCTATTTCCGGAAGGGGGGAGGGGTTCCAAAAAGACTCAGTCCAATGAACTGTCCTTGTAATGTTTCGAAAAAGATAAAA
AAAAATCTAAGATGCTCAATGAAACACCGTCTGTTGCCAAACTCCCTTGGCTAAATAAACGTGATGAATGTGCATACTGT
TTTTGATCTGACTTTTGGTTCAGGGAGTTTCGGGTTTGGGGGGCCTTCTTGTCTTCTTTCTCTTCATGCTTTTTCGCATT
GTCTTTTCAACGACATCTAAAGGGGAGATCGAACACCTACGCTCTCGCTCCGTCAGCTCCGCCTTCACGTGAATCCTCTC
CCTCGCTCCGGGCATCGCCACCCGTAGCACCTGGGCCGCCGCTGCTAGATTGGGGCAAATTCGAGCCGCCGTGACCCTCG
ACGTCCTCCATGGTCTCATCATCATCATCGCCGTCTCTCCGGCTGTCGTCTGTGTTGTTCTTCACCTGAGCCAACTCGTG
GTTCACGTCAAGCTCCTCACCCTGCAGCAGCCGGTCGACGATGTCTCCAATCTTTCGGTCCCGGGGGCTCATCCAGGAAG
GGTCGCCACTCGCAGCCTGTGGCTTTGACTGCAGCCAAAAGAGGTATCGTTGAGAGGACGATTCAAACTTGAGGACAAAA
ATGCGACCGTTCGTCTTGGCTGAAGCGTGGCCAGAGGCCGCACCATCGTAGGGGACAAAGTGGCCGTCGGTTGGCACCAT
GACAAGATTCAGTGTCGGAACATCAATTGGCACATTCCGAGGCCGCCAGCAAAACCGAATGAGATCTACGTCGGATGTTA
AAACACGAGACTCCCACTTCAGCAGTGGCGGCATCAAGAGTCGGGAGACAAGTCGCATTTCGTACCTTCTTCGGAGTAAA
GATAAATGTAGCCAGGTTCGACAAGAGCCTTGACCTTCTGAGGTCGGGTGGACGTCTAGGTTGACAAATTGTCAATGCTC
CAGTCTTCTTTTGCCGTCACTGCAGTTTTTCATAGAGGTCTAGAAGCATGCGAGGGGACAAGGGCAACTTACATCCACTT
CACAGAGCCCAGCCTTGAATGTAATGATCGGAACAATTGACATTTTGTAAGCCTAGGATCTTAGGACCCAAACTGAAAGA
GGTGAGATTATGTTCGGCAAAGACGGATGGAGAGACAGCTGGAGTCAGAACGGGCTGACGTCGTTTGGCTTGTTGATGAT
GATGTACTCAGTAGCTTTCGGAGCTCTCTCCACCACGCCAACCGTCACCAAAATTGCGGAAGGCTGCCAGTTTCGTGACG
TTTTACTTCCCCATACTGGCAGCTGGCCGCCAGGCGTCAAGCCTGGGACCCGTAGGTCGAACCCACATAACCACGTGACT
GGAACAGGGCGCTAGCCTAATCTGTATAGGCTCCAAAAGGGCTTGTGGCCTGCCGTTATTGGCTAGACTGGACGGCCGCA
CATTTTGGCAAAAAAAATTGGCACATGGAGGCTGGCCTGTAGGGTTTGTGGTCGCCCGAAGTGTGGCTAGCAGTTTTTTT
TAATATTATTCTGTGGTGTGGTTTTTTCCTACTCCTCCTTCCAATCCCGCAACTCAAGAATCGCATCGCCGCACTCGCGA
ATCGACAACAAGTAAAGGAGTTGGGTTTGGTTTCTTCTTCCTTCTGTCAACCTCTTTATACCCTCGAAAATCTCAACATG
TCGGCGGCACCCACGACGAAGAAGTTTGGCAAGTCCACCCGGACGGTGCCTCACCCCAGCCAGCGGGCCCAGAAGTGGTA
CGCCGCAGAAGAGGACTCACAGCCGAAGAAGGTCAGTAGTGCCGGGAATGAGATGATGAGGAATACGAACAGAGAGCAGA
TGGAAGCACATGTCATTGGCTATCAGTGCAGTGGAAGAAGGAGATGGGGCCAGGCGGCGGCAGTTGAGGTCCGACAGGAT
CGAGACTGCCTAGACAGGGGCACCGGGCATGGAATGAACGGAACGGGAACCGAGTATTTGAGAGGCGCATCGCTAACGTA
TATTCTCCTGAACAGGTCCGCAAGGCCCTTCGCCCCTGGGCTCCACGCAAGTCCCTTCAGCCCGGCACGATCCTCATCCT
CGTTGCTGGCCGCTTCCGCGGCAAGCGTGTCGTTCTCCTTAAGACGCTCGACCAGGGCCTGCTCCTGGTCACCGGCCCCT
TCAAGGTCAACGGTGTGCCGCTGCGGAGAGTGAACGCCAAGTACGTCATCGCGACATCCGAGAAGGTCGACCTGTCCGGC
GTGGACGCCAAGAAGATCGAGGAGATCGCCGCACCGAACTACTTCACCGCGGAGAAGGCGAAGGAGAAGGCCAGCGAGGA
GGCATTCTTCAAGCAGGGAGAGAAGCCCCAGGTAAGCTTTTTTCACGGGACACATCGCAGAACATCGACGAACGAGAATA
CAGGACAGGACAGGACGGCTAACCCCCCTTTGCAGAAGAAGGTCGTCCAGGCGACGCGCGCAGAAGACCAGAAGGCCATC
GACAAGGCCATCATCGCAAACATCAAGAAGGTCGACCTGCTCAGCAGCTACCTCGCCACATCATTCAGCCTGCGCAAGGG
TGACAAGCCCCACGAGATGAAGTGGTAAACGAAGCTCGACAACAGGTGATGGCGTGGTATCCACCATATACCGCGCCTCC
GGCCTTGTTCAGCTGCTTTGTTACGTCTTCGTCTTGTTTCTCTCCGACGTGATTAATCTCAACCCAACTGGGCTGTTGTG
TAAGAGGATCGACGGAGAAGCCAGATGAATGGGTGGGGTATTGAGCGTGGGAGAACGATGTTTGCGGGGGGCGGAGAGGT
GGCATGACCGGAAAATCTCTCTTGCCTTGGACGGTTACCGTGGACGGTGTCGACCTGGGCTGCATGTGTGTGCGTTGATG
TTTTCTTGTTAATTTTCTTGCACACACGTATGGGACGACAATGGCCTTTTGTGTGGGGAAAAATTCTACTTTTAAAAGGG
CCACAAGGGAAAAAACTTAAAAAAGACCTATGACATCAGAACACAAAAAAATATTGAAAATTCCGTGTATGTCGAGACGT
GAACATGAGATGTATATTTTTGAGATCTTATGTCTAGATGCGCTTTTTAAGGGGGATATATCAAACCTTGCCAGAGGACG
CCTCAGTTACTTTGTCTGCATAATATGCTTATCCCCGATCGGCCCAGCTTTGGATCAGGCCCTCTGGGGTTGGGTCGTAT
TCCTTCAGTGTGACCTTGCCAGTAGCCTCGTCCAGATATGTGTTGGCTTGCACAAAGACTTTGCGCGGCTGCTTGTTCTT
TAGTACAACGTCGCGAACCTTGGTGCCCCAGTACTCTAGTCCGACGCTGGACATCTTGCCGGCAAAGAAGTCGGTGCCGT
TGGTGACATCGGCAGTTGCCTTGTAGATGTGCAACTTTTGGAGGTAATCGCTCACAGCTGTCCAGGTGTTAGAAATACGC
ATGACCAAAGGAGTTGAAATGTAAACTTGCCCTTTCGTCCAGTCGTCAAAATCTTGGACCGGTCCAGGTGAATAGTCAGG
TCCGACAAATCATCCTTCTCATATGAGAGCTTGCAGAAGTCGTCGCCCGCTTCCAGGAAGCACTGTGCCGAACACTGGAT
TAGCAGAGAATTCAAACACGAGGAAGGGGAGAGAACGTACACGAAGAATAGAGAAACGTGCTTGACAGTGCGGCTGTCCC
CATTTTAGACCCTTTGGGTCCCAAAACTCCACCGAAGTGAGGCCGGCTCTGGCCATGGAGAGATAGGATGCATACAAAAC
GTCACCTGCCTCGCCATTGATGTCGACAGTGCCGTTGCCAAAGCCAAAAATCTTGAGCACGGGGAACTCGCAGCTGAGGA
ACATGGCGACCAGCTCGGCGCGGCACTCTTCGTATGCACCAGCAAGGCCACCGAAAACGGATCCCCAGGTCTGGCCGGGC
TTGTACCAAGACGTGACCGGTTTGCCCGTAAGCGGGCTCACCGGCGGGTGGTCATGGTCGAAGTTGAAGACACCTGTACT
CGTCTCTTGGAGTAGCTTGCCACAGCCGTGGCCGGTGAGCTCGTGTAGGCCGACTTGGACCTCGAAGGCACCGTCGCGAT
ACTTTTGGTAAAGCTCGAGGTCTTCGTCACGGATGAAGGGAATCTTCTCGTTGGCGGCCTTGGCACTCAAGACGTTGCCT
AGTGAAACATTCTTGAAGCCCTCGGTCTGGCGGATGTCGTCGTAGTTGGGAATATTAATACCGGCCGGGATTCCGGAGCT
GCAAAAGGTGAGCACCTCAAGCGACGTGAAGTCGGGCGATAGGAACACGTCCTTCTCGAAGTCTGCAGTCCACGGCAGCA
GCGGTATCAGCGTCGGGGCGGCCTTTACGAGACCGCCAAAGGCGCGTGTGCGCTCGAGGTTGACAACGGCAGCAAAGCCC
TCCCACTCGCCACGGGTGCCGGCCGGATCGCGGTAGGTCTCGATGAAACCGATGTTGCACTCGACCATTGGGCCCTTGTC
GCGAATCCAGAAGCGCTGGCTGTCTTTGAAGGCGAGCAGCGAGCCGTCGTGGAAGGAGTGTGCATAGGCCAGATGCATTT
TCTTCTGCGTCTCGTTGTCGGCGTTTTCGGCAGCCTTGGCAATGTATCTAGAGATGGCGGCCATCTCGGTCGCGTAGTCC
CCGTACACGAGACGGATAGTGGCGCCTTTCAATGGGCCATCAGCATCGTCGATGGCGAATTCTGTCTGGGTGCTCTTCAG
GTCGCCGCCATCAGCGGGAGGCGCCGTCACGGCAGAGGCGATAAGCAGCTCGTAGACGTTACTGCCCTTCTGCTTGCGCA
AGCGAGTATTTTCAGGCAGAAGGCTCATCTTCTCGGTCCACTTGGCCACAGCCGAGATCTCTGCCTGGGTGATGTCGGGC
GAGTCGGGGTAGTACGTCGTCAGGTGGCCCTCGTCGGTGTAGCCCAGGTGCAGGAGTCCAGCCGAGCCGGCAGAGAATAT
GCCTCCCTTCGTTGCGGCGTAGTGCTTCGCGGCGGAGGGCGACGTCTCTGCTAGAGCGGCAAAGGCAGACTCCGGGGCTC
GAGGGATAAACTTGGAGTCACCAAAGCTCTTGTAGTTGCCACCGTTTCCAAGAAACTGGGCCGCATACTCGAGAAAAGCT
GCCAGGTGAGGCTCTTCGATCCCGGCCTTCTGGGCCAAAGCCTTCCAGTCACCATTGGCAGTCTCATTGAGGGCCAGGAT
GAAATCGTAGATGGCTTCCGCTTCGGGGGATACCTGCCGGAGAACTATCCGCTGGCCGGCAAAGGCAGCCCTGCTGATGA
AGTGGGCATAGCGCTTTTGGCTGTCGGAGAGAGGGTCAAAGTGCTTGGAGATCTCCAGCCGCACCACACTGGGCGGTGCG
TCGGCCAAATAATGGCTGAGCTCGTGGGCAGTTAGGGCCATTGTGGTGCTAGAGCAGGATCTGCGGGAGATGAGGCGGGG
AAGTCTGGGATGGTGGCCGGAGGCGAAGTGAGTAGGGGGGGGCCAAGCGGAGAAAAGCCTCAAGGGACTGGCAAGATGCA
AACCGCTATGTAGGGTGTGAAGCAGGGGAGCGTGGTGAACACGGCCGAAGCGAGGAGTAAAGTTCATCTGACAGAAGAGA
GCAATTTAAGATTCTTACAAAGAGATGGAGGGGAAGCTGGGCGAGGCTCACACGGTCGTGTGCGCCTGTGGTTGGCTGAC
TGGCTGCGTACCTGCCGTTTTTGGGAACAAGCCGATGCCAGCAGCAGCCAATGAAGTGGCGGTGCAGGACGCCACACCAG
GACGGCCAAGGAGGCACGAACGGCGGGGTTTTAGAGCTGTAGCGGCAGGAGAGGCCGGAGCCAAGCGATGTCGGCTTGCA
GCCGGCGGACGAGAAATGCTCACGCGTTACCGTCCAGACTTTGTCGTGGCGGTGAAGTCGGCCCGCGCTGCCGAATTGAT
TTATGTGGTCACTGCCCCTGTCATAAGACGGTCTACGTCTACGAGAGTCCAGCTCGTGCAGCCTCGTGACCCCGTTCACG
GTCTACAAGTAAGATACGTGTACGAGTAAGATACAAGACGTTCCCTGGCTTCGCTTCGGCTTCGGTTGACCCCCTTAAAG
GTGCGATCAGAATCTCGAAAAATACTACACCGACAAACTCTGCTCGTCGGTCGGCACTCACCTGGGGTCTCGCAGCTGCT
CTCCAAGCCCAACAAGTGCCAGCCCCCACACTCGCATGGGCACTTGGGCTGCATGCAACAGCAATCCACGGCACTGTGAC
GGTCAGTGCGAACAGGGCCATCTTCGCCGAAACGCACCCTATTTGCACCAGCAGTAAGCTGGCTAAGCAAGCTGAGCGTG
CACCTTCTTAATCTAGGGAAATGTGGTAAAAGAGGCCGAAGGGGGGGGGGGATTTTACTGCTGGAAGCTGCGACCCCACA
TCGCCTAGTAATTGCCAGCGCCGTAGTTTTTCTGCCGCGCCCCTATTGAACGCCAAAACTTTTCCACCAAACAGATAGCT
GGAGAGCTGGCACTGTTCTCTGGGCTGAAGCGCATCTGCGCCAAAGTCTCGGGGACTTGGATTTGCAGCTATCGAAAGCA
GGGACCAGTCTCGTGCCGTTTGCGCCTTCCATCCTTCTGTGCATCCGTATCCCACGCAGGGTATCTTGCCACATCCCGTG
TCGCGAGCTAGACCCAGGCAGCAACCCTCCGGGTGGTGCTTTCCTCTATGTCGCTCCTGCTGCCATTGGCCTTGAGCTAT
GCATATGTTGTCGCCAGCAGCAAATGTCGCATTCGCCCACACGGCAGGCGCGAGTGACGAGAAAGCACCGCTCTCAGTAG
CTAGCCAGCGCATATGTGATAAATGCAAATCTTTCCTACACCAGCGGCGTGGTACAGTCCAGGTCAGAAGACATGCATCC
GCCGCTAGTTTTGGGGGCCAGTGTACAAAAGCTCCCTTGCTAGTCTCACCGATCAGCCCTGACGCCGTCTTCCTTGTCTC
TCACCGGGTTTCTCGCTATTTATCCTCCGCCGCCGCCATCGCACAAGGGCCTAATTCGACTTGATTTTCGTGACCATATT
TAGTCTCGTTCTTTTTAACCGCGTTGCCGCTGTCGTGGCCGACTTACACGCCGCCTTTTACTACACGGTATGTGTACGAT
TCTGTCAGCACCTGGGGGGAACTAGAGCAAATCCCTCGGTGTTCTCAGCAGTAGAGCAATACGGGAGAAACGGGCAACTT
CGCGAGGCAACTAGTCGAAGATGATGTTTTCAGTGTCAAGGTCGCCAATGACTGTCTCCAAAAGCAACGGCACGGTCCCC
ACTTCAGGCGACCACCATATCTGGCTGGTGACAGGGCCGGCTGGCACCGGAAAGACGACGCTGGCCACCTTCCTGGCCTC
GAAGCTGGATGTGCCGTACATCGAGGGCGATGAGGTGAGTGGCTCGAGACCTGCTTGGCTGCTTGGCCGACTCTGTAGTT
GACATCCCCTCTAGTTTCACCCCCCAGCCAACATTGAGAAGATGCGCGATGGCATCCCGCTCACCGACTCGGACCGTTGG
GACTGGCTGACAGCCCTGCGCGAAGAATCGGTTCGCCGCATAACTGAGGGGGGCAGCAGCTCCGTCGTGCTGACCTGCTC
CGCCCTCAAGCGCAAGTACCGCGACGTCATCCGCGTGGCCCCCTACTTCAACTCCAGCGTCCACGTTCATTTCATCTTCC
TGCACGCCAGCGAGGATATCCTGCTGCAGCGCGTCTCCGGCCGCAAGGGTCACTACATGGGCCCCGGCATGGTGCAGAGC
CAGCTGGACATCCTGGAGCCGCCCAAGGAGGACGAGACGGACGTCATGTACGTAGACGTGGGGCGCCCGTTGGAGGAGAT
CGAGGCCGATATAATGCAGCGCGTTATGGGGACCAATGGAAATGCTTAGGTCGTGTCCAGCCGGTCCCTCTTCCTTCGCT
ACCTTTTGATTTGCCTCTGTCTGGTCTGTTTGGTTGGTGTTGTTATTGGTCTTTGCACACATTTGAGAAAAGGTATTCGG
AACTCATCCAAGCTATGATCTTGAATGGTACACCTCTGTTTATATTGTTGCCATGTTTACATATAGAAGGGAAATTGGCT
TTGGTTGCGTTTGTTTTTGGATCATGCTCCTAAATGATACTCTAGAGCTCCATGTATTAGAGCTCCGTCTTACAGGTTTA
CCTGGTACGTATTACAGTCATATACACAGAGCGATGTGCCATGCCTGAGACCAGTAGACATGGGGGACAGTACTTCGTTC
AGCCTATTCAGGCAGGCACACAGCCACAATAGGCTTGACATGCATGTGCACACAAACCTGCTCCATACGCATTGTCTACC
ATAACACCGCTCTTCTATCTCAGTTGCATGATCATCGTGTCTGGCTGTTCCACCAATTCCCGTACGACCTCAGCTGCCCG
TGCCACCGTAGCCCCGTCTACCACCCGATGGTCTGCGCTGAAGCTGAAGTGACACACGTGCCGCTTTATGATGCGCTGGC
CCGCAGCACCTTCGCCCTCGTCAGAATCGTCTGCAAAAGCCGGCACAGTGCGCAGTCGACCGATGCCGAGGATAGCCACC
TCCCGTTCGACTACCACGGGGCTCAAATACGTGCCCCCAATATTGCCAATGTTGGACACGGTGATGGTGCCTCCCTGCAG
GTCGGCCGGCGCGAGCTTTCCCACCTGAGCAATCTGCTGCAGACGCACCAGCTCGCCCGCAATCGACAGCACACTGCGTC
CGTTTACGTTGCGCACCACCGGCACCACAAGCCCGACAGGCGTGTCCATCGCCACTCCGATATTGTGCTGGCTGCGGTAG
ACGAGGCGCGGCTTCTCCGCACTGTCGGAAGGCACCTCCACGCGTGCGTTCAAGACCGGATACCTGTTCAGCGCTAGCGA
AAGAGCTTTGATAACAAATGGTAGGTAGGAAATTTTGTTGACGTCGCCTTCTCCTGTCGCCTGGCCAGCAGTTCGTGCCA
GCGCGACGTTCGCCCGCTGCCGCAGCCGGAACAGCTGCGTAAAATCCACTTCGTCTGCATACAGGAAGTGCGGGATGGCC
AGAGACTTGGTCATAGTCCTAAACATCTGCAGCGGCATGCCGGTCAATGGGACTGCCGTCTCCTGCTGCGGTGCGTCTTT
GGTATCAAGAGCCGCCGCCAGGGCCGGCTGTGTAGTTGAGGCCGAAGCTGGGGATGGGGCTGCTACCTTCCTCTCCTCGA
CAAAGCGGTACAGGTCTTCCTTGAGCACCCTACCATCTTTTCCCGTGCCGTCCACCTGAGTGATGTTCACGGCCAGCTCC
TTGCACAGATGCCGCACGGCCGGTGTCGCGAGAGAGGATCCGGAAAACTTCTTCTTACCTCCAGTAGGCGAAGCAAGTCT
GGTCAGGTTTTGCGGCTGTTCTTGCAGAGACTGCTGTGCCGAAGTAGGCGTTGTTACTTCCTTTTCTGGAGCTGTCAACT
CTGCCGATGTTATGTCTGCACCCGGAACAGTGGCCGTCTCAACCGCTGTTTCGTCCGGATTTTGCACAGCCTCCTCAGCG
ATGTCGATATCCACAAACGCCTTTCCAACCTTGGCCATATCCCCGGCCTCGTAGTGCAGCTTTTTCACTACGCCGGCAAA
GCGGCTGGTTATCTCGACCGACGCTTTATCGCTCTGTACTTCGCAGAGAGGAGAGAACTCTTCCACCGTAGCTCCAGGCT
CGACAAACCACTGTATGATCTCGCACTCTACTATTCCTGTAGTTCTAGACGTAAGAATCTGTTTGTTGTACCCCGTCGCT
CTGCTTGACCTACCTTCGCCAATATCTGCGAGTAGAAGGGGCTTAACAGCCAGCAGCCGGCTGGACGTGTGCAAGTATCT
AGCACGAGGAGATGTAGGAAGACAAGAGCCCAGAAGACGACTCTCAAATTTTGGCGACGCTGCCAATGCCGTGGTGGCCG
ATATCCTGTAGCCGCCCACTACAACGCGTATCGCCGGGGTTAAAGCCCAACAGCTTCTTTGACGGAACATGGCTGTGGCA
AGTAGTAACGAGCGCTGTTGCTTCAGAGTCCTTGTTAAATCTGGCACAAGTCGATCTTCGAGCTGTTCTGATCACCCCGC
GGGACGTTTGTGAGAAGTAACGAAGAAAACTCTCCCATGTCTCTCGTCTTTCCTTCCTTCTCTTTCTGGGGAAATGCGGC
TGCTTGGGCCGAGCTAAAGAAAGCCTGGGGAAGTCTGCGCCGCGGGTAGCCGACGGCCTTATCAGTAGTGGGCCACACCA
GGGGAAACCGTGCTGCGGCTCCGAAGACGCACGAGCCAAGAGGGGATCCAGAATTTTATTTTTTATGCCTACTTCCAGCT
TCCGTCGATTGACAGCTACGGAATCCGGAGAACTTGACTCAGCGACCACGCCGCCCCATCTCGACTACATCGGCTATTCC
AGTTCGGTCACATAGCTGTTTCCAGCGGCTGCAGAGCATAATGGTGGCGCGAACATTCACCAATGCGGCTCTTTCGGCTG
GAAAGGCTGTCGGCCTCGGCGCCCCGCCATCTTCTTCATCCATCCGGTCCTTGCGGCAGGACTCTTTTGCCGCCGTTCCA
TGTCTTCGGTGCCAGTGGCGAGCACTGAGCGTATCGCAGTCGCGCAGAGACACAAAGGCAACGCCCACAAGCCAGTCAGA
GCCGAAGGCCCCGGCTCTGGAGCTTGCCTCTGCTTCCTCGCCAAGTCCGCTGGTAAATGTCCCTCGCTCCTACGGCGAGC
GTCCTAAAGAATTCACGCCGACGCCGCTCTCCCGACCCATCGGTATGCCTCTGCCGCCGCTGGCCGGTGAAAACAGCGGA
ATTGACTTTCGGACTCTGCGCCAACGCCGTGACGACTTTGTCGACTACGAGAAGCATCTAGTGCGAAGACAGGAGTTGTG
CGTGCCCTGACTCCCAGAGGAAGCCAGCCTCTCATTGTTCGTGCAACTCTCTCGACTGACCGCTGTCCTGCTTCTCCGCT
AGGAAAAATAAAATCATCAAGCCCTACTTCCGCGACTGGACCAATCTCCAATTCCACAAAGGCAAGACGTTCATCGCGCC
ACCGCGTCTCTTCCGTGCCGATCTCTCGCTCTACTTCCCCAACATCATGGGCGAGCGCCTGCTTTCTGCCGACAAGTCGG
TCACCTCAGAGCTAGCGGACACGACTCCTATACTGCAGCAGAGCGCTGCATCCGTGGTGGCCATGTTCAGCAGCCTATGG
GCCGAGAACCAGGTCCGCAGCTTCGTATCGCCCGAGGCCAATCCAGCATTGGCGGAGCTGATCAACACACACCCCAAAAA
TGCGGCGGGAGGCGGAAGTGCCAACCGTTGCAGCTAGTGCGACTCAACGTCGAGGAGAACGCTATGCGCGCATGGCGAGT
ACGGCGATTCAGCGGATCGCAGCGTCGGCGCATCGAGCCGCGCGACTGGGAAAAGTACCTGCTGGTGACGCGCGGCATCT
CGGATGAGATCCGCGAGAGCATTGGCCTGCTTAACAGCAAGGTCGGCTATGTCTACCTCGTCGACCGACATTGCCGTATC
CGATGGGCTGGCAGTGGTGGCAGCCAGCCGGATGAGTGTCAGAGCCTGGTTCGTGGCATCCGCTGGCTATTGGCCGAAGC
CAAGAACGAAGATCAGCTTCTACAGCAGCAGAGACAAAAGCCAGTCCCTAGCGAATCGCAGGGGCAGCTAGCTCGCTGCG
CTGCAGCTTGAATGCATCGGTAGTGCTCGTGCCGGTTGTCTAATTTATGCCACTCTTCTCCTTACGGGTGTCGTCTAGGT
TTGAGCAAAATATGTAACCGGGATCATGTATTGTACAATAAATTAGAATAAAAGCGACGGGACGAAATCCCCGCATAAAG
GATCGCATGCGCTTTCTTTCCCCAACCATGGAACGCCAGAAGCGAGTCTTGCCACCCATCCGTCTGGGTGCAAGATGATT
ATTAAACGTCATTGGCAAGATATGCAGTATGCAGATCGAGAGAAAAGTCCGTGGTCCTTCACAGAAAGAACCAGAACACC
ACGAAGCACAGGGCGACAAACGAGCCCATGATTATGCCATCGCGGCGCTTCTTGGTCGAGATGCGACCTATCAGTGTGTT
GATCCCGGGCACCTGGCTGGCTGCCAGCGTTATGCGCCGGTTGATATTGGCGAGTGTCTCACGCTGGATGCCAAAATTCT
CATTGACCGCGTACGCCTGGCTCAGCACGCTGTCCACCATGTCGTGGCTGCGGTCGATGCGGCCACGTTCGCCCAGCATG
TACTCGGCCTCGCTGGCCTCGCCCATGTCGTTGCGGTCTCCTGCACGGCTGCTGCCGGCGCGGTAGGCATCGATGTCGTC
GCGCACATGTGCCAGCAAATTCGCGCGGTCGCGGGCCTCGGCAAGTTGGCCCTTCAGCCGCGCCAAGTCCTTGCGGTGCT
CAGCCAGCTTCTCCCGTAGCAGCGTCAGGTTGTTCTGCTTGACGGCAGAGGACGTGAGGGTTGGGTCGGACTCGAGCAGG
CGGGTGAGCTTCTGGATCAGGCCGTCTCTCTGGAGAAAGGTTAATGACCAGACGCCCACGAGGAAACCGAAAGGGCAGCG
CCCATGCACACCTTTTCTAGAATCTCCTGCAGCTTTGCCTCTGTTTGCCGCTCTTGCTCTGCCGGCTTGGCCGGCCTGGA
CGATGCCGTCGACAGTTGCGAGTATGTCTGGAGGAGACTCTCGGTCTGTGAAGAAGAGGAACGTTAGTCATTGATGGCGA
GCCGGTTGTGAAATGCATGTTTACAAGAACGGGAATCACCATGGACAGACCTGGCTCTCCAGAGATCGCACTTGTTGCCG
TAGCTGGGTCCAGCCCGAGTTTCCAGCGCCGGCCGCCATAGCTGTAGGGCGTTCGGTTAGCTGTCGGATGATGAGGGGCT
CAGGTGCGGTCGCTGTGTGAGTGGTGCAGAATGGATTCGGCGCTCCTGGTCACTGGTATAAGATCTGGTGGAGAGCCGTA
GCTGAGTGTTGAGCAGGAAAGCGGACAGTCGATGCGCTGGCGAGGATGTCTTCAAATAGAAGCTTGGATACGGAGTTGTC
GCAGCTGTTTTAGAATGTGACGTCTCCTGACGCCACAGAAGTAGGATTGTATTTTGTTAGTACTCCGTACTCAATCAAGC
TTCGAGATATCCATGTGGCGGTGCAGCCCGTCTTGTTTCGGAGTTTAGCTATTCCGTCCCCCTCCCTTGCACGTGATCGC
CGCTGACATTAGCTAGACTTAGTTTCGATAGGGCTACTCGACCCTAATTTTTTCCCTTCCTAGAGGGGCCATAGAAAAAA
AAAATAGGAACGGAACTTTTCTTGACTACTCGCTCTGAACCGACGACACAACCCGCCCATCGCCCAAAGAAAAAAACATC
ACGTCGCGAGTCCATCAACCCGACATTCCTCATACAAAATGGTACGTGGCTGCTGTCTTTTGCAACTTTCGCGCATAGAT
TTAGGCTGGGGGAGATGGGACTGGTTGTCGAGAAGCGCTTCGCGAGTCAGTATCTTTCGCCTGTACGCTGCCGACACACT
CGAATCACCCCACGATACAACAGCATCCCGATGACCAGAGAGTACGGAAACTTGCAGCGCCGGCTCTGATACCGACGAAG
ACGACCTTCGCTACCACTTTCGAGACGGGCCCGGGGTACACGGCAGACCGGACATCGAAGCAAAGAAATTCTCAGAGAGG
ACAGCCAGGATGGGACGCACGGCCCGGGACTCTTTATTTGCGTCGGCACTATGGAGAGAGAATGAAGCAGGGCGCTAACA
TGTATTTTGTGTGATCATGCAGTCTGTCAGCAAGGTTAAGGCCGGCCAGCTGTGGCCGAAGAACAAGGATGAGCTCCTGA
AGCAGCTCACTGAGCTCAAGACGGAGCTTGGCCAGCTGCGCATCCAGAAGATCACCTCGTCTGGCTCGAAGCTGAACCGC
ATGTGAGTCTTGATTTCTGTCGTGGAGGCCAGATGGGGGAAAGGGAATACAGACGGATGCTGACCTGATGTCTAGCCACG
ATGTCCGCAAGTCGATCGCCCGCGTCCTGACCATCATCAACGCCAAGCAGCGGGCTCAGCTGCGTCTCTTCTACAAGAAC
AAGAAGTACCTGCCGCTGGACCTGAGAGCGAAGCAGACCCGTGCCATCCGCCGGCGGCTGTCCAAGGAGGACTCCTCGCG
CAAGCTAGAGAAGACCAAGAAGCGGTTGTCGCACTTTCCCCAACGCAGCTTTGCTGTCAAGGCATAAAGAGAAAAGTCGG
GCACTGCGTTCATTTGGGATTCTGCTTCGTTCTTTTCCTTAGCGTCAATGGGTGATGGGGGAGGATAAGGAAATAAATAA
AAAAACAGCCAAGGGAGAGAGGGGGCGGACAGACCCCATTCCTGTCTTTCCCTGCTTTGTGTTCCCTCTCTTTTCTTTAA
TTCATGTTGTCACGAAGACGGACAACACAAAGAGAGAGAAAAAAAAGAGTGAAGGAAGCGAGACCACCAAGCTGGAGAGT
TAGGAACGGCAAGGCGGAGGTGGAGAGTATGTCCTCTTCCCTCCCAGATCTCTAGATCTCTATTTTTGGAGAGCATCAAG
CATCATGAAACAAAAAAAGAGTAAAAGTCATTTTTCCGACTTCCTACGTGTGAGCTTTGTCTTCTCTGTGACTATTCGTC
GCTAAACCTCCCGCCGGACAATTGTCTACCAGAGGCCCTCATCATGGCAATATGCATGTCTTCATCTATACCTCGAAACA
CCGCCCAAAGGCACCGACTATTTTTTGCGTAGCGCAGATGCAAACAAGCCAAACCCTGCCGCCCATCCATATTGTATCGC
CGCGGTCTTCCTCACAGCGCCGTTTGATGTCGAACAAAACCCTTCCAAGCTATGCAATGTGAAACTATCATGCTATGTCT
ACCAATGCGGCCACAAGCGCTGCTGGAGACTGTATGTCTGCGCGGCTCTTTCTATGCTGTGTGCCGTGGCGGCGTAGTTG
GTCCTTGCGGTGGAAATGCTTCCCACAGCCGGGAAATTGGCAGATGTACAAGCCATCGCCTGTGTGGATGCGCTTGTGCT
TGGACAGGTTGGATGACTCGCTGAACTCCTTACTGCAGTATGGGCATTTCAGCGGCCGCACCTTGGTATGTGTCCTGATA
TGCATGGCTGCAGGCGTGTCAGTGCGGAAACGCGGTTTAAAAAGAGGCCAATATCGGCTTACTTAGTGCACTATGCTGAC
GGAATGTTTTCCCACATATTTCGCAGGACAACGGTTTGATGTCAGCATGGATGAGTTTGTGCTGGACAAGCGCCTGGTTG
GCCGAGAAGGACTGCCCACAGATGCCGCAGAGGAAAGGCTTGTCTGAACGGTCGTTGTCAGTACAAGGTAGGCCAAAGAG
AAAGGTTAGGATATTCTTACTACCAGTGTGCACCTGCATGTGGCGGTCGATCTTGCTCTTCTGTGCAAAGCCGCCCTTAT
CCTCGCAGTCACGGCGGTTGCATCCAAGCCAGCCGCAAGAGTAGGTACCACCGACATCGCGCTTCAGCTGATGGGTGTGG
GCCTCAATGGTGTGCCTGTGAAGGTCACTGGCCGAGTCAAATACCTGGCCACACGGGCTGGTACCGATCGCGTCACACCA
GAAGCACTCGTGGCGCTGCAGCATGTGCTGGGTGTCCTTGGCTTCCCGGCCAGGCAGCAGTAGCAACGAGCACTCTGAAT
CCGGTCGGTACTCGTTTTTGGGAATAATGGAGGCAAAATTGAATTTCGGATCCAGCGGCGGCGAGCTCTCGGGCAGGGCC
AACGATGGTGTATGCATCGTATCTTGCGACGACAAGGACACAGTCGAGGCTGTCGACGATGCCAGATCGGGCACGTGACT
GTGCATGCTATTGGCCGGCAGTTGTTGCAGTTGGTCGGACTGGTAGACGCGGTGCTCAGTCCAGAAATGCTGGACCATGG
CTTCGACATTTGGAAACTTGGCGCCACATTCATGAGAGGCATCCAGACTGTTGTCGCCGGCTAGCATCATGTTGAGATCG
ATGTTGTCAAAATAGCTTGCTTGGCCTTGCGGTATGACGTGCTTGATGTGACACTCAGCGTAAAAGCTGGGATCTTCGAT
CGGGCAGAAGGGGGCTCTACAAGACGTCGGCTGCAGTGGGTTATGGGCGTCGCGGAGATGCTGGTAGTTCATCAGAAACT
GAGGACTTATGCACGAGCCTGGGCCCATGACAAGCCCCGGGCCAGGGGTGGCTATGAAGGGCTGTTGGAGAGCATGCTGG
TGCTGCGGTTGCTGCGGTTGCTGCTGCAACTGTATGCCCTGGCCAACGAAGGAGGCAAGGGCAGCGGCAGCGATGGCGTC
TTCCGACGTGAGAGAAGTTTCCGCAGCAGCGGCCGGGGGGACGCTTTGCAGACAGGTCTCATCCTCGCAGCAGGCAGACG
GATCTTCTGAGCAGATGGATTCATGGCATATCTCGCCGTCACCACAGTCACTGTCACAAACGGACTGGTTGTCGCACTCA
ACATCCGGGACGGGGTTGTGTGGAGGGGAAGACAGTGCGGAGAGCTGGTCGACAAAGTCGTCTTGGTCGAAACAAGTGTA
GCCACCTCCAGACGTGGCTGGCGAGCCGGATACAGCGTGGCCAAACGGGGTGCTGGTGGCGGCGGTGGTGAAAACAGAAT
GGGCATCAGCGCTGGGGGCGCCCTGGAAGAAGTCGAGACCAGCAGCGGCGTGTGGGCTGACTATCTGACGCAAGCCAGCG
GCGTGTGGAGGGTAGTGGCGCGTGTGGAAGAGCATATGGGACGGGGCACTGGTGGTGGAGCCAAGAAGGTTTGTCGTTGG
ACATTTGGGCGGATAGGCACAGAGGTCGTCGTGTGAGGTGCGAAAGCAATCCAACGTGTTTTCTGGGCCGATGCACTGCG
GGATCTGCAGCTCAAACGACTTCCAGACCGCGTCCAAGTCGGCGTCGAGGGCCGCTTGGCCGTTGAGCATCAAGGTATCG
GTAAACTGGTTGAGGTAGGGATAGCTGGGCGAGTTGCGCTGGCCGCGGGCGTTTTCGTCGTCCATGATGACGACAGGACA
AGAACACGTCCGAGAGACTGCAAAGGACAGAAAGAGATACAAGCGGGGGTATGATAGCGGCAAGGAGGCGGCAAAAGCGA
GACGGGGAATGGACGTTCCCGACAAAATCTAGATGCTCCGGAGGACGAGGAGATTGACAACGTGCTTGTGATCCATGCCC
GTGGATAAGGAACACAGACTCAGATAGGGAATAGTCAGGAAAATCACGACGAGGACGTGAAAAATCAGAGGAGAGGGTAG
AGGGAGGACAAAAGGGGAGGGGTGGTGAAGCTGATGGTGAAGAACGGGACAGGCAAGTAAAAACTGTGCAAGAGCCTGGT
GCAGCGCCAGCGGGCAACAAACCATAAAACGGTGCATTCGCGAATTTACAGCGGACTGGGCGCCGAACCCTCCCCACCCA
CAACCGGCGGCCGCCTGCATTAGTGGGTTGTGGTTGGTTCTGGAGTGGCGACCTGATTGGCTACGGCACAGGCATGAAGG
CGAGGCTCAGTGAGAGCGAGGAAAAAAGGTGGTGCTGCAAATGCTGACTGAGAACCTTGATGGACCATAGAAAACTGTTC
GACCCACAGGCACGCAAATCGTCCGAGAAAAAGAAGAAGGAAGATGGAAAGAGAACGGATGGGAGAAAAAGGAAAAGGTC
AAAGACATCCCGTCTTACATGCTCGCAAAGTTGATTGTCTGTCTGTGGCATTTCATCTCGCTTCTTAGTAGATGAATACT
AGGCTGTATTACGGCATGCGCTCTAGAAAGATAGAATAGCAGACGCTGATGAGCATGACGAGATCTCTCTGTTAGTAGCA
CCGTTCTGTCATAAAGGCGGTCAGTATATTGGCGGCAGAACCCAGAAACTGGTGGGTAAGATACGGAGTACGGAGTACTT
GGGACTAATATTAGTAATCAGCTTGCGCAAGTAGTGACTCGGCCCCAGTTTGTATGGGGTAACTCGCCTGATTGCGCAGC
CTTCTTCCTCGTTTGTCCTTATCTTCTCCTCGCCCCGACCAGGCGATGCCTGCAGTCGACTCTTAAGTGATGCACGACCT
GTTGTTGTCTTTCCATCTTCTTTCCATCCTCTTGGCAGCTCCACCACAATCTAAGAACGAAACGTCTCTCGTGCCAGCGC
GCACTCGTCATCGCCTCTAACCCCCGAAGCTTGCACCGTCTCGTCGATATGGGCAACCTCTGCGGCAAGGTCGACTCGGA
CGCCTTTGAACAGCCCGGGCGCGTTCTCGGAAGCGCAGACGCGGTGCTGATCCCCGGACAGCCGCGCACTGCCGCCGTTC
CACCGCAGGCTACTTTGAACCGCGTCGGCGGTCCACCACGGACGCTGGGGGGCGAAGGCAGCTCCGGTGCAGCAGATGAC
GTGCGCAGGAAGGCAGCAGAAGCAGCTGAGGTGGGCTCTCTCATACTCCCCCACTATCTCTCCCTCTAACACGGCAGGCC
CGAAATGCACCCAAAAGCACCGGCAAGCTCGGCAGCAAGCTCGATGCTCAGCGCAAGGAAAGCCGGATGGACACGCTGAA
GAAAGCCAGCGCGGATGAAGTGCGACGACGCGAGATGGATGCGGCCGCCCAGGCAACAAGCCACAATTGATCGGCCAGAG
GCATTGTGCATTCTAATTCTGCGGCCATTTGGCCGTTCGTTTATTACGTAATCAGCGAGCTATGTATCTGCTGTTTTTTC
CCTCTTTTCCTCCTAAGTGACTGTGTACCGTCCGCTAGCCGGTGCCCGGCTCTCGGCATCGGCAGCGGCCACAGTGCCCT
CACGCAACAGCCGGGTCAGCTCGGTCAAGGCGTTGCCCACCGACAGCTCGGTATCGCCCTCGATCAGCAGGTACAGCTTC
GCCTCGGCGCCGGGACCGGGCTCCTTGCCAGGGCCGTAAAAGGTGCCCTTGGTGGTGATGGAGACGCCGGTCGAGTCGAG
GATCTTAGCCACGTTTGTGCGGTTTGTCACAGCCCAGCGCCCTTTTTGCGGGAAGTCATTGATCTCAAGCGTCGCATGGA
ATGCTCCGGCATCCGGACCCTTGTTGTCTACCGGCTGACCCGGTCGCAGCTGTCCGGCTCGGGCCAGTCGTGCGTTGATG
TCGCTGATCGCCGAGGCTGCCTTCTCCAGCGCTCCACCCGTCGCTCCGGCTGCTGCGGCCGTCGCTCCTGCTGGTCCTCT
CTTGTCGTCGCCTGTGGCCGCTCCCTTGTCGTTTTCGCCTCCACCGACACCCTCGGCCTTGGCTGCATCACGTGACACAA
TCATCGACGCTGCCAGTTGCGCCTGTGAAGACGCGGCCTTGGCCTTCTTTTCGTCCTCGGCTGCCGTCTCCTTGTCAAAG
TCGTCGTCCTCACCCTCGGCCTTGTGCGTCTTCCGTTCGCGCAGCCGTGCAGCCTCGCGGTCCTTGTCCAGCTTCTCCAG
GCCCTTGCCGCCAAAGCCTGACTGGTCCTTGGCCTTGCCCGTTTTCACCTTCTCTCGCCATGCCTTGCGCATCTCTAGCA
GCCGCTCCGGCACGGGCTGGCCGCTCTGCTCCAGCGCCTTCGCAATGCCTGGTGCACAGTTCTCCTGCTCCTCCGTCACA
AACGTCACCGCCGTCCCCGTGTTGCCGGCCCGTCCTGTCCGACCTGCCCGATGCACGTAGTCCTCCAGATGGTTCGGCGC
ATCGTAGTTGACCACCAGCTTCAGCTGCTTCACGTCCAGCCCCCGTGCCGCCACCGATGTTGCTACCAGCACCGGACACA
CGCCCTTTTTGAAGTCTGAGATGGTCGAATCCCGGTCCGACTGGTCCTTGCCGCCGTGCAACGACATGCACGCATAGCCC
TTGCGCAACAGCTCCCGCAGCAGCTCGTCTGCCTTCTCTTGCCGCTCCACAAAAATCAGTGCCCGCACGTCGTCGTCGTC
CATGTACAGCTCGCCCAGCAGCTCCAGCAGTCGCAGAAATTTGTCCTTTTCGTCCCGCACCTCCACCATCTGCGTGATCT
CTGGCGCCACCACACTTTTGCCGCCCACCGTGATTTCTACCGGGCTATGCAGCACCTTCTTCACCAACGCGTCGATGATC
CGTGGCATCGTCGCTGAGAACAGCAGCGTCTGCCGGTCGGGCCGGATGTTGGCAAAGATCTTCATTACTTGCGGCTCGAA
CCCCATGTCAAACATCCGGTCCGCCTCGTCCAGAACAATGTATGTCGTCCGCCGCAGGCTCACTACCCGTCCCTGGTTCG
CCGCCAGCAGGTCGATCATCCGTCCTGTCGTCGCTACCACGATCTCCGCCCCGCGCTTCAGCTCCGCGATCTGGTCCTTG
ATCGGCGGGCCGCCGTATGCGCACACTGCCCGCAGCCCCAGCTTCTTCGCAAACGGCTTGCAGTCCCGGTGAATCTGCAC
TGCCAACTCGCGCGTCGGCGTCAGGATCAGCCCGATCGGTCCGTCGTCTCGCACCCGCTCCTGGTCCATAATGTGCCGGA
ACATCGGCACCAGGAACGCCATCGTCTTGCCTGACCCCGTCTTCGCCACTCCGATCACGTCGCGTCCAGACATGATCACC
GGCAACGCCTGCATCTGGATCGCCGTCGGCTTGTCGTACCCCAGCTGCTCGATCACCTCCAACATCGGCCGCGTCAGCCC
GCAGTGCGACCATTTCTGCACCGGCTTCGGCACGTCCTTGCCCGACACCTTGATTCCGTCCAGATCTAGCCGCAGCTCTG
CTACCTCCGCCTCTGTCAGCTCGCTCAGCTCGTGCGGTTCCACCCAGAAGTTTTTGCGGATCGGCGTCAGCTCCATCTTG
CTGTAGTCGATCGTCGGGATATCCTTCTTCTTCCGCTTCGTCGCCATTGCGAGAATCGACTTTGTGTCGATGCCGTTCTG
CGCCTTGGAAAAGTAGTCGTCGTCGTCGCTAAAGTATGCCTCCGGTTCTGCCGCCGGCTTCTTCACCTTCCGCCTCGTCG
ACGGGTCGGGCGCATGACTCAAGTCTGCCATGAACGCATCTAGCGGATCAACGTTGTCATCCGTACTCATGCTGATCTCG
ACCGTAGGTGCAACTCTGCGTTCGACGTGACCGTTCGCCCTCCTGCGGACCGGCGGCTCGTCCAATTGCATGGCTTCCGC
GGGCGGGGACGCTTGAGCTTCGACAGGCTGTGCCTTCTCTGCATCGATTGCAGTTTCAGCTTCCATTTCCACTTCCACTG
GCATAGTGTCGGCCTTGGTCTCGACCGTCTCCATGCCTTCTGCTGCTGCCTCACCAGTCGCTTCAGAATCTTCTGGCTCG
TCTGTCTCCATGGCCGAGCTTTGCTTCTGCTGCTGTTGAAGTCGCTCGTCGCGTCGGGCGCGTGCCGCACGGGCCGCAGC
AGCGAGCTCTTCCTCTGTGCCAGCAAATCTGCCATCGTCCTCCTCATCATCCTCTTCGTCTTGGTTGTTGTAGGGGGTAT
CGTCAGCATCTTCCAGCGACACGTCGGGGAGCTTAGCTAGCTTTCTCTTTGACGTCTCCTCGTCGTCCAGATTTAGCTTT
CGTTTCGACGATGCTCCGTCGGCTGCACCTTTGCCGAATCCGAAGCCGCTAAACGGCGTACCCGCGGATAACTTGTTGGC
TAATGAGGCGCCGTTAGTAAGAAAGGTTGCGTAAGCATCAGGGCATTGTTGGGTCTTACCAGTCGCCGCAAGACGCCTAG
CAGGCGCCGTTGAGGCTGCCGCTGGAGGTACCACCTTCTCATTTCCTGTCGCCGGCCTGAGAACTGGCCGGAGCGGTTCT
GGGGATGGATGTCGGGCAGCAGACTTCTTAGCAATGGCCTTTGGATCGAACTTGCCAGTGTATGCAGCCGCAGCCGCAGC
CGTAATCTCAGGCTTCGCCTCCGGTGTAGCTGATGGGGCAATGACAGGCGAGGCGCTACCGAAAGGCTTCTCTTCCGTCG
TGGGCGTCTTGTTGCCTGCCCCGTCCGTCTCCATGCGGAGCTTCTGCTCGTGCCTCTTCTTCCAAGCCTCCAGCTTTGCA
AGGCGCTCAGCCTTCTTGTCCGCCTCCAATTTCTCAGGAGCAGCGGGTGTCGATCTGGAGCCCGAGCCTGCCGCAACCGC
GCCAACCGCACCCACGCCTGTTCCCGCTTCACTACGGGACGGCGGGTCCCCTGCCCGTTCGCGGCGGCCTTGCAGTCTGT
CAGCGGACCCGTCGCGTCTGCCACTAGCGCCATTCTCTCTGTGTCCTCGGTCATCCCGGCTGCGGTTTCGACGCCGGTTC
AGCGACCGTGAGCGAGAGCGTCGTCGCCACCCGTCGTAGTTGCGGTCGCGATCGCGATCACGGTCTCGATCTCGGTCTCG
GTCTCGGTCACGATCACGGTCTCGGTCTCGATCTCTGTCCCAATCGCGTTCTAGGTCGCCGCGGTCCCTATCACGGACCC
TATTCCGGTCTCGGCCCCGGTCTCTATCTCGGTAACGGCGCTGTCCACCGCGTCTGTCAGACGAGTCCACTTCATCACGA
TACCCTTGACTGTTGCTTCCTCTCACATCGGCTGGGCTGCGTGACCGCCGCCGGCTATCGCGCGCGTTGCCGCGTGCATC
GTCATTCCGGCCTCGATCACGCCTGTCGTCATCTTTGCGGGCACGCTTGGCGTCATGTGGACCTGCAGGAGATGGTGAGC
GCGAGTTCCTGGGGCGAGCCATGGTTCTTTAAGCCTCTTCTGTCTCTCTTTTTCTCTCTTTTGCTCGTGCGGCGCAGCAG
GTTAGTTGTGGTGACGGGTGAGAACTACTTTTTCATTCCTGACGCCAAGAGGGCACGCCGGCAAGTTGCATGGATGAAAG
AATGATGCAGCCTGGAACCTTGTTGCCGCAAGACTGGACGGAAAAGTCCCGGCGAAACTCAAAAATGTTCCATCACATCG
CAAGCGGGAGGCCAGTCGATCACGTGATAATACCACGGAAATATCACGTGATGTGTGCCGGATCGCGCTTGGTGGGGCAA
TTTCCTAGGAATTCTACGCTGATCGTACCGGTACATGCCTTCATGAAAGGATGTGCAAGCATTTCAGGTACTGCATACAT
CTAGTAGTACTTTTGCTGTTCGCGTCGATGCAAGTGCCCATGTAAAACAGGAGGGGCTGGTAGCTATCAATCCACTGACG
AGCAAAATTCGGGAGACTCCATCCAAACAAACCCACACGCGATCGAGCGGTATGAAAATCCGTCGTCTGGCCCGTCCCAA
TTTGCTTCAAACTGCTTATCCACTGACACACGAGCATCTCAGCCCACAAAGGCAACGCAGCCCCAAAGAGCAATTAAAAG
CTACGCAAAAACACCGTCACCAGCAACAAAATGTGGTCAGCCGTCCGCACGACCATAGGCCGAGGCCTGTTCAGCCCTGC
GGTGGAGAGCAAGGTCTTCACCCCCGCAGCTCGTCGCATTGCTACCGCATCCGCAGCCCGCGCCCCTCCACGGCCAAGAG
GGACTCTCTGCGTGCCTCTGATCCAGTGCACAGAGAGCACTCAGACCCGTGGCTTCGCTGGCACGGCCACGGCGGCCGTG
ACTAAGGATACGGCAGCAACGACAAAGGCAAAGAAGGCGCCGGCAAAGAAACCGGCAGCAAAGACAAAGGTAGCGGCAAA
AAAGCCGGCTGCGAAGAAGCCAGCAAAGAAAACGACGGCAGCCAAGAAGAAGGTGGCAGCCAAGAAGCCGGCTGAAAAGA
AGCCCCGCAAGGTAAAGACGGATGAAGAGAAGAAGCAGTTGAAGGTGCGGGAGCTCAAGAAGCTGGCGCTGCTCGATGAG
CCCACCAGACTGCCGGAACGGTCCTGGGTCATGTACGTGTCGGAGAGGATCAAGGGTCAGAAGTTGAATGGCGACAAACA
CTCCATGGTCTCGACCATGCCGAGTCTCAGCAAGGACTACAAGGATCTGTCGGAAATCGAGCTTCAGGTGAGCGCTGCTT
CTCTTTTCGGTCCCTCCTCCTCGTAGCCACGTTCTGACCTCTTCCTGTAGCGGCTCCGTGATAGCGCCACCAAAAACATC
GAGACCAATGCCGTGGCCTACAAGGCTTGGGTCGAGAGCCATTCGCCAAAGGAAGTGGCCGAGGCCAATCGCGCGCGCGC
GCAGCTCAAACGGCTCGTTGGCCTGACTCGGCGCAGCATCCAGGATTCCCTCCAGCCAAAAGAGAATGCTGTCGGCATAT
GCTCTTTTCACCAAGTCGTGCTGGCAAAGGGGCAAGTTCCACGGCGGGCCCCTCGCTGATTGCGGCCAAGGCTATCGCGG
CCGAGTGGAAGGCCCTGCCCGAGTCGGAGCGCCAGGTACGTTGTTCCAACCCGTGCAGCTCCTGCAACGCGTATAACTGA
CCCATGAACCTCACAGCCGTTCGAAGAAGAAGCCAAGACCGACTTTGAGCGTTACGAGAAGGAGGTCAAGTCCGTCCTAG
ACCGGGTTGTCCTCAAGAGCTCTCCTCCGTCCTCGCCTTAACGGAAGACTTGTTTCTGGTAGCCACCGTCTCGTCCAGCC
GCGAAACGGCCATGCTAAATATGGCCCGCTAAGATTCTCGGCAGCATCTTAGCCTTCCGCCTCCGTATTCTTATATTTGC
CTCCACTGTTTCGCGTCTTTTATAATTTGCTTGCTGGCCTTGCTCGCGGCTTGCCGACGGTCTGCCGCGAGATGCCATCA
GCCCGACGTTGTGCGGTCGTTGTATGATAGTGGAGGAAAGGTGCTTTACTGTTTCGTGCTCGCTTTGAAGGTGCTTTGTC
TTTCTCTGCATCCCGCTCGGTTCGATATCGTTAGGCCAACAGTACACTTAAGATAAAAAATCCCCAATTCTGCTAGATCC
CAGAAGCTGTGCGGCGCCGTTTCTTCGGGCTCACCACAATGACCGGCGTGCCTAATGCGTCCAGCCAGGCAACCTCCATG
TCCTGAACTTGCTTGCTCGCCGCATACAGAAGGAGATATGTGTGGCCAGCAACGGCAGCAAAGCAGTGCAGGCGCAGCCA
CGCGTGCGGCTCCTCGTCGCGCGAGCACCACACACCCCATCCAGCGCTTCCTTGTCCGACATACTTTGCCAGAAATTCCC
ATGTCTCGTGCCGACTTTTTGCCGTCCAGGACGAGGTGTTGACCTTCCAGAAGCCGCGCTCAAAGGGTCGAAGGACGCGG
ACAGCCGGCTCCGACGGCCGGTAGCGACGGGCCAAGTCCAGGTCGTGGGCAAGCTTAGCCAACTCGTCGGTAACAAGCGC
CGCCACATCCAGGTGGGCGCAAGATAACGCCGGCTCGGGCGGCAGAATACGCAGGCTTGTATGGTATGATTCTCTGACGG
GTTGCGAGGATGACATCAAGAGCACAGACTGCATGCTTTTCCGGGCAGACGTGTCTTTGGCAGCACTCGCAGCAGTTTCG
TCCGCGTCACTTCTGTGTGCTCTGCCATACACTATCGGGGAAGAGGTCGCCGGTATCCGCTCCAATCTGGGTCTTTTGGG
CCATGAGCGAGCGTCAGTAGAACTACGAGAGACGATTGGAGGCGAGCTTCCCATCTTTTCGGGTTTTCGATATCGTTTTA
TTCCTGGAGGGGCCGATGTTCCTCGAAACAGCCCCGGTATCGCAGTTCTTGTCATGGGTGCTGCCGTTCCTTGAACCATT
TTGGCCACACTCATCTGGCAGCGACGAGGGTATATTTTCCGTCAGTGAGGAGGTCAGCTCAAGCGCACTGCTAAAGTCGA
CAATAGCAGACGAGGGATTGTCTTCCCATCCTGAGGACTGTGTCTCATTCTGAGGTTCGAAAGCATAGTGTGTCCCGGGG
GCTCCTCGCCTCGCATTTGCAACGCGTTTTGCAAAGGTCAGCTGGTGCGTGAACGACCGAGACAGGCTTGATTTTCGTTT
GTTTGGTGCCTTTCGTATCAAGCTAAGATCTGGACTATGCTCTTCTGTAGGCGATGTGTCTTTCCCATGTATGCTGCCAT
CTTGCGAGTCAGATATGAAGGTGTCGTGCAGGCTGCCGAAAGAGTTGTTTAGACTAATCCTTGAAGCGGGTGTCTTCTTC
AACGCATCCGGCTGGGAGTCTGGTATGACAACATTCGGCGAGACATAGGACGTCCGAGGCCGAAACTGGTCTCGCAGGCC
AGGTGTATCTCCTAGGCTTACAGCCTGCACCGGAGCTGGAGAGCTGACATTTTACCATACACTCCGGAACGATAGGGTGA
GATGATCAAACGACGGTGCAGCTGCAGGCTCGTCATCTGTCTGTTGCCACCTACCGTTGATACGCTTATGCTGTGGAGCA
ACGATGTTATCAAGACGTCTGGCGGCGCCAAAGTCCAGATACGCCTGGGCTAAGCAGTGATATCTCACATCGTCGGATGC
CTTGCTGGGTGCCGAGATGTGCACCAAGACCTCGGTCTCTGGCCAGGTCATAGAACGGGAAATCAAAGAGCCGTATGGTC
TGATACTCGCGTGAAGTAAATATATTATAGGTTTAAAAAACAAAGCACTTTCGAATAAATATTGTGTTAGAGCAACTAGT
TCAAGATAGCGTATCCAAAAGGAATCAACGAAACTCCAGAAAGATGATTAGCCGTAAAGGGAACTCCTTGATTAGTTGCT
CGTATGCAGAAGTACAGGCAACTGCAACAGTGAGGCGGTAGCTCTCCTATCACGGCTTTAGTGGTCGAAGTGCGCCAACC
AGCAACACTCTCACCGCCTTTTGCTAGGGAAGCTATTCTGCCGTTCTAATCACCAGCAGCTTGCAGCACCAAATAGGGGC
ATCAGAACGGGAAGACGTACGACAAAAAGGTCCACAGCAGACACCGACATTCACTCACTTCCGACCCCTCAATACGCAGA
AATGGCATCCGGACCGAAGCTTGGCAGCGTGCTCGTGATTGGTGGGTGCGGATTTCTCGGCCACCATGTGGTGAATTTGC
TGCTGCAGGACTACGTGCCGTCCAAGTCGGTGACAGCGATCTCGGTGGTGGACCTGCGCTGTGACCGCAACCGGCGCCCG
GACGCGGACGGGGTGCGGTACTTTGAGGCAGACATTACGAACTCGGAGCGACTGGTGGAGATCTTTGAGGAGGTGCGACC
GGATGTGGTTGTGCACACGGCCAGCCCAGCACCACAGGCGTCGTCCAATGTGTCGGACGCGCTGTTCTACAAGGTCAACG
TGGAGGGCACGCGCGGGGTGATTGATGCAAGCAAGAAGGCGGGCGTGCGGTGCCTGGTGTACACGAGCTCGGCGAGCGTG
GTGTCGGACAACAAGTCGGACCTGATCAATGCAGACGAGCGCTGGCCGGTGATCCGGGGCAAAGATCAGACCGAGTACTA
CTCAGAGACCAAGGCGGCAGCAGAAGAGCTCGTGCTGGCAGCCAACGACCGGACGACGGCGGGCGGACTGCTGACGTGCG
CCATCCGGCCGTCGGGCATCATGGGCGAGGGCGACACGATGCTGCTCTACCACATGGTAGGCGTGTACCGCCAGCGGCGC
CACAATGTACAGATCGGCGACAACAACAACCTGTTTGACTTTACGTACGTGCTCAACATTGCACACGCGCACCTGCTGGC
GGCCCAGGCGCTGCGAGCGACGGTGACGGCGGCGACGGCGCCGTTGGACCACGAGCGTGTCGACGGCGAAGCCTTCTTTC
AATCCCCAACGACAGTCCCATGTACTTTTGGGATTTTTGGCCACACTGTGTGGAAGTACGCGGGCAACCAGGACAGCCTC
GACAAGGTGTGGGTGCTGTCGCGCGGCACCGGGCTGGTGCTCGGCCTGGCTAGCGAGATTGTCTTCTCCATCCTGCGCAA
GCCGCCGACCTTCAACCGGCAGCGCATTGTGTACACGTGCATGACGCGTTACTACGACATTAGCAAGGCCAAGCGGCTGC
TCGGCTACAAGCCGATCGTCTCGCTGGAGGAGGGCATCAAGCGCGGTGTGGCCTGGTTCATGGCCCAGGACGCGGCCAAG
GCAGTGAAGGCCTAGGAGCAGAAAGCATAAAAGGCGGTTGAGAGGCGAGAGGAGACGGTCGGATCTTAATACTAAACATT
CGTTGTATTACCACAATCAAGTATAGAATCAGCGCATAATGGGACAGCGTGTTCTGCAGCCGGTCTAAGGGCGTGGCGTT
GCTTACGCAAGCGGCTAAAATCTGACACAAACGGCTCCCGAAAGGGAAGGCAGCACTGTGATAGACGTGTGATCGCAGTG
TCTGCAAACTGGCGATGAGTTTACGAGCCATTCTCAGCGGGTCGCGCGTGAAGAAGAAGAAGAAGAGCAGCAGCGGAGCA
GCAGCAGTAGCAGCAAAGAGGAGTGGCAGTGTCCAGCACGGCGCATTGTCGCGACCGGCAGCGCCATGGCCGACAGGATT
GCGACAGACGAAACCAGGCAGCGGCCGAGACGTGGCGAAGCGATTACGCTCGGGATTGTATGAGGACGAGGACGAATACG
AGAGTACAGCAGGGGGCCGGGTTATTTGTTCAACGACGACGAGCTCGATCGGCAGCTGGACGACAGTGGGCTTGTTGCGT
CGCTGGCGGACGACCTATCGCTGCGCGACGTTGTACAGGCCCTGCGATATGCGCGGGCCAACATGTTTGATCCGATTCCT
GGGCACCAAGAGGGCGGCGGCAACGGCTTTGTGGGAAACAGTACCCGCGTGGCCGAGCTGCTCAATACAAGGCGGCGGCT
ACCGGCACTGGCAACGACGGCGCACGTGGCGGCACTGCTGCCGAATGCAACAGCGACGGAGCGGGAAACGGTATCCCTGA
TGCGAGCGGGTATATTGCGCAAGGTTGTGCAGCCGCAGTGGCGGCGAGCCGGCGAGCCGTTGGGCGAAGTCCTCGTGGAG
ACAGCCACGCTGGAGCAGCTCGTGAGAGATGGACCGGCGTCGAGTGAGGGTGATGGTCTGAGCGACGACACACAGGCAGC
CTTTGTTGCCTGGTTGCGTGGTGAAGGGGGCGAAGAGCATGGAGGACGAGACCACAGCAGCCCCAGAGCGATCACGATCC
ACGGTCAGACGGCACCACGGCTAGACGGTCGCATGGCCGACGAGCTGGTGCGTGCCGGCTTCCTGGTCGGTCACGGAGCA
AGACGAGTGGTGGATCATCGCAGTGGTGGCAGCGGCCAGAGCAACAACAGCAGCGAGAGGAGTGGCCACGGCGACGTGTT
TGCGCGGCCCGAAGACCGTACGTCGCTGCTTAGCCTCGAAACCGTGGCGAAGGCCGCGTCTGGCTCCTTTGGCGCCGTCG
GTGGCATCGGTGCCGTCTATACGGCCGGCGGTGGTGGTGCACGTTCGGCTCTGCCGTTGCAGACCGGGTGTCAACAGAAT
GCTGCTGCATCTACGGAAGATCTCCTGCTGGCCGTCCCCGGCCACGGCGCCTTTGTCAAGCTCGTGTCGGCGGCGCTGGC
CCATCTCGTCAGCCTGCTGGCCCGCACACCATTCCGTGAGGCACCCGAAACGATGCTGCAGGAACGATGGAACGCTGCCG
GCAGCAACTCTGGCGGTCATGGAAGCTACCGGCGAGTGACGCTGAGCCGCACCAGAAAATGGAAGGACCTGTATGGTCTG
AGCTTTAACTGGGTGCTGGCAGAGGCCGTGGGCGCCGGCCTGGTCGAGGTGTTCGAGACCGGCAGTGTAGGGCGCGGAAT
ACGGCTGCCGGCATAGACAGGTAGGAACGAGATTGACTTTGTGGCTGTGGGAAATCCGGTGACATACCTTTACGAGATGA
GCAGCCTGTGGTGTTGGACACGGGAGTAGCAATGCTCACGCCATGGTCCTTACGACGTGCTCTGGCGATCAGGATTTGCA
CGCGGGAACACAGACTGAAGTTGGATCGGCCTGCGAACCTCGCAGCATCGACAATTTCTCCAATCACGGATGTACAAGGC
ACAGGACGGGCTGGTGCTCATTACAGAATACACCACGGGAGAGCAGATACAGCAGCTTCACCGTCCTCTGGCAAAGAAGG
GATGTCTAAGACAGTTTCCTCCATCTAACGTCGCGACATGCTGTTCAGACATCTCACTACGTCGTACTGCCCGAGAACGA
AATGAACACGGACGGGGTGCTAATCTCCAGGATGCAAAAGGACGAAGCAAGGCATACAACGGATCGTCGATTCTGTGTAC
TCCGTACATACATAGTAAGAAACCATATGCATAGCATCTCCACGCTACTTGTGAGACAACATGCAGCAGATGAACACAAT
GCAGCGCTCGGTGATGCACGGCAAATGACTAACATGCAAACACATGCAAGGCCGTCATTCTTGTCAGGTCCAGCCGTGTC
TACGACGTACATGCCGGCGGCATTGTTCTTAATCGAGACTGCCGTCGCATTGTTGAACGCGATCTAACGCAAAGGTCCTC
GCCAATCTTAGCCTGTCTTGTCCGTCTTGTTGCTACATAGTATTATACGCCATCTGGTCACCGAGGCTGCTGCATAGTAT
TTCGACTCGCAATGAGTACGTGCCGAATGGCTGCCACGTCAGGCTGCCAAACAACAGCCGATTTCACATCATGCCAGCAT
ATCCAGTCGCGTCCAGCCCGAAAGAGCACACTGCTGCACTGGCCCACTTTGAAGGACACGGAAGCTTCTTCAGCATGTAC
GGAGTACGAGTACGAGCAGATGTGACAGGGCCAGCCGAGTGCTATCACACCTCCCTACTATGTATATTAGCAACGTGGGT
AGCCGCCTGTGGGCGAACAGACCGCGCAAATGCAAGTGCTGCCGGCCTGCGTAGGCGAGGAGGACCCGGGAGCGCCAGAA
AGGCGTGCGAGCATGTGCATGAGGCCCGGATGCGACGTACTCGGACTCGTCAGTTGCATCCCGACAGACGCTTTGGGGTT
TTCGCGAGATAACGCTCATGCAGGTACGGACAGCCACATGTGCTCGTATCCACGAGCCCAGATACTACGCCGTACACAGT
AAGATACTTTGCATGTACGGAGTACTCAACGACGCGTCCAAGTACGACTACTCGAGCAGCCAGTGGATAAATGTCCCGGC
CCCTGGTCCCAATCCCCTGTCCAACGCATGCACGGACCTTGGCTTGGTCACGGAGGAAGGCCAAATGGACAGATGGATTG
GACGGCGTGGTTGACTAGGGAAATGGACTACGACGTACGGAGTATTAGTAGGAAAGCAGAAAGAGAGTGTGGTTACCTCA
CCTCGTAGCCAATTTGCAATTTCCCTCTCGGCAGCATCGTTTCTTTCCCCTTTCAGAACCGGTAATACACTATCGTCTCC
AATCCAAAACGGCATTGTAGCCATAGCTTAAGCGCTGCTTGCTACTTTAGTAAGATACGAGTCAGATTTATTATTCTCCC
CTGTCACCTTTCCGGTTTTGGGCGTCCCCCCTTTTTCTGTCGCATGGGTCCCGGGTCTTTTTTATTTTTGCCTGGAAAAC
AGGCCTGGCGAGCAGGCCACAGGATGCTCAGATGCTCTCGACAGCAGGGCTGGCCATATCTTGTACTCAAACGCGTACGG
ATTCGTATTGTGCTCTCCGTACCCGTGCTTGGAGCGCTGAGGGCAACGGGCGGCCAGAGGAGCTCATGAGCATCTCGCGC
AAGCATGACGCTCTTTGGCCGGAGCAGTCTATCCGCACTGACCGAACCGGTAAGGCCAGAGCTGCAGACCAAGGAAGCCT
TCTTGTGTCCTCGCGTCGCGGCGTGCATGGGAACCGAGTAGCGCACGCACTATGCCGTACACGTATTTACCAGACTGCGA
GTATTTGTGTCTAATGCAACGACGTCTGACCATTAATCACTCGCGCCTCTTTTCGCGGCCCCTCTTCTTTTGCTTTTTCT
GCTATGCTTTCGTGGTGGTCCTCCTGAAGGATTGTGGTGTGCCCGGCCTGTGGGGAAACCTTGAGCAGGCACTAGTCCCC
TACCGTTATAGCGGGGTTCCAGCCCAGCACTCGCCACTCGAGACACTGCCGGCCAAGGATGGCCTTGAGGCTCGTGAAAG
CTGCCGTCGTTGCGCGTGGTAAGCTTGACGACTGCCCCTATTGCCACTGACACCCTCCAACAGCCTCTCACCCCTGCTCA
TGGCTGCGCTTCCGGGGATCCTTGCTTATGCTAAAAGCAAAGGGGAAAAGGCAGACAGGGGACAAGCTGGCTACGGAGTA
CGGAGTAGATGAGGACTGCCGTGGATCCGTCAAATTGCACCGACAATAGGAGACACGAATGACAGCCGGGAAGCCACAGC
GACCTTTCCCCCCCCTACGAGTAATTCCTCCCACTCCTGTTACAAGTATCTTACCAGCCTGCGCCGGCCGTTTCTGCGGC
TGACCAGCCACAACCCACTTCCATGTACGATACCAGTCCACAGCCAATGACCGTCCTCTCTTCCTCCCCCCTTCCTCATT
CTGCATCATATCTCTCTTGTCCTAAATCTACAGACGGGGGTATGTTTGTATTTGCCGTCACAGACAAGAGTACTCCGTAG
ATGTACGGGCACTCGTATCTTACGAGTATTTTGTCTAGCGCGTTGCCGCAGAAAGTACCTAGCGCGCTTTCCTCGAACAC
ACCCAAACTTGCGCTAGTGCGGGCAGCGCCTTCCCGCTCCCTGAGCCCAACGGCCAGTTACTCGTAACTTCCTTGCACCT
CGCCCGTTCTCGATAGGCTTAGCTGGTGACTGTTGACTATCTCTGGTATCTCCCTTTCTCCCTTTCCCCGTTACCTTCCT
TTTCGTCTTCGATCCTCTCTCCTTCATGTTGTGAAGCCGCATGCGCCCATCTCTGATTCCCGTCCAACACACTACCTGTC
TTTCAGCCAAACCGTGTGCAAGACGCGGCCCGGCTTGGCTATCAGCTCCTTGCATCGCCCGTGTGGGTTGTGGTTTCCAT
TCTTCGTGGGGACTGGTAGAGACACCACTTTTGCCTACGGGCTTTTATTTTATTTTATCTTTCTTCCATCTCCAATTTAC
ATAGTACTTCTCTCGCTCTTTGCACTACGACTGCACTCTTTCCTTTCGCTCCGCGCTCCTTTGTCCCTTTCAAGCCTTCC
TGCAGCGTCTCGACGACACCCGCTCGCTTCTTCACTTTCATTTGCGCTGTCTTTGCTCTTCATATTTGCTGTCCGTCATC
TGAGACAGCCCCCAGATCGGCCTTCTTGCCTCCTGTCTCGCCTTCTCCACCGTCGCCCTCACAGCCTCCTTCTGTTTGTT
GTCACTGGCTGTTGAGGACTCGCTCCCCGAAAGACCTGCTCTCATGGTTCCACCTTCCCTAGCGACTCACCAAACCAACT
CTGACCATAGCTAGAAGAGCCCGCCCTCTTGCCACTCGAAAGCCCCCCGCCTGGTAGATCGATACCTTTCGTTGTCCAGC
AAAACAACTCGTACTCGTCGGATGAATCCCCGCAAAGCGCTGAATAACAATACATATCAGACTGCACCACGCTTGATCTT
CAACCACAATTAATCCAACTGAGCCGGACCTCGCACAGAAACGTCTGCGGCTTGCATGCGTCCGGATATATATGCAAAAC
GAAACCTTAATTGTGGCTCGGTATGACCTCCGCACTCCCGATGTCCTCCCCCCGCCCCAAGAAGGTTTACTTGCATCCCT
CTGGTTAGGGGGTCCGGCGAAAACCTTGTCTTCCCCCCTATCATGCTCTCGGCCTGAGAAAAAAAAAACATGCACCTTGA
CATCGCACTGACCTTTATCCTTTTTCAGCCACCCCGGATAGCAGAGCAGCCCATTATCGCTCTGCATAACGACGTTTTAT
GCGCCCTTGAATGACCGGCAACGCTTGTGCTTGACGCTTTTTTCGATCGTCACCGTCGCACGACAAGCGAAAACGATACC
GCGTCCGAATCCGAGCGGCATTGGCGAATTCATGGCCGGCACCATTTTTAGCAAAATATAAACTATCCATTTTCACAACT
AACAGTCGCTACCGCCCTTTGCCACAGGGCCCCGATTTGCTGTCTACGAAACCAAAGAGGCGTCTAGAACAGCAGACATG
GCCGCGGCCTTGCCAAGGTCTTTCAACGGCCCGCCATCAGCGGCACTTCCTGCACTTCCAGTGGGAAAAACTCGGAAGAG
CATAGGTGCCAATCCCCCTCCTACCCCAAGGACTAGCAGGGCAGCTCCTACCACACCGCGCAGCGGCCTACGTGCGCCGT
CCACGTCCGCTTTACCCGGCAATTTTCCGCAAAGTCTGGTACCAGGCCTACCTCGTTCCTCCTCTGGAGCCAACGCTGCT
GGGAAGACGTTACGGAAGACGGTCAGCATAAACTCTTTTCCTCAACCTCCAAGGTCAGACAACCGTATCACAAGTTTGCC
TCCGAGTCCCTTGTCAGCTGGTGCACCAACAAGCCGAAAACCGAAGACACCAACGACACCGAACTACACTTCGAGTAATT
CAACACCGAGTCTCTTGAACGGAACTGGCGATGGCAGGTCCGTTGCACGCCCTGGCCATCGAAGCTCTGATGGCGTCATC
AGTGTAGCTTCATTACCTCAAAGTCGAAGTTCATCCGCACAAGACTCCTACTCTACCTCGGCAACTCAGTACGACGACAT
TGGAGATAGCTCGGCAGGGCCCAGAAATGGCACTACTGTACCACCTACAGATGAAAGCAGCAACAATCACCAGTCAAAGG
GCGATGGCAAAGGCAACATCATTGTCAGCGTTCGAGTCCGGCCGGACGCCGGCGGCCGTGACAACAAAAGTGACGGCGAG
TGGATGGTAGATGGGCGCAAAGCCCTGGTGGCCTATGGAGGCAAGGAGGGTGGTGATTATTATTACGGTGAGTTTCTCGT
TGCGCACAGCCAGACAAATTCAAGCCAAAGGCTCTGTTGCTGATACATTTGCTTTGCAGACAACGTCTTTTCTACACACG
ACAACAACTCAAAAGTCTACGACCATATCGCAAAGAGGCTAGTTCGCCGTGTCATGGAAGGCTATCATGGTACTGTGTTT
GCCTATGGCATGACCGGCACTGGCAAAACCTTTTCCATGCAAGGTACGGCTTCGTCTCCAGGCGTTATTCCACTGGCCAT
TACCGATATCTTCTCCTACATTCGGGAAACACCGTCTCGCGAATTCTTGCTGCGCGTTAGCTACCTCGAAATCTACAACG
AAAGAATCCACGATCTCCTCAGCATGTCGACAACTGGCGGCATCGGGCCAACAACACAGGATGAAATCAAGCTACGAGAG
GACAGCAAGCGAGGTGTATATGCAAGTCCGCTGAAGGAAGAAATCGTGCAGAGCCCAACACAGCTTCTACGCGTGATTGC
TCGTGGCGACCAGGCTCGTCGAACAGCCAGTACACAGTTTAACTCTCGCAGCTCTCGCAGCCACGCAGTCGTTCAGATCG
TGGTGGAGAGCCGCGAACGCAGCCCGGCTAATGCTACCGGGAGCGACAACAAGCGTGGCGGTCTTCTGCCAGGTGGCGTT
CGTGTGTCGACGTTGAGTCTGATCGATCTTGCCGGCTCTGAGAAGGCGGCCGAGTCCAAAGAGCGGCGCACAGAAGGTTC
CCATATCAATAAAAGCTTGCTCACGCTGGGAACTGTCATTTCAAAACTGTCCGAACACAAAGACAAAGATGGCAAGCAAG
CTGATAAGGACGGGAAGCATCTGCCGTATCGAGACAGCAAGTTGACACGGCTATTGCAGGGTGCATTGTCAGGCAATTCA
CTTGTCAGCATCTTGTGTACCATTCAAATTGGCTCTGCCGGCAGTGCTGCAGCATCGAACAGTCACACTACCGAAACGAT
CAACACGCTGAAATTTGCGTCGCGAGCGAAGAACAATCTCACCAGTCATGCCAAGCGAGCTGAAGAGGCCCTTGGAGCTG
GCGGCGATGGCGGCGCTCGAGTTCTACTGGAGCGATACCGTATGGAAATTCTTGAGTTACGTGCACAACTCGAGAGCCAG
GCAAAAGACAAGGACAGCGACAAGGGTAGCGGTAGCGGTAAAGACGACGAGGACCGAGTGCGAGATGTCGAGGAAGAGCG
CGCTCGTGAGCGAGAGGCAGAGAATCGGCATGAGGAGCAAATTCTCGAGATGCAACTCGCGCGAACGGCACTCAAGGAGC
GCATCGATCACCTGAACAGGCTAATTCTCAGCTCGAAGTCTACCGGCGTGAACACCGGTGGCACTTACAGCGCTTTGGGT
ATACGGTCCTCCATAATATCTGTGCGTTCTATTGCGACAACCAACGCAGGGACTATGGCGAGTGGGAACAGATCGCTTCT
AGAGCGGACTGTGTCGACAACATCCTCATCGTCCACAATTGGCCGAAGAGTCAGTGAGCCTCCAACATCCGGTGGCCGCA
CCGATTCTGCACCGGCAGAAGATGACGACATCGCCGGTGAATTTGGCGATGGTATAGCCTCCCTGTCATCACAAAACCAG
GCACTTCAGGCGGATCTTGCGGATAAGAACCGTTATATTGCGATGTTGGAGAAACGATTACTGCAGGCAAGACGTGCCAG
CTCATCGAGAGCATCTGTTGGCCTGGGCTCGTCGAACAAGGGAATCATGGTCGGAGAAGACCACAGTGTGTCGGCGGTGA
TCCGCGAAAAGGACGCGGAAATTTCAGAGCTTCGTGCCCGCCTGGACGATAAGGACCGCATGCTAGCCGCGTTGCGCAGT
GCGGCAAGAAACCGTGACAATGCCGACCGGGTAGAGTCTCGCATGGATTCGCGGATAGAATCGCGTCTAGATTCAAGACT
GGAACACCGGCTAGACTCACGACTAGATTCACGACACGATTCGCGACTAGATATGCGGGCTGATGTTCGAACGTCGCAAA
TGCTTGAACCGCCTAGCAGCCCACCAGTTATGGCGCTGCCACCCACACCCCAACCTCATGGGTCGATGTCAGACATGAAG
ATGGCGCCACCTTCGAAGAGGATGAGCGCGGCCATGTTCCCGCGAGCCCGGAAGAAGAGTGTCGACGAGGTCAGCCGGAT
GCTAGACGAGATGATCCAGGACCGCGTTGAAAGTGGCCACCTGGTCCGCGGTGTACGCGGCAGCGTCCGTGTACCGGCTG
AAAAGAAGGCCAATGCGCTGGCAGAGTCAGCAATGTCTTTGGAGCCGTTGCGACAGAGCCCGCCATTGGTTCCAGAGGCA
ACACCCATGATTTTGGAGGCGTGAGTCGACAGGAAGCGACTCGGGCTTTCTTCTTTTCTTTTATGCAGCCAGGATCTAAT
GGCGTTTGGGAAGGGCAGTCACCCACCGGCCCTATTATTGTTTATGTTTACTTTTTTTTTTGAAATTTTGGATGATAGCT
ACGCTTCGTTTGTTGTGGCTCTGTTCGCTGTCCTATACCCGGGAGTTTCGTGTGTACGATAAGATACTATCATCGGCTTT
CGCTTCTTGGTAGCCCGCATTTTCTTGTTTATGTTTTCACCTTTTGTTGCCACGATGGCTGGCATCTGTTCTGGCTCGGA
TGTGGCGGAACCAATTGGTAATAGAGCGACGGCAATGGTCCGAAGTGTATATTTAATGAGATGAGGCTGTGCTTGTACCC
TCTGATGCTGTGGAAGGCAAGACGGCAAGATATCCATTTCTCAAGGAAGAGAAGACGGGCTGTGTCTCGCACTGGTGCTT
GATTTGGATGTTTGTTTTGGTATCTTGCCCGCCTATTGTGACAGACAGTTGTGGTCTTCTTTGTTCTGTAAGATACAAGC
AGTTTTCAAAGAGAAAGACACTGATCTTTCCCTCATGGCACACGCTTTTTTTGTGACTACGGTGAATTGTGGCTTTATTT
GAAACGTGGATGCAGAGGGCTGGATTGAGACAGCTTCTGCTACGTCATCATTGACACCAGCTGACTGCAAGCTGAAGCAT
ATTTTGTACGTCGTATGTTGAAGAGGAGCTAACGTCAGACACAAGCTTGGAGCATCCTTGTCAAGAGCTCTGGGCGGTAG
GACAAGACGGGAACACTAAACGGAAGAGCGTTGTGCTAATGACTTGCAAGGGAGGCTTGCGCTAAGGCTCAAAATGTGGA
ACGCCCCACCGTCGTTTTTAACGTGTTTCAGAATGCGACAAGGTCGGCCATTAAGGAGAAAGGATCAACTTCACTTTCCA
AACAGCGCAAACCCAAATCAGGGAAGTGCCCTTGTAAAACAGGATATCATACGCTTTTAGCTGCAAAGCAGAATGACATG
CCGTGAGAAGAGGGCAAGATGGATTGTAAGTAGAGGCCGAAGAAGCTTCTCTTAAAAGGCTGTCTAAGCGGTGGTTCTCG
GAGGGTCCGGCTTGCTTTCCCTTTTTCTTTTTCGTTCTTTTGGCTCGTAGTTCAGACCGCCTTTCTTCTGGACTCCGCTG
AGGCGGTGCTATCTGTAAAGAGAGCGGCTTCGAGGTCGATTGACGAGCGCACGCTGCGCAGTTGGGCAGCAAGGGAAAAA
AAATTCATAGTTTAGCAGGAGATCGCGGATTTGTTAAAATGCCCGTACGGAGTAGTTATGCGAGCTAAACGCGTGAGGCG
AGAAGCAATAACCTCGCACCGACAAAGGCCACATTTGCCGGGGCCGGGGTAAAGACAACCAAAAAAGAAACGGAAACCTA
GGAAGATCGCCACATAATTGCAAATCACGGCAAATGAACGAGGTGTGGGCGCACAGCAGATCATCTCTGCGAGCACTGCC
GTGTGTCCACAGGATGTTCATTTTGTCTCCGTTGCCTTATTTCCTTATTTCTTTTATTAAAGCATCTGTCGACACCCCAT
GGCGCCTTCCTGCTTCGCCGTATTCCAATGTGCAACGTTCCTTCTTGCTTGCCAATTACCTTCATACGACGGCCTTGTTT
CGACTGGCGGGCTGTCTTACGTAGACGCGTATGTGACATAATCGGGACCTGCGCCGTGTTCTGTGTGCAGGCGCACACGA
TATATCCCAAACAGCCTCACCTTCTCGTTGGCTGATTTATGTTTTATATCACTGTCCACTGTGACCCCCGGTGCCCCTCA
GCTGCAGCTGGGTCGCTGTTGTCCGTTTCCCACGCAAAAAGCGGGCACCGTGTTCAGTGGCCTACTCGTAATAATGAGCA
GCTCTCCTCTGGAAGCGAGTGGATGGAACTGTACAACCCTGCAGCCAAGCTTCCCACGATCCTCACTTACTTAGCAGGGG
CCTTCCTTTCCTCCTACCTTTCCGGGAGGCCACTTTCAAGCAAATGGCAAGAAAGCGCCGGAGAACGTTCCCCGCATTTC
TGCCACTTTCCGTTCTTTTTCCTTTTTTTCCTTCTTCCGAGTTTCCTTTTCTTCTTCGGCTTTCACAAAAGTATATCGCT
CCATATACAGCTGGCAGAGGCTTGGCCTTGTTGGCTTCTTTCTCACCACTGCTGCCATTCTCAACAGAATGTACCTATGG
TCGCCTGTCTCTTACTAGGGGCTTTGACAGTCCACCGCAAGCAAAAGGGGGGTTGTCACCTGCTGAGCACATCTTAGTTG
TTTTGGGAACTTATGACGTTCCTCCCGTCCCACTGGAGCACCCATCGCCAGGCAACCCCGGGAACTAACCTTTTTTCTCC
CTGGCACTTGCTTGTCTTAAGAACTCTCGACATCCGCTCTCGGCATATTGTGATGGGCGGAGGCTAAGGAAGGAGCAAAC
GAGATCCCCATCTTCTACCCAGTCGTTCCTTTCCGCTGGCCGATTTCTTTCAGCCCATGCCCGGCTGGTCACGAGCGTTT
CCTTAACCCTACTTTATCATTCCCAATCGTTCTCTACCTGGCGAGTCCAGAGAAAGTCTGGTTTCCCTTAATCCTTGTAC
CTAAACGACATCTCTTCTCTACTTCCTCCATCCCGTCCCGTCTCATCTCGTCTTGTTGCGTTTCGGTTTGTTTCGTCTCA
TCTCATCGATTTTCGTCTTCCGAAGCAGCCACCTCTGTTGGGCTTATGCTCTCTGGCACTTCTCCTTGACAGATCGGTCC
CATCGCCATGCCCCCAACACTCGACCTCGGACGAACGTCACATACCAAAATGTCTACGCCACGCATCAACTTGCGGCGAG
CTACGTCTTATACACATGATAGAGGTCCGCTCTCATCGACTTCGTCACGCTTCAGCTTCAACCATCTCCTCTTCACGTCT
CCTCCACCATCTCCTGGCCTGCCGCAGTTGCTCCCACGGCCTCGCAGATCCGCCACTATTGCTCGACCAAGCAGGCTCGT
CCGCGCACTGTTAATATGCTCTGGCATTGTCTGTTTTCTGTATATAGCCGTATCGTTCTTCTGGCTCGATCCTGGGCCAC
ACATCATCGACACCAGTGCTTTTGCTTGGCCGACCGCCGTCCAGGGCAACAAAAGGAAGTATGAGATGGTCAGCCAGGAC
AGGCTGCCTCACTTTTCCACGCCGGCAATAGTGAACAGACACGGCAATGCCATATGGACCGTGTCTATCCCGCCAAACTC
TCATTTTCCTCTCGCTACTGAAGAATACGTCGATATCTGTGCCAAATGTCGCGAGGTGGCTAGCCGAGTCGACGAGCTGC
GCCGCAAGGGACTCGGCATCGGCAGCTTCGGCAGCTTCGGCGGCTTCAGCAGCATCCCTGGTCTTGGCGGCAGCAGTAAA
ACCGGAAAGCAGAAGTCGTTATCCGCGAAGCATTTTGTTGACGTTCACGAGGCTGAGCTGGCGGGCTATCTGGCCGGCAG
TGTTTCCATTGCCACCCTGATGAACCAGCAAGACGAGGGAAACGATCTCGTTGGCCAGCCAAAGGGGGGGATGCTAGACA
GGCCTGTGTGCGCACGCAGCTTGACGTTTGTGCTCAGCTCCTCGGATGCAGGCCTCGGACAGTCGTTGATGTTTTTGTGG
ATGTCTTTTGCATTGGCTCAGAACGAGGACCGCCCGTTTTTTATCGACGACACCCGCTGGGCCTATGGGGATTACACCAA
CATCTTCCAGCCACCGCCAATTCCAGACTGCCGTCCCCCTCTGCGCCATGAGATGCTGCCATGTCCGCGCCAGGCCCGCC
ACCTTATTGTGACTGCCGAGACAGCAAGCGACGTCTTTGCTATCGAGGACGACGACACACAAAGCGCCGCAAAGACGGCG
CATTTCTTCGATCTCGCCCGCGTCGGCTACGAGGCTCTTTGCAAGCTGAATACCGACGATAGCAAGCATGTCGTCGAGAG
GGTGAAGCAGTTCAAGGACAAGACGGTCAACAAACAGGCAGAGGCTGCAGGGACGGGGGCAGCGAACAGAGGCACCATTG
TCGGCATACATGTTCGACGAGGCGATCGGCACCCGCTGGAATTTCAGTATCGCGAGTCGTATATGCCGCTCAACCTGTAC
GCCGAGCGAGCCCACGAGGTGCTCGAAACACGGAACAACAAGCGCACAGCAGCAGGGCAGCTGGCCCGCAGCCACTCCCT
GATGGTGGTGGCATCAGATGATCCGATGGTGTATGATGCGAGCGAGTTTGCCGGCGCCACACGCGCTCAAGACTTCATCA
AGCTGGCAGGCAAGGCAGCAACAGTGAACCAGGAAAAGAATCGCGATGCCAGCTACATGCACAAGTTCGTGGACGAAACC
TTGGGCTGGGAGGGCGGCTTCTTCTCGGCCATGTTCTGGAGCCTGGGACGTCCGGCCATCTCGGCCAAGAGCAGCTCGTC
AGCGGGAGAGACGGCCGTTCAGGAGCCTCCATCCCCCGAGACGCTCGGAGTGCGCAGCTTGATTGGCCGTGCCTACATGA
TGGACCTGGTCGTGCTCGCCGGGGCTAGCGATACCATTGTGTGTGCTGCCAGCGCCACCGGGTGCAGACTGCTGGCTGTT
ATGATGGGCCGCGATGCAGCCCAGTCGCGGGGCCAGTGGATTAACATAGACGGCAACTATGGCTGGTGGGCTGCGGATTT
TTGAAGCGTGATTTTCTGGGCGTTCTTGTTTTTGGTGTTTTTGCTTTGGTGCATCAACCGCCTTCCTTTCGATTTCTTTT
GTCATCAGCCATCAGCATTGGGGCTATACCCCGGGGCGTGCACCTACGAAACGAGTCATAGCGAGGCAAGGAGCAAATCG
GCAGCATCTACGGCGAACAGGGTTTGGTTAAGGCTCGCATCTCACATCATATCATAATTGTTCAAAAGTCTTTTGGAGAT
AAACACGGAATGTTTGGTCAAAAGTCAGGCTTCAGGCCCCCCCAATAAAATAATTACAAAAGAAAAGGAACAAACGCTCG
GGTGAAACGAATGCAGATGCCACGCCACCTGAGAAAAGGCCAACTGCGATCCCAAGCCTGAGGCAACATATAAACTACTC
CGTACTCGTACGTTACTCTACCACATGCAGCCAAAGGCATTGACGAATGAGGATGCGGCAGTTTCTCCGAAAAGGGGGGT
CGTATTCGCGGAACAGGCCGTCGAGTATGGTCTAAACGGTCGGAAGGCAGAAGTCAATTGAACAAAATACACAAAAAATA
GGACAACAAAAAGATCATACAGAAAAACAGCTGATCCAAGCGGGCCTGCAGCACAATATAGCCTCAGGAGCTTTGCTGAT
CGGACGATAGGCAGACAGAAGGCACTGCGACGACGAAGGCAAGTATCTCTCCATGCTAAAGCCGCCAAGGTGGTACCTGC
ATTTGGCGAATTGTGAATGCGGATACGAATACGAACGGGGCATCTGATTGGCTAGGCATCATTCAACAATTTGCGAGCTT
AGGAAGGGGGGGGTTGACCGCTTTGCGACGGGCATTTTTGGCGTCGTCGGATAAAATATAACTGAACGGTCCTGCCGCTT
CGATTGTGAGCCAATTCCATCTCTCCCCTTCTCAATCCAACGGCCTACACTGACAAGTCTCTAGCCGCGTGGACAGACTC
TTGGCCGCCGCAATCACAGGAACCGGGCCGCGTTTCTTGCGCATAGAGCTTGCTCCGAACTCTCTTGCAACCTGTCTTCC
CTCATCTTCCCTTCTTCGGCCTTCTGGCCTCCTATCTCTACTTGTTAGCAGACGCGTTAGCAGGAAGCTGTCCTCTTCCA
CACGACCCAGATGGGTGTCTTTCAGGATGCGGCGGGGCCGCTGCTCGAGCAGTACTCGCAGCTGGGCATGGCCACGCAGA
TTGGTGTTGGCGTCGTGGCAGCGCTCACCGTGATTGTGTTTCTGAACGTCGTTCAGCAGATTCTGTTCAAGAATCCCCAT
GAGCCACCAATGGTCTTCCACCTGTTCCCAATCATCGGTAGCACGATCACATACGGCATGGATCCTCCGCGCTTCTTCAA
GGAGAACCGGGCCAAGGTATGTGGACGCTCTTTGCATTCTGGCCGCGTTTGAAGCATTGGCTAACGGTTTGCTCTTTGTT
TCCTGCAGCATGGTGATGTGTACACTTTCGTCCTGCTCGGCCGCAAGACCACGGTGTTCGTTGGGCCGACTGGCAACGAT
TTTATTCTCAACGGGAAGATCCGCGATGTGAGCGCTGAGGAGATCTACACCGTGCTCACGACGCCCGTGTTCGGCCGCGA
CGTGGTGTACGACTGCCCCAACTCCAAGCTCATGGAGCAGAAGAAGGTATGCGCTGCCGATGACTGTCTGCTGTCTGTGG
TTGTCTCATTCTGACCCAATCGTGTCGACAGTTCATGAAGTTCGCCCTGACGACTGAGGCATTCCGCTCCTACGTGCCCA
TCATCTGGGAAGAGGTCAAGAGCTACTACAAGCGCACTGCGGACTTCAAGGGGCAGTCGGGCGGGGTCAACATCCCGCCC
AAGATGGCGCAGATCACCATCTTCACGGCATCGCACGCACTGCAAGGCAAAGAGGTCCGCAACCAGTTTGACGAGTCGCT
GGCAGACCTGTATCACGACCTGGACATGGGCTTCAGCCCGATCAACTTCATGCTTCACTGGGCACCGCTGCCTTGGAACA
ACCGGCGCGACCATGCGCAGCGCACGGTGGCCAAGATCTACACGGACACGATCAAGAGTCGGCGGGCAAGGGGCGAGACG
AGCGCGCAAGATATCATGTTCCACCTGATGAACTCCACGTACAAGAACGGCACTCCGGTTCCGGACCACGAAATTGCGCA
CATGATGATCGCGCTGCTGATGGCAGGCCAGCACTCATCGTCGTCGACCAGCTCTTGGATCATGGTTCTGCTAGCATCGC
GGCCCGACGTCATGGAGGACCTGTACAAGGAGCAGGTGCAGGCTCTCGGCGCAGACTTGCCGCCGCTGCAGTACGAGCAT
CTGGCTAAGCTGCCGCTGCACGGCGCCATCGTCAAGGAGACCCTCCGGCTGTACGCCCCCATCCACTCGATCATGCGCAA
GGTCAAGCAGCCGATGGCGGTGCCTGGAACCAAGTATGTCGTGCCTACCAGCCACGTGCTCATGGCGGCGCCTGGTGTCT
CAAGCAAAGCGACCCGGTCTACTTCCCCAACCCGGACCTGTGGGACCCGTACCGGTGGACGAAGGACTCGCCCAATGCGC
CGAATCTTGGCCGCCCCGAGGAGGAGGACGACGAGAAGATCGACTATGGCTACGGTTTGGTCAGCAAGGGCTCCGCGTCG
CCGTATCTGCCATTTGGTGCCGGCCGTCATCGGTGCATTGGCGAGCAGTTTGCCAACGTGCAGCTGCAGACCATCATCGC
CGAGACTGTGCGGATGTTCAAGTTCCGTAATGTCGATGGCAGCAACAGTGTCATTGGCACTGATTATGCCTCGCTCTTTT
CGCGGCCGCTGGAGCCTGCTGTGATCCACTGGGAGCGTCGCGAGCAGGTCGCGCAGTAAGCTGCAGGGAAGGAGCGGCGG
ACAGAGGCCAACGGCTGCGCCTGCTAGAACAGAGAAGACTGCGAGAATTGCGAGACTGCGGCCTGGACTTCAGCCACCAC
TGTAATCACGGCTGCTCCTTCTGTTTATATATGTACTCCGTACAAGCCTTTTAATATTGACATACAAAAAAATGCCATAC
GGAGCAGGTGTGTTTGTGTGAAAAGTGGAGTGCTCATTTGCTCTTTCTGTCGCGGGGAGAGCAGCTGCTAATACCAGCAG
GCGCGGATAGAGGCAAAATGGAAAGCGCAGTGGGCCAATTGGCGAGGCCAAAGCTCCGCCCCGAGTCTCCGTCCTCCAAA
ACCCAAAACAAGGAAAAGGCCGGTTCCCCTCGATGACACAGCCGTTTAAAAGCTTGAAACAAAAGGGGAGCCGCGGTGAC
GGCCAGCAGCAGCTCTGTCCGATCGCATACGACGACGTATGGATTAAAACACGGCCAAACCAGAATACAGAGAACGAGGA
ATACGAAGTACAGGCTCAGCAAGCAACACACAGCGACCAGTCTCAAAAAAATGGAATCGTACACCACCCACTACATTTGC
CGCCATGGCCGACAATCATCTGGGACCATTGCTACGGCTCTGGGGCATCTCGGTCAGCCAGCTGCCGCCCTTGGAGGCCA
GCGCTGATGACATTGCGCCATTCCTGCTGGCGCTGCTGCAGGAGGCCGTGGCTTTTGTCGACACGGTCGACGACAGGATG
CCAACGGCATTGTGGAAGCCAACACACAGCAAGATATTCCGTGGGAAGGAAGCCGGCGGTGCTGGCAAAAAGGACAAAGT
ACAGGTCAACATACTGCGTCGTCGCGTATCTGCGGATAGACTCAAGATGGTGGCAGCCACACGAACAGCGGCCCTGGGCG
GCGTGCTGGCAGCCAACGCGGTCCAAACAATTCTGCCAGGCAAGAACAAGAAGCTAGAGTTCAGCCCATCCTCGGAGACC
TGGTTCTGTCGCCGCTCGCGCCACCCCAATGCTGCTATGGCCGGCACGGCCTCGTGGACCGAGTTTCGCACTTATCTCAA
GGACAACCACGCTGCCTCGGAGGATGACATGACGGACAACATCACGGGTGCACGTGAGGCGCTCGTCTGGCCTGCCGCCG
GCCTCGCCCTGCAGGGCGCCGAGGAGGGCGGCCGCCGCTGGTCTAACTTCCCGCTGGGAGTGTACGAGATCCGGCATAAG
CTGAGCAAACCCTTGCACACCCGCGTCTTTCCCGTGCTGCAGATGACGTGTGCGGCCGTCAGTGGTGGCAGTGGCAGCGA
AGGTGAGGACCAGATCCAGAACGGCAACGACGAACTACTGGTCCCCGAGTTTCTCGTCGTCAGCGTTACCGTGAACAACT
TTGCCACGGCGCCCATGCCTGGAGAGGATGCCACCGATGTTGCTTTGCGGCTGAGCAGCCAGCCGGGCGTTGTCTTGGGC
TTCTATGCAAGCGTCGAGCGCGTCCGGCTGCTTCCCACAGGCGCGGGTGATAACCGCGGCACCGGACTCGTCGAATGGGT
CATGGCCACGACGTCTAATGCCCGTGGCGCACTGCCGTCCATGGTCCAAGAATTAGCTATCCCGGGAGAGATCTCAAAGG
ACGTCCCGCTGTTCTTCCGGTGGTTGCAGAACCGCCCACGTTTGGACGATCCTCTGGAACCGGCCGCGGCTGCTACCGAG
AATCTGCCTCAAGCAGCAGAGCCAGCTGCCTTCCCTTTCCCACTCATGGATGCAGATCTAGCAGCAGCAGAACCTATATT
AACGCCTACAGCAGCACCTACAATAGCACCTACAGCAACACCGCCGCCACTCATAGCTCCGGCGGATACGCACCCATAGG
AAGTCGCTCCCGGCGAGGTGGCCGTGTCTAGCGAGGCGCCTGTGGCTGGCTCCAACGAGGTGGCCTTGTTTCTTGGCCAG
GGCACCGTAGCACAAACAGCTGCGGATGTCAATCAGGCCATCGATGAGGCCGTGAACACAGCCATGGATACGCCTGGTTT
CACGTGACGGATGGCCTGCGTTCTGTAGTGCCTATTCCTATTATATTGTTCTCTTTCTTTGCGCGCATTATCATTATGAT
ATCCCCTTATCGTTTTCTGTGCATAACACAGCCCATAGCTTTATGTGGTTGCAGCCCAGATTTGACTTTACTGTTTTTTT
TTGTCTATTGTTATCCATCAAAACAAGAGTTGCTACTTCTCCTCGGGCCAAAATAAGCTGTCTAGGTTTATATGGTCAAT
ATACACAGCTGCCAGGCCAGGCCTTTTGAACTCGTAATTAATAGTTATGCTACATGCAGCAGCAGCAGCAGCAACAACAA
CACCACGCGGCAGCAGAGGACAGGTTCAGCCCCCGACGAAGCAAGTACTCGCCGTCGTCGCGCACCTGCCTGCCCGACTC
TGCCCTAGCTGTAAGATACGCAGTTCCCGGCGGATGCAAGCGCCACCCATCTCCTTCATCCTGTTTTTTTTTTCTGCCGG
TCTGTCGTCTAGTAAACACGCTTGAACGGAGGCACGGGCTTGCACTCGTTCTCGTCCAGCGTGGTGCTGATTACAGCACG
GTACTTGAGGTCTACCGGGCCGTGTGGCTTCTTCTGGAAGCTCAGCGTGTGCTTCATCCAGTTCTTGTCGTCACGGTCGG
GGTAGTCTTCGCGGGCGTGTGCGCCACGTGACTCCTTGCGGTTAGAGGCAGACACAGCCGTTTGCACGCTAATTTGTTAG
TAAGCAGAAGCGAAGCAAAAGTAGGAATGATGACTTACGCGCAGGTCAACAGGTTCCGAAGCTCCAGGGTCTCGACAAGA
TCCGAGTTCCAGATCATGCTGCGGTCCTTGATGCCCACATCTTTAAAGGTCTGGTCGACCTTGCTGATGTTGACGACGCC
CTCGTCCAGGGAATCCTGCTGGCGGAACACGCTGACATCCTTCTGCATAGTCTTCTGCATCGCCAGACGGATTTCGGCCG
TCGACTTGGGGCCGTCGGCGTTGCGGAGTTCGTCCAGGACCTCGATGGCGTCGGCACCGGCGTCGGCACGCAGCGGCTTG
AGCTTCTGGCCCGGCGTCGACTGGTCGCGGATGGTGTGCGACACGGCACGGCCAAAGACGACGAGATCCAGCAACGAGTT
GGCGCCCAGACGGTTGGCGCCGTGCACCGACACGCAGGCAGCCTCGCCACAGGCAAACAGGCCCTGAACAGGCTTGTCCT
TGCCGGCCTCATCGACGGTCAGCACCTGGCCGGTGTAGTTGGTCGGAATGCCGCCCATGTTGTAGTGCACAGTCGGCAGG
ATGGGGATCGGCTGCTTGCGCACGTCGACGCCCGAGAAGATGCTGGCCGTCTCGGAGATGCCGGGCAGACGCTCGGCAAG
CACCTCGGCCGGCAGATGGCTCAGCTGCAGGTACATATGATCCTTCTCGGGACCGACACCGCGGCCCTCACGGATCTCGA
CCGTGATCGACCGCGACACGACATCACCACTGGCTAGATCCTTTGGCCTGGGCGCGTAGCGCTCCATGAAACGCTTGCCC
TCGCTGTTCAGCAGGTAGCCGCCCTCGCCACGAGCACCCTCGGTGATCAGGCAGCCGGCGCCGTAGATGCCGGTCGGGTG
AAACTGCACAAATTCCAGATCCTGGTTGGGCAGACCGGCACGCGCCACCATGGCCATGCCGTCACCTGTGCAGGTGTGTG
CCGATGTGCAGCTGAAGTAGGCCCGTCCGTATCCGCCTGTGGCCAGGACGGTGCTGTTGGCCAGGAAGCGGTGCAGCGTG
CCGTCCTCCTGGTTGTAGGCCAGGACGCCGCGGCACTCGCCATCCTCCATGATCAGGTCAATGGCAAAGAACTCGATGAA
GAAGTTGGTGTTGTGGGCTAGCGACTGGCCGTAGAGCGTGTGCAGGAGCGCGTGACCGGTCCGATCAGCGGCAGCACAGC
ACCGATAAGCCTGGCCACCCTTGCCGAAGTTGCGCGACTGACCGCCAAAGGCACGTTGGTAGCTGTCTCGTTAGCCTCGC
TCACGGTCTGTCTGCCGTCCCGTCGGCTTCGCGCCACAAGCTTACATCTTGCCCTCGTCGGTACGCGAGAAGGGGCAGCC
ATAGTTCTCCAGCTCGATGATAGAAGCCGGCGCCTCGCGCGTCATGTAGTGGATGGCGTCCTGGTCGCCCAGCCAGTCGG
AACCCTTGACGGTGTCGTACATGTGCCAGCGCCAGTCGTCCTCGTGCATGTTGCCGAGTGCCGCGTTGATGCCGCCCTGG
GCTGCCACTGTGTGGCTTCGCGTGGGAAAGAGCTTGGATATGCAGGCCGTGTTGAAACCGGCCTCGGCCAGACCGAAGGC
AGCACGCAGGCCCGAACCACCGGCACCGACAACGAGAGCGTCGTACTCATGGTCCTGTCTTGGTCAGCAGGGCAAAGAGC
TGCGGAAATGGAGAGGCTGCCACGTACAATGACCGGGTACTTGTTGCTCAGGAAGGGCGATGCCTCCTTGGCCCGGAGGT
GTCCATTTGAGATGATGCGAGCTGTAGACAGTGTAAGTGTTAGCGGTCGAGTGCTCTGACGTTCAGTCCCTCCTCTACCC
AGACAAAAGGCTTACCGGCTGGCCGCGTGCTAGAAAAGTTTCTTGTGGACTGAAACGAGACAAGAGCCAGCAGTCAGCAT
GTCTGTATGTTGAGGCAACGCGAGAAAAACAACAAGGATCCGTCACGCACCGCTGGCCGGGCGACTGACGCCAACCGCTT
CCAAACTCGAGCAGACGACATCTCGTCTAGAGCTTCTGGTCACGCTGCTCGTGTGTCTTGCTGTGATGCGACTCTCGGCG
ATTTTGGGGAGAGGGGGATGCTCCTCGACAATCGGCGGCTCCGCACTACCAGCTGACGGATGTTGCGTGCGAGGGAAGAG
AGGGTGGCGGTGGTAGGAGGGAGAAGAAGAAGAATTAGAGAGGGGAGTGGAGAGAGGCAATTGGGAAAAGATGATGCGTG
GGAAGGAGGAGGATGGGAAAACCGCAGGACCAGTAGAAGAGGAGCCAATGACGAAAAAAAGAGGAAACCGCACAATTCCG
AACCGCTCTCCCCGGAACCCCCAAACGCCCCAAAGCCCAGTGCTAGCCGGTCGGCCTGCGAGCCTGTAGCCGGCCAATCT
GCTTCTGCCAATTTCACATTATTACTCCCCGCGACTGCTAGCGCCTCTCTCGCCCACTGTGAGCTTCGTTCTTAGCCGAG
GACCTGCCGAGCGATGTTGGTCCGTGCGTCGACGTGCTGTGTCAGCAAACTTCACCACGCAAAGGAAAGCTAGAACAGAG
AGCAGAAGCGGCAGGATCCTACTACAAAGTCAAAGTATATACAAGAGTCTTGGCCTCGACGGTAATCGGACTTTCATTGT
GTCTTCCCACGATTACACCATCCCACCGGCTGCTGCTTCTAGCCGGCCGTCGATAGCAAAGCTCGGCTGCTCATCCGTCT
TTACGGTGGCATGTGACATGTCCACGGCACTGACTTGCCACCTCGCTCGCAGCATCACTCAACAAATTGCAAAAATAAAT
GGTTATATGGAAACCGAGAAATGCAAAAAGTCTAATTATCCAATGGGAATATGCCGCTGCCGTCACTCGGCCAACACATA
CCGCAGCATCGCCAGGAAGTTCTCGTTGAGCTTGTAAACCTCTGCGATAGCTGGTTTTGCTGGCTCTCCTGCACTTCGTC
GTAATCGGTCTTGTCGCTTCGCCCGCTGTTTCCGTTCAGCATCGATTGGGCCCAGCTCGTCCTCAGCCTCCTGGGCCGCC
TCGTCGTCCGAGTCATTGCTGTTATCGTACGCCATGTCCGCAAGGTCTGCATCGTCCAGGCCGAAATCTCCTGCACTGAA
GCCAATGGGCACTGCAAGCGTCGAGTTGCCTCCTATTCCCAGGCCAAAGCCATCGGTGCTGCCGCCTTCCGCTGCCATCT
TCTGCCGTGTCTTGTCTTGATGCCACTTTTTCCGCGCCTCCTGCCAGGCTATCAGGCTGTTGATCTCGGCAATTGCCTTG
TCCTTATCTAGAACCCCGAGTTCAACTGCACCCTTGAAGAGTGCGTTCACGTCGAGCGTGCCGTTCACGGGACCCTTCCG
CAGAAACTCCAGGATACCCTCAATCCACTCCATGAGTTGGGTGAAAAGTCCGTTGTCGTGCGTGTGCACCTCGTGCATGA
ACTTGTAAAAGTTGTGTTCGTGTCGCTGGCAAAGGTCGATAAAGGCTTGCACCGTCTGGTTCGGATCGGCCGACGCTTCC
TGCTCTCGGCAGCTCTCCACCACTTTGATCAGGTCGTCGATAAACGTTGCAAAGTCCGTGATGCTGCTGTACACGTTGGC
CGACTTGTACACGCGGACGAGCGGTTCGTAGAATATCGTGAACAGATCGCGGAATAGAGAGAGTGTCACCGGCTCTTCAA
TCAGACTCAGCATCATCGCCTTATCGCGCTGCCGAGTGAACTGCTTCAAGAGCTGCTTGAGGTACGAGAAGAACTGTGCT
CCCTGCTTGAGTTCCTCATCCACATTCTCTATGGCCGAGGTGAACGCCACATAAGCGTTGTACAGCCGTCCAATCTGTTC
TGGCGCGAGTGATGGCTCAATAAGCTCCGAGCGTAGCACGCCCACGATCAGGTCGACATCATCGGCTTCCGCTTCTCCCC
GGATCTCCATCTTGATCGGCTCGTCGGCATAGACGAATGCCTTCAGCTTATCGACAAGTACGGAGTCGTCGATCTTCGCC
GAGAGGGCGTCGATAGTCTTCTGAAAGTTGCGGATGCCATCGTGGAGCGTTAGAGAGAAGATGCGTTGCATCAGCGATCG
CGCTCCAAAGGGCTGGGCCAGAAAGATGTCCAGGATTCCTACCAGTACGGCGGCCGGGTTGGCGGTGCGTGTGACATTCT
TCATTACCGTATATGGTATCAACGAATGAATGCGCTTCGCCTGTGCAAACAACTCGGGCGAGTTGTCTTCCGCCAGAAAC
AGATGGTAGATGGTTGCCGCCACCTCGATGCGCAACCACTCAGCAAACTTCTGGTACTGTATACTCAAGTCCTGGATGGT
GTTCTTTTCCTTTATCTCTTTGAAGAGCATCGTGAGGCCGTTCCGCTCTACGATATCCTGACGGAACCTGCAACTCGTTA
GGATGTGCAATTGCTCTGAAAGCGGGGAACAGAACATACTGTTCCATGTAGACATCAAGGTCAGCTGCTCGGCGTCGAGC
GATCTCGTAGAACCTCTTTTGCTCTTCGACACGCATCTCGTCCACAGCCTTTCTCCGCGTGATATCGTCAACATCTTCAT
CTCTTGGCGTTATCCGGTCCTTAGTCAGGAAATCCTGAATGGCGTTCGACTGGGCAATCTGCTCGTTGCCGAGGAGCGCT
CGAAGATACGCCCTCAGAGAGATGCGCTGGGTTTCCCGCCAGAGAACGGCAGACTACTCCATGACGTTAGCTGTTGATCA
CCGACGTGCCTTTAACCGTGAAATGTGTCGTCGTCTGTTTCTTTCACTTACGCCTGGCACCGGACTCGTAGGGGTCAGTG
GTGCCCTCGGACTCAACGGCGCATCCATCGAAGGCCGTGGTGATGATCTGAAAGAAGACCCGGATTTCCTTTTATCTAAA
TAATGTCAACTAGAGCACTGGGAAGAAAGGGGGGAATCTTTCTGCCTGCTCAGACTGGCGAAGCGACAAGGTCACGCACC
TCGGATTGACAAATTCTTGAGCGACTCGCCCAAGCTACCTCCTGTGCTTGAAAAAAGGGTCATCTGGGTCGAGACAGACG
AGACGGATGAACCGTCTGAGTCATTGCTGCTGACCATGGAACCGAGGAGGTAAGACGACGTGCTGCTCGACTTGTTCTTT
TTGGGCAATTGCGGAAGCACGCGCCCAGGAAGCTCAGTATGCAACGCTTTCTGCAGGCGAGCAAACTCGCCGTACCGTCG
GCCGATAAAGTATTCAAGCTCGCCCTTTTTTTTTATCCGTAGGATGAATTGCTTGTTACCGTCAGCAGTTGCGCGGGAGA
TGGGACAGGCAAATACTAGCATACAGCATGTTTGTGGTTCCGTATATTGCGTTTGATCGACTGGATGCGCACGCCGGCAA
CGTTGGCGTCCCAGCCATTGATAAAGTTGCCTTCAGGGAGAGAGCCCAAAACACCACTGTCTATAGCGTTACGGTCGACG
ATCTCGAGTTCTGTGAAGCGAATGCGCTCTTCAAAGCCAGACGACGTGCGAATGCCCGAGACCATCATCAGCTCAACGAG
CTTTTGGGCCTTGATGGCCAACTTGCGCCGCTTTTTCTCTTCGAGGCGGTCCTCGGACGACGAGATGTGTTTGCTAGAAA
AGGATTCGAGGAACTGCAAGGTCAGAAGGCCAGGAAGCTACTTCTGAGGGGATCCAGTCTCGCCCGTTTCGAGAAGGGCA
CTCACCACTTGCAGCTTGTCCTGCCAGAACTCCTTCTCGCGGGCCTTGTCGAGGAAGGGAAACTCCCGGACATGGTGGAC
AAAGATATAGCGCAGGATGGGGAGTTCGGAGTCAACAGGGGAGACCTCGCCAACCTCCGACTTGAAGGGAGCACCGAAGC
GGCGCAGAGCCGTAGGCGAATTGAGCTCCGAAATCTCCCATTTAGCTTGCTCTCCAAGAAGTTCACGTTTGAGGTCTATA
TTGTGTTCAGCTATAGATCCGGAGCAGTCGGAGACACAATGGGACAAGGACCCCGAATCCAAACTAACAGTGTTCTTGTT
TGCCAGTCAAGGTCTGTCCAGGAGGCGGAAGCTCGTCTGCGGCCGTGATAGCATTTATGGTGACGTCGTTGAGACCGGGA
GCGGCGGGGTCTGGTAGAGTCGCGGCCATGCTATCGCTGCCAGCAGGGGGTCTGCTCGCGGTACCTGCGCCGCCCAAAGG
TTCTGGGATGCCGCTCATTTCTGTGTTTGCGAAAGGAGACACCAAGAGGTAAGAAGTGCGGACGTAGGAGTTGAGGAATT
AAGTGCGTATCACTAGCAACGGGACTCGTAGCTCACAAATAGTGGAGACCGTGCGAAACAGGTGAGGGGTGGAAATTGGC
GAATAATGTTATCGAGGCGCAAAGTGGCGATGATTTCCTTGAATGCGCAGAACAAGAAATGATGACGAGGAAGAGAATGC
AGGCAGAACAGGTAGAGAAACTTCAGACAGGTTTGCAGGGGTAACTGGGAAGGTGCGAACAGGGGAGCTACAAGAACAAC
AATTGCCTTTTACGCCGTTTGTGTCCCTGAGTCTTGTTGTATCTAAGTATTTTGTTACTGTACGCCCAGTCACCTCGACG
CGATAAGATACGGAGAGACACCAGAAACCGATGGTACATAGGGCAACTACACTTTCACTTTATATCCGCATTTGAGGTCC
ATGGAAGCTAAAAGTACCAGAGAATTGCTGACTACGACAGCTTGGCAAGGCTAATGAGTTGCTGCGCACGAAAACGAAAT
CAAATGGTGGCTGTGTTGTAGGCATGGCTATCACAAACAAAGGGGGCGCAGAGTGACGAATCTTCTCCATTACGTATCGA
ACATATTCGCTAATCTCCTTCCCATTTCTGTTTAGAGTTGCAAGTGCGTCTGCCAGCAGAACCCTCTAGCCGAGGTAAGA
TTATCGATGGGGCGGCTGCTTTGTCCGCTCCGCCCCTTGATGATTGCGTATACATCTAGGCTGCGTCCTGTTGGCAGCTC
GAATAGTCAATGTTTGGACTGAATGAATGCAGAACAAAAAATCCCATGCTCGCTTATGCAGATGGTAAGATACACGGGCC
GATCACGGCAAGAAAGCAAGCCCCCCCCAAGAATAAAAGCCAAGGCGGCCACCTGGATTATAGCTCGTCAAACAAGCGGA
CTAGAGAGTCTGCTTTCGAGACGGCAGCTGCACCATCTCTGTCTGAGCTGTTGTGTAGTAATGAAAGATGTCGTTCGTGT
TTGGATGTCGTAGCCGCCAGGGTAGAGTAGGCATTTTCAACGAGCCGGCCCACGTCGTCTGGCACGGTCAGTGTCGTCCG
GTTGGCTTTGTTGGACCGTGCCATGACAACCAGAAGCACGACCAGCGCCAGCACGACGCCGGACACGATGGCCCACAGCA
CCTTGAGTCGTGTTCGTGTGCGTTCCTGCCAGGCCAGATCTGCGCGTTCCCAGCGCTCGACGCGTTCCCGGATGACATCG
ACGCGGCCACCAAGCACCTCGACGGCCTTACGGCCGGCAAGCACGCGGGCGTGCAGCTGCTCCAGGCGGCGCTGCTGGTC
GGAGGGGAGAGGACCAGAAGTGGCCGGGGTAGTGCCGGTGGTGGCCGCAGCAGCACTGCCGGCGGAGCCCTCTCCTGCGC
CGCCACCGCTGCCTTCAAAGTGGGCAAGCTGCTGCTCAACCTCGTCTGCAAGGGACCGGGCCTCGGCTCTGAAGTGGATG
TTTGTGGTACGTGCCGAAATTGCTAGCGATCGTAGCGCCTGCACGGTGCCCTGCAGGATGCTGAGGCGGGACAGCACCGA
CCCGTAGACGGCGTCGAGTCGCTGTCCCGTCGACGTGGACAGGCCGTCAAGGTCGGCCAGGGTGGCCTGCAGCAGCCGGG
CAGCAGCACGGTCTTGGTCATGCTGGAGGCGGCGCATGGCGGTCACGAGAACGGGATCGGTGTCGGGCGGAGGGACAAAG
GTCCCCGGGAGCGGTGCTCTGGCAGTCTCTGCTATGGTGCCGCTGGTGCCGCTTCCGCCAATGCTGCCGCCGCTATCAGA
CGCTCTGCGCGGAATGGTCAGAGTGGGGATCTGCAGCGGCGTGGGCGAGCCGGCTGCCGCTGCTGTGGCTGCAGCTGCCA
GGGCGGCAAAACCGGCGATGTTCTGGTGGGTGCCGCTACTGCTGCTTCCGCCACCGCTGCTGCGATGGCGGTGACCGCCG
TGGTGACGGTGGTGATGGTGGTGGTGTGGCTGCTGATGAGCCGAAGTTGTCGTGCGCGCTTCCTCGCGATGCTTCTCTCG
ACTGATGCGTACGCTTGGCCGACGGCTCGAGCTGGGGCTTTCCATGGAGGACACAGCCGGCGGAATGCTGCCGTCGGGCC
GGCCTAACTCCAGAGATGCACGGCTGTTCCGCGGAAGGCCAGATGCAGTCGCTGTTGGCGTCTTTCTCGGTAGAGGACTG
TAGGGGGTCGAAGCCGACAAGGCCTCGCCGCTGTGCTCCTGGCTGTCGTGGCGATGGCGTTTGTCGTGGTTTCGATGCAG
GAGCACGGGCGACGAAAGCTCCGAGAGTGACCGGGTGAACTGATGTCGTGGACGCTGAACTGCAGCCTGCGAGGAACCGT
CCGAAGCTGTTGTCGTCGTCGACAGAGCTGTCGAGGCTGCCTTGTTTTCTAGCATGATGGGCAAGCCAGGCTCTGCAGCC
CAAGGAGCCCGGAAACAGCACTGGATAGATAATTCCGGCCCCTCGTTACTTATGGAGGATTGGCATATATAGTTGTGCCG
TCAAAGGAGGTGATAGTGTATAGATGCAGGGAGTTGGAGCTGCAATTCTGCGGCGACTGTGAATTATGTCACATGCACAA
ATGGGTGAGGGGGGCCCCACCCATATCAAAAGCAAGTACTCCGTACTTCGTACTTCGCACTTCGCTCCTTCTAAAACAGA
CGACGCGTCACGCCTTCACACATCCCATATCAGTTCCCTTGCCACTGAAATGCATCTGTTTCACTTCTTTATGCTTCAAT
GCCCGCTAATAGCTATATGCCCGACTCTGCTCAGCACAAGTGCACTATGCATACAAAAAGCACAAGGGTCCTCTTCAAAC
ACGGCCGTCGGGTTCTCGGTATGCTGGGGAACGGTTCGCTGCAAGACACCGGGCACCAGTTCGGTTCCATCTCTCCCACA
TCCGCAAGGGGGTGGGTATCATCCTCCCTAATCCTCCTTCTCTGTGCATGGCCGTCCCAGAAGGCGAGGGGGTGATGCTG
TGTCGCAGACGGCTACATTTGTTGCGTAACCATGGAGGGGCCACGTTTTGGCACTGCCCTTTCTGGTTGTTGATAGCCAT
ACTTCTGCTGGGTGGCACTGGCTGCTTTCAGGTCGCCATCAACCGTTGGCGCCACAGCCTCGTGGACCTGCCCACATGGC
CATTGGCCGCTCCGTAGCCGTTCTCAAGTGTGCAGAAGCTTGTTGCGCTTCTCTTTGCGCTTCAGGCGCTCGACCCGCTT
CTTGTGCATCTTCTCGGCCAGCTTCTCGTACCGCTCCTTCTCCTCCTTGGCGGCCTTCTTATCGCGAATGGCTTTTATGC
GCACCTGACTCGGATTAGCCACAAGCGATACGCGGCATACTCTTCAGAGGCTGCCTCACCTGTCTCTCTGCCTCCTTTTC
GTCCTTCAACTCCTTCTCCTTTGCCTTCATCGTTGCTCTGGCAATGCGCTCCTTGGATCGCTGAGCGAACGAGGTGAGGC
CAGACGCAGGCCGAAACGCCTTCTTGGGCTCATGCCATTGCTTTCCTGCAGACATAGGTTAGAGGCAGAGACGAGGGGCA
GACGTGGATATCCGCGCTGTACGAACCGTTCCTGCGAAGGCCCAGAGATTTGGGCGCCGATGCGACCGCGCTGACTGCTT
CTTCGCTCGACATAACTGCACCCGTATATTTTTCGGAAAGGGAAGTATGCCGTGGTGCGAATCAGGATACTGTTGGTATA
GTTGCCGACAGAGAAGGGCCCTGTAGCATGCTTCCTCCCCTCCGTTCCTTTGCATCGCCAATTTTTTCTCATTCTGCCTG
CTAGCGGCCACCGCTCTGGCAGAATGAATTGCCAAAGCTCACCGCCAAACCCAGGCGGACACTATTGTGTGTGTCCGGTG
CCACGCTCAAATCCACTGTGGAGAAACGCTAATAATCCTCCGTGAATCGCGAAATTTTGCACCGGTCAAATATGAAATTG
GACGGAAGCAATGCGCAAATGGACATGGCTGGATCAAATGCCATACTAACTTACGTATTCTATATCACACTCCTTGGGTC
GAGACGCAATAGCACACATGTCGTCATCCGGTGTCTAGCAGTCCTCTTGGCTCTGGACTGCTAATTTTCTCCGATCTGAC
TCGTCGCACAACATCCCATTAAGCGCTGACTAAATCGTTGATTCGCATATTTCACGCAATTTTCCACTTACGGTAATCGT
ATCTTACTACGAGTCGCGCAGCGCGTGTTAGCCACGTCGAGTGCGCCGTTCCGGGCGCAAGACTTAGCCCTCGCTTTAGG
CTCGGCCCACTTCGTAGTTCATTCTCCTTTCAAGCGTGGCGTGTACCGGGCACGGCGAAGAGTTGGAAACGCTGGCGGTA
AGGCAAAAAGAGTTTGACGATGAATATTATTAGAACAAAGACAAGAGAAAAGCGGCAACCGGTGGCCTAAAAGTGGAATT
GTGTCTGCCTATTCCACGGAGATTGCAGCGCAGATCCTAGGCGGAGAGGCTGTGTAGCCACTGGAACGGTGCACGTTACG
GTGGAAAAGGGTATCGAAATGGAGGAAATTGAGCAGCACAGTTTAGCCGGACAGGGAGGAGATGACTTCGGTACCGCTAT
ATTACTACGACGTACCGGAGTATGCAAGATGCTGGTGTAGTTTTTTATTCGACAGACTGCCTATTGGCAAAGTTGCCCAC
ATGCTGTAGTATTGTTATAATAGCTATTGCTATGATAGCAGCTTCTATAAGAGGAAACATTGATTCATTTCTTTTTGTTG
CTTCTTTTTGGCCATGATAGTGCGCGAGTCCTGTTTTGGGCATACCGGTAATTCTGGACAGCACGATACGACATCAGCAA
GGCAAGACACTGCATGCAGGTTGCAGGGCGCAATGCACACCGGATGCGTTATCTGATACTAAAGATTTCGGACTTACCCA
TTCAAAACGGGTTAGTGAGGGGGCTTAGGGTGTAGTCGTATCTTACAAAGAGCGCAGGATTACGACGACAGCATCCGGGG
GCTGGCGAAAAAAGAAGGTGTGAATCGCCCGTCATAGGCTGAGTGGCCCCTGGTGGTCCAAATCTGGTGACTCGTAAGAT
CCGGGCAAGGCCATCTGTCCACAGTCATTGGTCCACCGCCTGCTGAAAGACAGAAGCCGCAGGCTGCAGACTTCAGGGTG
AGGGACTATCTGGTGGAGTCGCAGAGCAGAAAGACCATACTACGGAGTAGGACGTACGTCGTACGTCGTATGTACCTGTG
CTGCCTTGGTCCCTAGTGCCGAATCGTGCTCTAAAATAGAACCGCGTGAAGCGGATGCCCATTACGGAGCGGTCTTGCCT
CTTTGCGGCCAACTGTTTCTGGGCTTTCGTCTGTTTCCATGACATTGGCAGGGGTGGCTGCAACCAAAGCTTGCCAGATG
GGAAGCACACGCATCAATGAATCACACCTGAGGGCTTTTGTTTCAAACGCGCCTTCTCCATTTTGCTCTCATGACGATGG
AGCTCTAGCAGATCGTTGCCTCCCTAATCCCGAAATAGGCTGGGACGCTCGGAACACCAAACACGGTTACAATTCCTACC
CCACGGCGTCGTATTTCACTTCTCATGATGGCAGCCGAAGTGGGAGTCGCGCAGTCTGAACTTGTACATAGTCAGATACG
AAGTTTACAAAATGGCGGACAATTCGTGCGAGTGGGAGGAGCAACACACTTTGTAGCAAGCCGAAACTAGCCAGCTAGAC
CGTTAGGATCCCCCTGCCAATAGTTAGCAAGATGGAGTAAACAAGACAGACAAGGAAGACACGGCAGAGGTGGGTGAAAG
AAGGAAAATAGAAGAAAAAGAGCGCGTGCAATGACAGTAGTCCGTACTATGCATGCATCTCATCGCGACAGCAACGCTGC
GTCTGTTCAGGAACAAGAATCCAACCAGTCACGGCCGCAGCAGCCGGAATCGTACATACGAGTACGTCGTAGTATCGTAC
CTGAACAGCCGGGGGTGTCGCTTGATACGTCACTCGCTTGTGGGCTGTGAACTAGTGGGTCCGTGGGCTTGTGGACACGG
GTGCGTGGATTCGCCGGTTCACGGGCTTGTGGGTTTGTGGATGTGCAGCCAACGACGGGAGAGAGGGACCATCGCATCTT
GCTCTGGTCAGAAGCAGCACAGCGTCTAACAGAACGGTCTTGCGTGCCTCGCAGGCAGCTTGTGATTCCGGGGCACGACA
GCGACAGCAAGAAGGCCAGAGTGGATGGGTGGAAGGGTGTCATCTCATCTCAGAGGGAGGCTGCCTACAGACACCTCGCA
GTCTTGTTGAGCACAATCTCCGGCTCAATCGGCCTGCTCGGCTGCTGCTGGTAATTCGAGGGCGCTTGTCGTATGCAACC
GACTCGTAAGATGCATTGTAGTATGGAGCAAACGGGTGAAAATTTGGATGCCCTCTCCCATAGCACCCAAGGCAACGCAT
CGTCTACTCGTACATGCATCCTGCTCGCTGTTCATCCCCTCAGTATGATCCTACATACGAGTGTCGTAGTCGTGGGCAGG
CGGCTCAGCCGATCCCATCTTGGTCAGAGCGAGGGCCGGGGGGACCAGGTATTGATATTAATACCAGGGTGGGCAGTGGT
ATCGGGTGTCTGCTGTAAGGGAGGGGAGTGTAGCGGGCGGTGTATGATGTGTAGTAAGATACTCCGTACTGCTCGTATCT
TACATACGTACTCGTATATGTAGGATACGGATACTATGTAACAAGTGCCCAGACCCGTCCTGCGCTACTGCGCTACTGCC
TTAGTGCTGTCGACCAAGACTTGTCTGCCCTGGTCGTCGCATCCCAGTGGCTGCACTCACATTGCGGTGCCCACCCAACC
GGCAGGGGCCCATGGACGAGGGGAAGGAGGGAAGGAGACAAAGCCGCGAAAAGCAGCATCCAAAACGCACCTACACTTGG
CTCGTATTCTGGTCGCTCTTGTTTTCTTTTTTTTTCCTTTGGCGCCGATCGATCCGACCGTGGGGGCCTGTCTTCTCTCT
GCTTGCCTTTCTGCTTGCATGCTGCTGCTGCTGCTACTGCTGCTACTGCTGCTACTGCTGCTGCTGACTGTCCAATCCGC
GGCTTGCTCGCCGTCCTTCCGCTGTCCGCCGTGCGCTGCCCTCCATGCGCTGGCTCTCTTCCTACTGGCTTGCCTTCTGA
GACCTGCTCCTGCCTCGGGGCTCCACACGTCTGCCGCCACCAACGGAATTCCTTCCGCTCAATACTGGCCCAGTCGGTAC
AGCACACCGAGCCCGCCAGACTGTTTCTCGCTATATTGGCTTCGTACAGCGCCAAACCCCACTAGACGCAGCGCCTGCCT
TGTTCTCGTGCCTAGTAATATTACCTTCCGGCGCTGGCGGCACCCCCCACCGTCTATTGCGCCAGCTGCTCACGCTGTCC
TCGCTCTTTCCCGCTTCCTTTGTCCTCTCTGCTCCGTACCTGCTCGCCTGCTCGCCTGCTCGCCTGCTCGCCCGCGTTTC
TCCTTTCTTTTTCGGCTTGACTTTTTAGATTTACGTACCCCAATTCCGGGCTCCTCTCATTTCATCGATTTCGATCCCCC
CCCAAATTCCTCTCACCGACGAACTTGTCGTCTTTCGCATCTTTGGCGAAGCACGCGCACCTCGCCTGCCGTTGCTTCTG
CTTCTGCGTCTCGTCATTCCGTCTTATTAGGCTTCGCGCCGACGACTTCTGGGTCGACTCCAGCAACACAGGATCCTCAG
ATTTTGCGCCTCGCTGGGTTTGCCCGTCCGCTCCTTATCCAACACGTCCTGTGCAGTCTCCGGCTTCTTTTTATTCTATT
TTTATAACCGTTTTGCGTCTGCCGGGTCTCAAACAACATACATACTTTTTCGAATTCATTCCTTAGGTTCTAATTGCGGC
ACTGCTGCCCTGCTTTCTTTCGCTCGGCACGTCAACCCCCCGAACTATGTTTGCGAGATCGTGACGAGCAACAAGAGGTA
TGTCAGCCAATACGTTGTGCTGCTTATGCATTTATGTCTCCCCCCTCTAACGGTTTAAACCTACTGGGCGCAATTGTCTT
CCTGTACCTGCTTAATGCACAGAGCGCCCTGGCGGCCGTCGTCGCTTGCCTAGCGTTGGCCTGCTTACTGATGATGTCTA
GATATTTGATAGATCTACGTTCCTTTGCGTGTGCCAACCGCCCTTCAAACCGACGTCGGGTCCGGGTCCCTCTCCATTGC
TTTACTCCCGTCTCAATGCCACCGCGGCTCGACTAGGCTGTCCATTGCTCTCTCTCCGGGGTCGAAACATGGCGGCCTTT
CTCAGCCATGATAGCTCACCTCTTGCCGAGGTAGCGCCCGTCAACATGGCGGTCGCTGAAGACGACTTTGCAGAGCGCTC
GTCGCCGCGTAATATCCCACCGCCTGTCACGATCCCCCCGCAGTCAAACGACAATCTGTGCGTCCCAATCTATTCGTCTA
CCTCCCAGATCTCTCGACATACACAACAGAATTCGCCGTTACCGATGCCGCCTTTCGTGTTTCCAGCCAAACCGTCGACA
TCAGCCCCTTCGTCTTATTCACGTGCAACCGGAAGACGGCCAAAGTCGGTTGCAGACCTGCACGAGGGGAGCACCTTCGC
GGCCGGAGGCGCTAGAAGCCTTGACAACCGGTCACCGAGGCCCCTTGCATTACCCTTTTTTTCCTTCAATCCAGGCGCCG
TTTTCCCGCCCACGCCTGACCATTCATTTCTCAGTCCTCCACTCTCGCCTCAGCCCTTTGGTGCTCTTCCTATCCGCCCG
GCTGGAGCTGGCCATCGCCGGGGAGGAAGTGAGTTCGTTGGTGGCAACGCTCGTTCTGGAGATGCGTTTGCTCTTATCAG
TACTAGCCCGACAAAGTCTGAGAGCAGCCTCACGTCGCCGTCCCTTGCACCTGTGCCCAGCTCTCGCGGCCCCCCCCCCA
ATGGCCCCCCACCCGGTCGGCGTGGCCATGCCCACAGACGATCGGCAGCTATTTCGATCCACGACCTATCGGATATGCTG
ATTCCGACAACGCCAACCCACCAGACCCGTGGCAATAGCGCCCCATCCAGTCCGTTGGAGTTCGGCCCCGGGCTGAAGGC
CTTCGCCTTTCCGATGGCAACAAAATCCGACGACAAGCTCAAACCGGGTCCTTTGCCCCCCGTCGAAGTCGTGAAACCCA
ACGATGTACCACCGGCCTCCTTGACACCCACATTTGTTTTCCCGGATGAGCCCGATCAACAATCTGCCGACTTCAGAGCC
TCTAATCGTGCTAGGGTTGGATTTTCCGACACTCTTGAGTTCATCCCTCGGCCTCTGTCCCTTGTCTCCAATGACACAGC
CAGCACAATCACCGCACGGCCCATGGCTGGAAGTAGTGGCACCTCTGGCCACTCCGTCTCTGAGAGCATCTCGTCGGTTA
TATCACTGAATTCGGCAGGCCTCACACCTATAGTCCGAAGCACTTCAAGTGGAACTGTGCCGGAGTCTCGGCCCAGTACA
GCTGGTGCTGTGCTGGAGCGTTCTCAAAGTATCACGGCCGACGATCCTGACAGCTCATTGCCCCGAAGACGCAACTCAAT
TCCTCTGCTTTCGTCTATTCCGACAGATTCGGAGCTATCGGCAGATGCTGCCACGAAAGGCGTTGCGCCACGTCTCCCTA
GTCCTATCAAGACGCCCAACAAACGATGGTCCTTTTTCGGCCTGGATCCTTTCATCACCATTGGCAACAGCTCACCAACA
CGACCACGGGCAGGAGCGGCGGAGGCCGTAGACGGGTCTGCGATTGCAGATGCTGCAGACGCGTCTTTTACTGGCCCTGT
GGCACTTGCGACGGCCCGAAGCCGATCCCTTGACAGGGATGCTGTGATTACGTCCAGACCGGCCTCTGTGAGAACAGTGT
CGCGGAAATCGAGCAAGAAGAAGAAGAAGGCAAAGAGCTGGGGAATCTTAACAAGGAAGTCGAAGGCGCGGCGAAAGACT
AGAAGAACGCCAACGCCTCCACCGATCTCGCAGACTGCCTTTAGCGATGACGAGGAATCTTTTGAGGAGCAGACTTTTTC
GGGGGGTACAATCGATGAGACTACCGAAGTCCTCGCACCTCCGACAGTGTTTGTCACTCCGTCTTATTCACCGACCGATT
CAGACAGCACAGCAGAGGCGTGGCGACTGCCTCCGTCGCCTTCATACAGCATGCCGGATGACGATGCTTCTTTCGCCATG
ATCGACCTCGACGCGGCGCTTGGTCCCTTTAATACGCCTCTGCCACAAAATGCCGAGTGGGAGGCGGCACAGAGAGCCGG
CGGAATGACGAAGCGGCAGCTGCACAGTGCCGTTGGCATGACCCGCTTCTCTGGACCCGGCATGCACTATTCCCACAGAC
GCGCGGAGAGTGCTCCTGAGATGCCACCATTCAATAGAGCCGGCCTCCCGAGATTTAGCAGCTCAGGTGCAATGGCAGAC
GTCTTTGAAGAGGATGAAGAGGACGACGACGACGAGGGCAAAGGGAAGCGGCGCCAGATGCTTATGACAGCCGACAGTTC
TGATGCTGGCTCTGTGGTCTATTCCGCTTCGGTAGGCGGAAGCACTCCGCCGTGGCGTCCTACACGGGTGACCGAGCGAA
CGTCGAGCATCGACATTCGCGTGACGTCTACTGACGGCCGTGCTGCTGCGGACAAAGGGGTGGATATGTCGACGGCGCCC
AGCGAAGATGCCATATCCTCCGCTGCGCTGAGCAGGCGTGGCAGTGGGCTGAGCGTGATGAGTGACGACGACAAGACCCA
GCTCAGCACTGGCCTGAAGTCTGAGTACTCAGCAAGCTCTCTTCATGAAGGTGCGAAAATGGAGGAAGGGTTACGTGGCC
CCCCTTTTGATGTTCCCGACAGCGGATGCGACGTTACGGTGGAGTCGGCGTCGGACTCGACCGTCCACTCGATTGGTCGT
GTGAGGAAGGGCAAGGACCTGGCGCCCGTGGTTGTGATGATCGTGAGCCCGCTCCACCTTCCGCCTATGTCGCTGGCTCC
TGTCAGCCCGTTCTCGATGCCAACAACTTCGACTCACCCGTCGCCACGGTCGCCGATGTCGCTTGAGGCAAACCGCGTGT
CGACGGCACCGTCGTCTGTCACAGAGGACAACTTCCAGTCGCTTTTGATGGGTGCGCCTGGGCCCGAGCTCCGGCGGTCG
CTCGACATCCCGTCTCTGACGCCGTCTCTGGCGAGCAGCACTTCGACGACAACGCGGGAGAGTGGAGTTCCGCCATCTCT
GCACACGGCGCAGGGACCTCAGACACGACCGTTTCTACCGTCTCGGGAAGCGGAACGGCCGGCGTCCTTCACATATACGG
CCTTTGGACGGCGGCGGTCGAGTCTGGCGAGTCTGCACCGGCTCATCAACACGTCCCATGGCGAGCGGAGCAAGCTGTCG
ATGGAGGTGCCGCTGGACAGCAGCAGCATGCCTGAAACTGCTGAGGACGCAGAAAAGAAAAGGCCAAAATCCAGCCGCAG
CAAGCGGCTAAGTCGGATGATGCAATTCTGGCGATCGAAAGGCGAGGCGGAGTCCTGAGCATGTTCTGACGGCAGGCAGG
ATGCAGCACGTGCAATATATATATAGTATACGTATATGTATATTGTGTGTGTGTCTCCCGACGATCTGGGTTTTGGCGCT
ATTTATGACCATACGAAGCACATGGTGCGTTATGAAAAGAACAAAAAAAAAACGAAAGAACTGAGAGTCGCATCGGGGGA
GGAAGCCAGACGGAGTTGAATGCGTGGACACAGGCCAAGCTGGGAAGGCCGGCCGGTGCACAGCAGTCATACATAAGCAG
GAAGCAGACAAGTGCCGTGCGTGGCAAGGCAGGCGGCTGCAAGATTTCACGAAAGCCTTTTCATTTTCATGTATTTTGTA
TTGGCCAATTTATCCATTCTCTTCTATCTCTTGTTTTATCTTATGATTGTAAGTTGCGAGCAGTAGGCAGGAGGCGGGCC
TTTGTATTTGTATATGAGTTTCGGCAGGGCAGAAGAGCAGTGGCGAGAGGGAATCCTGACAGAGTTTTTGAACCGAGACA
GGCAAAAGAAACGAGCGTGTGATTAAAGTGGCATTGCATGTCTATTAAAGGAGACGAAGCGCATTAAAATACGGCGCATT
ATGGAGTATCTTACGGAGTACGTCGTACAGCTGTAGTTGGGGTAGTCTCCACAGGCTAAATAGTGCCGTAAAGCGCGGCC
AAATTCACGTGGCAACGAATGCACAACAAACGAACACGACCGTAAACACTGAGCGACCGAGGCTGGGACCAACACGAGTA
CAGAGACGCCATCGGCAACACCAGCAGTGATCTTCGCGCGCGTTCTATCTGAGCCATTGTCCGTTGTCTGTCGTCACGCA
TCATCGCATCATTGCCACGCGCATTTCGCATTTCGCATTTCGCATTTCGCATTTCGCAATTCGCAATTCGCAATTCGCAA
TTCGCAATTCGCAATCCGCATCTACTCGATCCCTCCTTGCCATGGCCAACACGCGCAGCGCCTCCCGACGGCTCCTGCGC
GAGCTTGACGGGTGGCGCAAGGAGCAGCTGGCCGACTCCCCGGACGACGACAACAGTCCGAACCGCGGCATCGAGCGTCT
GGGGCCGGCTGGCGAAGGCGACGACCTGTTCCGCTGGGAGGCCGTGGTGAACGGCAAGGGTGTTGGAGGGGGTTACGATG
GTGAGTCTTGGTTCCTTTTCGGCTGTTTGATGCCTGGCTGACCGGTCAGACGGCCGCTGGCTTCTCCAGATCGACGTCCC
GGCCACGTATCCGCTGCAGCCACCGGCTGTCCGGTTTATGACACCCATCCTCCACGCTAACGTGCATCCGACCACGGGCG
CGGTCTGCCTCGATCTGCTGCAGGCATCGGCCTGGACACCGGCCATGGGCGTCGCTGCCTGCGTGCGCGCCGTTCGCCTC
CTGCTGGGCGCGCCTGGCGCCGACAGCCCGCTCAACATCGACTTGGCCGCACTGCTGCGTGCCGGCGACACCGACGCGGC
CGCCCGGCTCGTCCGGCTCTGGTGCGTCGAACAGCGGTACGAGGGCGCATCCCAACAGCGAACAGAGAGACTCAACCAAT
ACGGCGCCGATCGGGGCGCCCGATGCAGAAACGTGGGTCCTGGGTCCTGGGTCCTGGGCCCTGCGTCGTGGGTCGTCGCA
TACGGATAGGGCTGTCGGGTTACGGAACATCGATCATGAGGATACATGACAGGCGACGCGCAAAGGTGTATATCAGTGTA
CGATAATGCTCTCCTTTTTCCCCCTTTCTTTTTTCTTTTTCTTTTTCCATTTCCCCCATTTCTCTTTCCTCTTCACTTGT
TCCTAGCATCAAAAGCGACTGCTAGACGCCGCATAGACAGTAATCAAAGCTTGTTTGGATATTCCCTTCCTCCTTCTCCT
CCCCGTCCGGCCCTTGATATATACCTGATAAAAAGGACACCGCCCGGGAAGGTTGCTCTAGTAAAGGCACGCAAATGAAA
GGCGACGTGAATCAAGGGGGTGACAATGAACGGGGGAGATGTGAAAAGAGAAAGTGTCGAGAAGAATGTTGTAATATACA
GAAGACGCCTACCCCTGCCGAACCCAGGCGAAAGAAAAAAGGACAAATGGCAGATGCAATGGAGCCTGTAACGGCTGTCT
AATTAGATCACCGGGCGCTTCCTTGTTTCCGTTCCTTCCAACCCAACGATGCCTTGTCTGTGCTGGTCGTTTCGTCGTCG
AGGCTCATTCGTTGTAGTGGTATACCTAATCCGGATTAGTCAGCTGGTTCAGTGGTCAGAGGATGGATTCTGCGCGTGCA
AGCTTCCCCGGTAGTTTGGAAGACCGGTCGCAGCCCAGCCCAGACGCCTGGCCATCCGAGCAAAGCCCTCAGTCTCAATC
AAGTGGTAGAAGGGAAAGGGTGGGAACATGGCGCCGTCGCGGTGCACTTCGGCCTTGACCAGCAGCGCCGAGCCGCCCAC
GCCGTCGAGCGAGACCTCTTGGTGCATGCTGTCGCCAGCGGTGCCCATAAAGGCCATCAGCGAGCGGTACGTGGCCATTT
CGGCATAGCCCTCAAAGAGGACGTCGTCGGGACCCATTTTCTGTGCCATCTCCTGGGCAGTTGCGCTGTCCTGCCAGTTG
TTGTAGTCGTACGGCCGCTCGTCCAGCTTGTTGGTGTCGGGATTGATGAAGCGCTGGAAGCAATTGGGCGCGACGATGGC
CTTATCGTGCTGGGCCAGGTCCTGGATCAGCGTCGGCGGCGTCTCGACAATGTCCGAGTCTAGCCAGAGCACCCACGACG
TCGACGGACCGAGCGTGGTGAAGAGCAGCGAGTTGCGGGCCTTGGCCATGGAGGCGCGGCGCTGCTTCTGGTTCTCCAGC
TTGTGGCGCTCGCCCTCGTCCTGCGACGCTAGCGGCGGCTCAAAGTCCTGGCGCAGAATGATGATGCTCTTGAAGCGCTC
CTTGTCGTTGCCAAACTTCTGCGTCTTGGTGATCTGCTCCTGCAGGGCTGCCGTCGCCGCGTTGCCCTCCTTGTTCTTAG
GCAGGATAAAGGCCAGCGTCATGAGCTCGTGCGGGTACGTCAGTCGCAGCAGGTTCTGCCAGTAGTCCGGATAGAAGCGG
ACCATGGGCGAGAGCACCAGCACGTGCTCGCCGTTCTCGACCGGATGGGCCGTGGCCGTGATGTTGTTCATAATGTACCG
CGTCACTGGTGGCGGCGGTGCCGGCTTGCCGTTAGCATGGTTGGGCGTCTTGCGGAAGGGAGACGTCGGCGGAGATAGCG
GGTGGGACGCCGCATTGGCGTTTCGTGCCGCCGACACGGTCGAAGCGCCGCCCGATGCCACCAGGAAGTAGATGATGACG
ATGCAGAGCACGCCGCCAATCAGCAGTGTTATGGGGTTCGTCTTCTTTAGACGAACCGGGCCCAGTGCTCGCGCCATGGC
TGTCTGTGTGTCGTGGTAGAGATTGGGAAGGCGGAAGGGGGGAGGATGTGGTGACCGAGGCGTTCGTTTGAAGGCTGGAT
GTGAGGTCGTGTTCGTGTTCGTGTTCGTGTTCGTTGGCGATATCCTTCCACAGGCTACCGTGTCATAGGCATGTCCTCCG
CGAAAAAACGGTGGATTGGACGTGCAGGGACAACAGAGAGGCTTGTCTAACTGGATATATGTAGAGGGAGAGAAGAGAAA
GGAACGAATGGCAAGAAAAAGGGGAGGGAGTAAAAGATAGCGAGAAGACACCTCCCAGGGGATGAAGTAAAAAATAAGCG
TAACGGCTGGGCTATCGTGAGCACGGCGTCAATAGGTTCGCGTGGTGATCCGGACAGACGTCGCCGTGATGCCTAGAGGA
GGGGAGAGTAGCAGAAGAGAGGGGGAAGGAAAAAAGGGTTGCGGCGGAAGAGGGAGAGAAACGACGAAGAGATTGAGAGT
TGACAATTTGAATTGGCATAATGTCTGGCAGGCACTATCGGAAGGGGTTTAGCCTGCCAGTAGGGAACTTGGGATTTCCA
GTGCTATAATTTAGCAGTCAGTGGCAGTGGATCAGGACACGGTAAGTTAAAGAGCAGTGCCGCTGGGATCACGTGAATCG
CGACACGCTGTAAGACGACCGCTTTACGCGATCAGCAGGTTGGCCAGGACAGGCAATACGGAGTACGAGCACGGCGAAAC
ACTGTATTGTGTGGCATGCAATTCGTGCTTCGACGGAGTACAGCGACATGGCGAGAAAACACGCAATTCGCGCTACCTTC
CCTGTTTTCCTCCGCTTCAGGTACGCCCTTTTTCCCCTTAGGGCAGCTTTGATGCCCCCTATTTTGGCAATGGCTTTCAC
CGCCTTCTGGGGCGGAGGGGCGATCGCAACAAGCTTGCTGTATCTTACGGAGTAGCAAGATAGTATAAATTGGTGTGGGT
TCTGGGCGAAATGCCGTCAAGCTGATCTCCACTCTTGGAAGGCATGGCCGATGGTGAGTCGTGGTTGCCCGTTGGATGAG
AGAACACTCGCCATTGCCTTTGTAATCCACCGTGTGTACGGAGTAATATGTAGACTGTTTTCCGAGATGGCTGGCAATGG
GTCAAGACAGGCGGCCCCACTGCACAGACGATGCGGTTCGACAAGGCTGTCGCGACAGCCTGCGGCTCATTTGCAGTCAC
CAACGTTGACGACTTGTTTGTGCTAGCGACCTTTTTCGCCGAGGCGACAGCCGGCCGCAGCGGCCTGACACCGCTCAAGA
TCACGCTGGGCCAGTACTTTGGCTTCACCGGCATCATCATCGTCAGCCTGGCTGGCTTTGGCGTGTCGCTCGTCGTGCCA
GCCGAGCCGATCGGCTTTCTCGGCCTGGTCCCATTGCTGCTGGGCATCTGGAAGTTGGCTGGCGCTATTGCCCCGGCAGG
CGGGAATGCCGACGAGGAAGAGCCGCGAGAACAGCCGAACGTGCGACAAGGAAAGACGTCTAGGACAGCCGGCGTCAGAA
GCGTGCTCAAGGTGGCGGCCGTGACCATGATGAACGGCGGGGACAACGTGGGGACATACATCCCGCTGTTTTCGCAGGCC
AGGGGGGCCGAGATTGTCGTGTACGCGGCCATGTACTACCTCATGCTCGGGCTGTGGTGTGCGGCTGCCTTTTTGGCCAT
GCGGCAGCAGCATGTCCTGCGCCTGGCCCGGAAGTACTCACGCGTCCTGGTGCCGCTACTCTACACCGGCATTGGCACCT
ACATCATCGTCAAGTCGCAGTGCTATCCGTGGTCGGTTGCGCGCATCGACCACTCGGTCTCTGGCCACCACGGAGCGACA
ATTTTGGCTGTTGCCACGACAGTCTTGTTGCTGACATATTTGGGCGTTGTGCTATGGGTGAGGCTGCGCGCACAGCTACA
AGCACTGGTGTTGCATGCTCGGACCCAAAGGCAGGAAGAAGATACAGAGCTGCGAAGTCTCGAGGCGGATGGACACTGCC
GAGATATCTGTTAGGACAAAAATATTACAAGTACGGAGTAGTTCATACGCTGTTGCTAGTACCTGCCTGAGGCACAAGCA
CAGCCACAGCCAAATTCGGCGATAAGGCAGCCACGTTGTGAGTGGCTGCAGCAAACAGCTGTTGCACGCGTCGCAAGAAA
GCTGCCTTGAGCTTCGTCAGTCTTCCAACCATTACCACTTCGCCCCATCGCCCAGCAGCCGCGAATCCGGGGCAGCCTTG
TCTATTACGTTCCGGTGTTAGACCTGAATCTCTCACTCCCATTTCAGCTGCTGCAAAAAAACAGCATTCTGTCTCCTTGC
TGACACTCGATCTCACACACTTTACCGCCCCACGATGGACGCTCTTGTTACTCGGTATAGCCGTCCGGCATTCCGGCAAT
GCGAGGATGTGGAAGATGTGGACGAGATGGACTACAATGACACGATGCCGGGTCTGTCGTTCAAGTTTGCCATGCCTCCG
GTAGCACAGGTGGGTTTCAACTGTTGGTGAAGTGAAGTGGATGCATTTGTGCCTTTGTCTCGACGTTGCTGACGTTGCAG
CCGTCGGCCTGGTTGCGTGCGGCTACGGACGACCGGTCCAACCCGACGTGCCCGATCAAGATTGCGCACGGCACGACGAC
GCTGGCGTTCCGGTTCCAGGGCGGCATCATTGTGGCGACGGACTCGCGGGCGACGGCGGGCAACTGGATCGCATCGCAGA
CGGTCAAGAAGGTGATTGAGATCAACAGCTGTCTGCTGGGGACGATGGCTGGCGGTGCAGCGGACTGCCAGTACTGGCTG
GCGTGGCTGGGACGCGAGTGCCGGCTGCACGAGCTGCGGCACAAACGGCGGATCTCAGTGGCGGCAGCATCCAAGATCCT
GGCCAACCTGGTGTACAGCTACAAGGGCATGGGGCTGTCGATGGGCACGATGTGTGCTGGCGTGACGCCCGAGGAGGGCC
CGGCGCTGTACTACATCGACTCGGACGGCACCCGGTTGGCGGGCAACCTCTTCTGCGTCGGGTCGGGCCAGACGTTTGCG
TACGGCGTGCTGGACGCCGAGTACAGCTACGACCTGGCGGCCGACGACGCGCTGGAGCTGGGCCGACGCAGTATCCTGGC
GGCTACGCACCGAGACGCCTTTTCCGGCGGCTTCATCAACCTTTACCACGTCAAGGAGGACGGCTGGGTCAAGCACGGCT
TTAGCGACACGAACCCCATCTTCTGGAAGACGAAGTTGGAGAAGGGCGAGTTCTCCAACGTGACCAGTGCACTGGACTAG
GAGCGTCAGGGAAGACAAGGGAAGAATGAGGACGAGACAGATGGACTACATGAAATGGTATAACATACAGATTATCGAGC
ATTGTCGATAAACCCGTGGTCACGTGATATACTGTAAAGCTTTATGTAGAGCTTCAATCCTCCCAAGCTCAGTCCTCTCG
CAGCCAGCCATCCATGCCGAGGATGCCCCCATCGTCAGCAGTGGAGTCCATGGCCCAGCGTCGTCGTGGCAGCACGCGCA
GATCGGTGCGCCAGCCGGCCTCGAACAGCTCCATGCCGGCCCAGGCGATCATGGCCGCGTTGTCGGTGCAGAGAGCCGGC
GGTGGTGCCACGAGCGGCAGGTAGCCGAAGCCACGCACGTCCAGTGCAGAGCGGAGGATCTGGCGCAGGAAGCGGTTGCT
GGCGACACCGCCAGCGACGACGAGACAGGAAGGGGGGCTCGGAGGGTCTCCTTGGTCTGTCTTGGCTGCAGCCTCAGCTT
CAGCTTCCACTTTGGCTCTGCGCCTGTTCGCAGTTGCAGCCACTCCCTCGACAGCACCGCTCTCTAGCGCCAGCACCAGC
CGGCTGGCCAGGTGCTCAAACGCCAGCTGCATGGTTCCGCGGGCCAGCACTGGGCGGTCTTCATCGGGAATGCCGGCCCC
AGACGGCTCTTTGGGCGGTTCGTCTTCTCCGCCGCGGCCATCGCCCTTTGCCAGCCGGATGACGGCGCCGTTCAGGCCGG
AGAAGTCGAAGCGTAGCGCCCGTCGGAGGATGCCATTAGCCAGCGGTGCCTCCAGCCGCCATCCGCGACCCGACTCAAAG
GGGGCCATCTCGTCACGGCGAGTCGCCGGATAGCTGTATCTGGTCTGGGCGGTTTCGCTTTCGCTTTTGCTTTCGCTCTG
GCCCGCAAATCCCTCCAGCAGCTCTCCGTACGGCAGGCTGCGTCCGGCTGCCGTCTCGGCCGCGGCAATGTAGCCACGCG
GCAAGATGGCCCGGGCGCTCTTGTCGAGCAGGTCGCCGATGGCGATGTTGGCTGCGGCCGCGAGGATGCGGTGGTCGGCG
AGGCCGCGCGAGTGCAGCAACAGCGTGTGGCCGCCCGAGACGAGGAGCGAGAGGTACGGAAAGGACGCAAAGGGCGCTTC
CTTGTCGTCGATCGCCGACACCAGCCGTGGCGTCAAGGCGTGCGCCTGCATGTGATGCACGCCCATCAGCGGCACGTCCC
AGGCCACGGCCAGACCCTTGGCTACAGATAGCCCCGTCGCCAGCGAGGACGCCATTCCGGGACCTCGCGTCACCGACACA
AAGTCTGGACGTTGCTGGCCTGATCGGTTCGCCGGCAGATGTGCTTTCGCCTGCTGTATCAATGGCCCCAATGCGGCCAT
GTGTGATTCCGTCGCTGTCAGCGGGTGGATTCCCCCAAATGCCCGGTTGTCCGCCGTGATCCGCTCCTCAAACAGCAGTC
GGGCTCGCCTTCTTCTCGTTTTTTCCTCGCCCGTCTTCTGCTCTCGCTCCTTCTCCAAGACGGCCACACAGGTGTCGTCG
CAGGACGTCTCGATCGCCAGCGTCACCAGGCTGTCCGGCCACCGCTCTCGTGCCTCGGCTCCCTGTGCCATCCCTGACAG
CCTCTGCAGCCCTCCCGGTCGCCGCCGCTGTCGCGTCCATATGCTCACAGCTCTCATCGAGACAAGGCAGACCCGCACAT
CCAGAGCTTTCAGAGCATCCGGACCTTGCAAACTAGATGGAATGCACACTCAAACCCTCCCATCTCACTTCACCGGCCTT
TTGGGACAAATGTATGCACAAAAACCGCGTATGCCGTGCCTAGATGGTGCGTTCGCTCGTGGAGCAAAGCCAAAAGTCCG
CCGTCGAAGAACACAACTTTTCACACTCGCGAGAGCACGTGACTTCCGTGTAAGTACTCGCAGCCCCGTACATCGTATTA
TACATCTGTCTTTTGCAGTTTATACATATATGTGTATGTAGCAGTAAACCAATCATACCCATAGCCCAAGCCCAGAAACG
CCCACGTATGCACCCTCACGTTGACGTGTTGCCGTTTTCTCCGAGAAAATTCGCCCATGCACACTTGCATCCGCCTGAGC
CGCCGTCCGAGCCGCCAAAACTGAGGTTGTCGCTGTGGTTGATCAGCGTTCCGCCAAACTGCAAGTTCGCCACAATGAGA
CTGGTATTGGCTGCCAGGATGTGCTGCTCGCTGTCCACTGCTCGTGCAAACGCACCCTTGCTGTTAAAGTCGCCGCCGTG
CAGGTCTTCTGTGATCGTGATGGGATAGGGAAACGTGCCGGGCTGCGTCGTGTTCGCCGTCCGGACCGTGCTGTCACCCA
GCATCCGCGTGCTGTTGCCCATCCGCGTCCAGATCTCCACCAGAAACCGTGTCTGTAGAAAGGTGACCATGTATGCTGCC
TCCGTCTCCAACGACCCGCCAGCCTTGTCGTCCGCATCGCTGCCATCTGGTGCCGTCGACTTGACGTAGATCGTCTTGTC
AAAGTAGCTGTAGAAGCCGTAGTGCTCTGTCGGCAGTCCGCGGTCGTACAGCCGCACTGGCTGCTGCTTCGGAAATGGTC
GTAGAACCGCTGCCGCACCGGTGCCGTCGGCATTCGTGGCCGCCGCCGGAAAATGGAATGAGCTGCTGCTGCCGGTCGCC
CTCTCCCGCATTCTATTGCGCCGTCTCACCACCTCGTTCGGCCCTGCCGTGCTGCTGTTGACCGACGCCAAAAAGCTGAT
GTAGAACGGCGTTGGTTCGCCTGCCTTGCGGTCTGCCACAATGTCGTCCGTCGTGTTGCCCAGGAACCACATTTCCTCGA
ATGCTGGCGGCGACGGCTGCGGCGTGAAACCGGCGTCGAACCTCTGGCTCGTTGACGTGGCCATAGTCGTTGCAGCCGCC
GTGCCTGTAGTTTTGGCCGTGAAGCTCGTCGTCGTGCCGGATAGCGCCGTCGTTGTCGTCGGCACCGGTACCGCTCCGTC
TGCTACGTTCCATAGCTTCTGCGAGCTGTTGTCGAATTGTATGTCCAGCACAAACATCAGCGCGTCCGCCGAGAACGGCA
GGTTGGCATTCTGCTGCTCTTTGGGCAGCGAACAGCTCCACATGGTCGACGGACTGACGCAGCCGTCCGCAGTAATCGTG
TTCTCGGCCCCGACCACCGTGGTGACGCCTGTGGGAATTGGCGGGAAGTCCGTCGTGTTCAGCCAGAACGAATAAGCTGT
CGAGACTGCTGTGTGCCGCCGTGCCAGCACTACTGCCAGCACCACTGCCAACGTGATCGCCGAGATCACTCCGCCCGCCA
CCCCGAGGATCGCACGGCGTCGCTTGCGGGCTTCACGGCCTCGGCGTCGTCCAAAGCAGCCGTTCTGCGGCAGGCACCCG
CGCCCACGCCAGAACGACCCTGCCTGCTGCACGGCCACGTCCTCTTTTTCATGCCGCTGGCGCGTCCGCTCGACCTTGGC
CGCAGCTGGTGACGGTGCTGCCCCGCGAAAGAGAAACGCGCCCCGGGGTTGGTTGGGTAGGGGTGTTCCACTCGCCGCCG
CCGCGCTTCGAATTCCCGGAGGCGTCAGCGGTACTTCCGCCATGTGAATCGCTCCCTGAGATGTCATAGCCTGGAGCAGG
CCCGGGGAAATCGGCCCTGGAGAAAGGGGGAAGTCAGCTCGCGCCAAATGGCCCGGCGGAAGCACCGCCCGGTATCGCAC
GGCCATCTCCGGTCTAGATGGCGTCTCGTATGGTGGTGGCGCATCGGACGGAGTGTCAGTGCTGCGCTCTCGACCCTGCA
CTTGCACCTCCACTGTCTTCTCGCTTGTTTCGCCAGCAGGCTGGATCGGCGCCAAGAAGCGGGAAGACGACACCACCGTC
GGCGAGCGATCGTTGCTGACTTGTACACGACCGGCATTGGCCAAGGCCGTTGAGATGCCCAGACCTGTTTTATTTCGCCC
TGTGGCCATCTCCACAGCAGCAGGCGACGGCTGTTCACCATCGTTATGCCTCCACCATTCGTCAGACGCAGCTGAAACAG
CAGGTGTCATCGTAATGGCTGGCAGAACCGGCACGGTAAACTCTTCGGCCACCACAGGCACTGCAGGCACGGGCTCTGTT
GCTGGTGTGGACGCCGGTGTCGTGGGAGATGCTGTCTTGCCAGAGAACGGACTAGCCGGATGTTCCGCAAAAGGCGTTCG
CACATGATCCCACCAGCCCGAGTGCGTCGTGCCCACGGTGGCGGCCATAGAGCGCACATAACTTCTGACGTGGGATAGTC
GCCGGTACGACCGTGGGCTGCCGTCTTCTTCAAACAAGGTGATCGGCGTGCCATAGTCGTCATCGTCATCGATCTCATCG
CGGAGAATGATGCTGGCTCTGGTCGTCGTGTGGCTGCTCTTGTTGGCTAAAAACGGCAGCCTTGGCTCTTCCATGCTTGT
TCCGTGGTAGCTTGGCGGTACTGTCGGAACGGGGGGCAGCCCTTCCTGCTCGATGTTGTGGTTTGGCATCGAGTAGATGC
TCGAAGCTGTCTGAGCCACTGAACTACCAGAACTGAGAGGTGAACCGTCCTCAGTGTCGGGAGACCAAACCGACTGCAGT
TGCGGGGCCCTCGATGGTACTTGTCCCTGGGTAGGAGCCTGCCCTGGCTGCAGTCGATGCTGCTGAGTGGTACCTCCCTG
TCGAGGTTGGATGGCACCGCTCCTGTCAAGATACTGGGAAGCATCGAAAGGGGTTTCCATCGTCGTTGTTTGTGGTGTGA
GAGTCTTTCCTGCGAGATCATCTTCAGGAAGACTTATGCCAATGACAATGGGCCCGTCATTGGGAGATAAGCCCTGGGCA
GTGGTGGTGATTGGAGTGTTATCCGCCTTGTTCTTGCTGTTGCCTCCGTGATGCTTCTGCGGGGACATGGCAATATTGCC
GTTGGTCATGCGTCGCAGCCAGTTCCAGTTGCCAATAGACGTATCAGACGGCTTGCCCTCCAAAGCCCTCAGGGCAGCGG
CATCCACAAACTTCCCCACCCTGCCACCGACTCCTGGCTGTCGTCTCTGCTCAGCCTGCTGCTGCTTGCGGAACTTTGAC
ATGTCTGTGACCAGTCGGATACCTTCCTTGTTGTTCTGATCCTTTTGGCGAGCACGGGATATCAGTCGCAGTGGGTTCTG
GACCGGGTTTTTTGTCGACGCCTGTGTAAAGAACGGAGCAGTTGTTGTACTCGGCCCGGCTTGAAGGGGGTGGGATTGAC
GCGAGTAAGATATTGATGGCAGCACTTGATCTTGGGTTTTCGGCGACGTTACAGCCTTTGATGAGGCCAATGGAGAAATG
TCTTCGCCGTTGTCATTGTGCTCAACACGCTTTTCCTCATCGCAGTCGCTCTCCCACTGCTCCCAGTCTTCTTGCTCGGT
CGGCTTATCGTCAGGACCATCGAAAGGTGTCTCGAAAGGGTCGTTTTGTCGGTTTGTTTGGTCGTTCATGTTTGTGATAT
TGACGGAATGAGAGTTTAGATAGGTCGTCGCTTGGCCTGCCAAGCAGATAGAAGCTATCGTGGCAAATATTGGATAATTA
TAGATTCAAAATTGTAGGTGCACAGAAAAGATAGGAACAAATTTTGTGTAGGAGGTATGTTATGCTGCTGCTTTTCCCCA
AGGCTCCGAAAATGGCAAGCATATGAATAACAGTCGAAGGTGGGCAAACGAGTAACGAATGTCCAAAGTGCGCCGTTGTC
ACTGAACAACGGACTAAGTTAGGCCACGAGAGTGATTGTCGAAGCGAGAGGGTCAAAGAAAAATTGACAAATGGAACAGA
ACATCAATGAGTCTTCAAGAAAGATACAAAGAAAGGACCGACAGTCTCAAGTTCCATTTGCTAGAACGAGAACAATGAAT
GAGGGGGGGAAGACGCGCGGACAAGAAGAAAGAACCCGGGAACGAAAAAGAAACAGAGGATGGGAAGATAATCTTGTTAG
AGAAGAGGCCCAGGAGCTGGCCGCCACTCGTTATGAAATACTATGGCGAGACAGCATCCTGGCTATCTTGGTCTAAGACT
CATGGACCGGCCGCCTCCCGTGTCACCACCCGCTCGTCTGCCGTCCGCTTAGTATTTCTTCTGACCAGCCAGAAGGCTTC
CCGCATGCCCAGGGCCCACTCGAGCCTGTTGTGCTAGGGAGACGATGCAGCAGAAAGGCGGGAGATCAGGGCCAACAGTC
GAGCCTTCTCGCCTGTCTGTCTGATGGCCCCGCTGTCGTTCATCTGCCCTGGACGTAATTACTAAATATAACAATACCCC
AACTCTTGCGAATGAGTTCTCGCAGACGCGTGTCCTAGAACGAGCTCCTGCAAAGCTTGATGCTGGACGTTCTGCATTTT
CGCCAAGCAGTCCTAGAAAGGACCAATACAAAGCAAGGCGACTGCGCAGATCCGCCGATTGAATTAAGCGCCGCAGAGCT
GTGCGCATGCCCCGTAATTATTGGCTGTCGCGGAAGCGCCGTGCTGGGCTGGGCGTTGACCGGGGTAGCTTGGCCACCAA
TGAAAAATGTCGATCGGAGCGCCGATGCTGTCGACTCATTATTTATTTTCAGATTCCTACTCCGTATCTTACTATGTACG
CGAAGCTATACGTCGTAGTCAAGGACTGCCTGCAGGCGGCCAACTAGATGGTGCACATGTGGGTATCTACTGACTCTCAC
TGTGGCTGGGCCAATCGCGGGTGGTTGCCTGCTTTGGCCCGGTCCATCCTTCCCTCTTGCAGTCGCTGTCGCTACAGTAA
TCTCACGTCTCGTTCATGTTCTGTTTTGCATTCTGCACAATCTCTCTCTGCTGCTCATGTGAATTTCAACAAGTGTCTCG
AAGCCGTCTGTTCCCGCTCTACGGAGTAAATTCCTCGCCGGTGATGATGCAATTTGCTAGATTGTCCATCCCTATCGGGC
TTGTAGTGCTCCGTACATGTTGTCACGTATATCCACTTCTTGGTGCAAAATAAAGCCAAGTAAAAAGCAAGTTGCAAACC
CTGTATTACGGAGTAACAGCCAGACCGTTCACACTAAAGGCCATAGCGCCCAGATGCCAAGACAAGTACCATACGAGCTT
TTGAACCTCACTTGCTCGATGGGCGGGAAGGATGAACCTTCTCAGGACGCATTGATGGCAAAATGGCGGATTTTTGCTTT
GCGATGACTGTCTATCAACCAAGCAGAAAATGAGATAAAAAATTTAATGTAACGGGAAATATTTCATTCGACTGGGGAGG
CTATGTCTCTGACGAAAAATGCAGACGCCTCCTCCGGCACCATCGTGCTGTGGGATTCTATCATTGTCTTCCTAGCCCAT
GTTCATTCTTCATTCATTGGGCGACCGTGCTGGTTGTAGTGCGGCATTTAGCAGCATCCGCAGCTCTCCTCGCAGCCACA
GCAGCCGCACTCCTCAAAGAAACCACCGCGCATGGAACCTGCGGGCTCCATCTCCGGCTGCGCCTGCATGGGCTATAAAA
GAGTAAAGGATTAGACACAACTTCTTAGAGTAAATTGACAGAGAAACAGAAGCACATACCGGCTGCTCCATGACAACGGC
ACCGTTGTCAGCAGACATAGGCGGCGGCGGTGCGGGGGCGTCCATTTTGAATTGGGTTATGAGGGCGAATGAATTAGCTC
GTGAAGACAAAGGTCATTAAAATGCGAAGAGTTGTGAATTGGTGCTTTGCTTGTGAGAAAGTGGCGGTATGGTTTTATAA
GGAAGAGGATAGAAAGAAAGCAAGACAAGCGGTCAGAGTGACGAGGACCGTGACCTTAATACTTATTTACCCCGGACGAC
AGCGTTACGGAGCAACACCGCCACCAGATTTTTCTACTGGTACACGTACGTTTTAAAGGGGGGCGGGTTTGCGAATCGGC
ATGAATGTGCTGAGTCGCAGCCCGCGACTCGTCAGGAGCGCGCGTACGAAGTACGTCGTAGGGCAGGAACGACCCCTGCT
TGGGAAAGAGGGGCCCAAAGAAGGAAGGCATAGCTGAGGCGCACGGTCAATACGTCCAAGTGCGTGTTTGCCCGTTGGCT
CCCTCCCGGCGTTTTTCGACCTGTGACGACGTCTACGATACAGCAAGGACCACCGGACTGGAGACAATTGGGAAGGTGCG
AGTGAACACATACTCCGTAGACTTCCCAGCCCACTTTCCCTGGTTCCATGGCCGTGCCGTTTCAAGTCTACGGAGTACAT
AGTAAGATACGTTGTCTTCGCTCCCCGTCCGTTTCACTCAGTTCCACTTCTGGCGTGTACGGATAACAACGCAGCAGACG
GAGTTCTCTTACATCATATGTGATGAAGTGAGCCGGGACCATGCGTGGCAACCAATGGACAAGGGATGTTGAGGTCTCCA
TACGAAGGACGACACTTCATAACTAGAACAAGGATCAGGCGTGTTGCTTAAGATACGTCGTATCTTACATAGTAGTATGG
ACTCAGAGAGCTGATCTTCTGCGCGCGCATTACGGAGTACATAGTAGTGCAAGGAGAAGTGTCTCGTATTAAGAAACTCG
TATCGGAGACCAAGTACAGCCACGATGGAGCCATCAATTCAGCCACAGCTGGCGTAATATATTCGTACTGGTTGCTGAAG
AAAACGACCTGGCCGCTTAGTCACATACGCAGCATTTGGTGCTGGCCTTTGAGGCACCATGTCCAGAACCTTGCCGTATT
CCGTATAGATCGAACTCGTGATACGGGGAATACATCTTAGCTGGACTGGCGACGTGCTGCTTTATACTGCTGCTAATGCT
GTCGGTAACGTTGCCTACAAATCTCAAATTTCGCAGTTTTGCTGTTTGCATACGTTCTTAATACGAATAAGAACATATTT
GCAATGATATATGTATCTTATCTTACGGAGCACCGCGAAATAAGATATTTTGTAAAGAGTCTGGCACTGTGCCTTACAAA
ACGTTGTATCTTACTCCGTAATACTCTGTATTCCGTATACAACGGTCGCCGGATAACAGTGAGGAGTTCGTTGGCGACGA
CTGCGCCATCTTAAAAGTATCTTATGTGAGAACGGCGTACGGTGTATTACATGTCGTCTCTTATCTTACCTTATCTTGAC
CTAAATAAGGGACACAAAATACTTGCAAAATAAGCACGTGACTTTACCAATAATCGGCACCGATCCACTTAGCTTCCAGC
AATCATGCTTTGTACCCACTAAATCGCCAATGGTTCCGTAAGTAGTAAGGTTGGTTCTGGCGATGCAGCGCGCGAATTAT
GCAAGTTTGTGCCTAATATGGGAAGATACGTTAGAAAACGATGATTTGGTATGAGAAAAACTATGTAAAAAATAATTTTG
GCGAAAGAGGGGAGCAAGACGGACTTTTATTCTTCTGGCTTCCGACCCTCAAGAGTTTAAATACGTGAGACTTGCTCGTA
TGTGGCCGCAGGTACTCCGTACGAAGTACTAAGTACATTGTATCTTATGTCGTAGTAAGATTCTTGAAATACTATGTAGG
CGGTCCAGCAAAAGGGGCCAAGCAAAAGGGGTTGCCGCTGTCATCCCGCCGATACACATGTTTCTAACCGCATTTGCTCT
TCATCCCTCAGGCCACGCATGGTAATTTGACCCCTGCAAATGGTGTCTATTAAGTAGCTATGTACTCCGTACTCCATATG
TACTGTAGCTTTCCATGCTCGTATCTTACTATGTATTTCACGTACGCCTCAGTGTTTGTAACATACATTGTATGTAGGAA
CAGGATCCCTGCCTCCGAATCCTGTGAAGTATATGGGGTGTCTTGCTCGTATCTTGCTGATTTTTTACTTGCTGAGATCC
TTATACGAATTGGAACGTGGCCATGCTTACCCGTATCGTATTGCTAATGCGTAGACAAGCCTTTTCGTAGGTCACGGTTT
TTTACTTGCTATTATATATGCACTCGACAAAACTTCCACACGCCTGATACATTTTTATACGTCGTAGATGTCTTATCCAA
TTTCCCATTCTCCCTGTGGAGACAGCAATAGGCGTTTCCATTAATGTCGATATCGGGAGTCAGTAAGATACTCGTTAGAG
AGAAATTTAAAATAAGATACATAGTACTATGTACGGAGTAAGATAGTTGGTATATGTGAGATAGTACGCGTATTTTGCCC
TGCTGTATGGATGTTAGCAACGGCCGTTGTGCTGCACCGTGAATTGGCGAAATGATGATGCCGTCCCTCACACCTACGAT
GAACAATTGCGAAATCACTTCGCGATACATAGTACAATGTCAGCAACCAACAGCCTCTGCGGAAAGCATTGAAAATCACA
CAGCACTTATCTTCTACTGGCATTAGCCATTGATATCCTCGTAGCTTTAATCCAGTCTGAGCATCCCTCTCGTGCATCTC
CCTAATTTTAGAGGCGCATCTCTCAGGGGCTTGAAGAAATCGTCTAATGCCACCGATTGACGCGACGCTAACTAGTGCCC
CAAATCAGGGTGAGAAGTCAATAAGGTAGGGGATAGGGGTGATCAAGTCGTAATTCGCTTGCGAAATAAGTAAAAGCCAA
GTGTTGCCAGCATTATCACAATGCTAATCGAGCCAACGAGAGCTCAGAATCTGCAAGGCAAGGCGGGCCGAAAAATTTGG
CGGCCAATTGCCAGATAACGCTTTAAGGAAAGAACGACTTCACGACCCCTTTATGACGAGCTCGATTGTTCGCATGCCCC
ATAAAATCGAAGAAGAAGAATCAGCGACAAAAGAGAAAGAGAACACTAAAATCTGCTCTTTATTCTCCTCCTTTGGTCAT
CTTCACGGCGAGACATTCGTATCGGTGGCAGTAATTCATAACGCTCGACATCAGCACTCGTCAGACTACGACGCATTAGA
TGCGACCCGCCACATTGGATACCTATGCGTAACCCAAGAAGAACACAATTTGTGTTTTCCGAAAGGCGTGCGACCCAATT
CTCTACCTCTTCGACTTTTTCTTTCTCTTTTTCTTTTTCTTGTTCGACAGCTCTCGGCTACCGGTGTTTTGCATTGCCTT
GAGTTTCCCCCTTTAATCACTATTCGGCATATCTTCCAAGTGTCCTTAAAATTCCAGTTAGGCCAACCAAAACCCACACA
CCCTTTTTTAGTCACTCGTTCACCTGAGAAACCGCCACATCGCCCGATTGCTGCATCTGCACATTTGCGGCCACGTTCGT
CCAAACACCCAACACCCGAAAAGGCGCCTGCAACGAACGGCGCGTGGCCCCGAACGGACTGGGCAATCAGCAAGGATAAC
CGAAGAAGAAAGGCTTCGAAAACCAAACCTGGTTGAGAAAAGAAGGGCGAAAAAACTGGAGACTACTATTTCGTGACGAT
TCTAGCGTTTGTTTTTCAAGATCTTGGTCTTTGTTTCTTCCATTTCTCCAGGAGACTCGTCCTGTTCTGCACACTTTTCT
TTCATCCTCCTATTCTCATCACCCCCTCTATCCATATCACCCAATTCTTTGTCCGTGACCAGCTTGGCCCGTAGAGTGCC
ATCTGGTGGCGCGGATACAACTACCACAGCACTGGCTTCTACGCTCTCCACCGCGTCTTCTTCGTCCTTTAGCGACAGAC
CTTCGCGGTCGCATCGTCGCCGTTCTTCTAGCATTGGTCCGCCCCAATCATTACCGCTGAACGACTCTTCTGGCTCTCAG
TTCCTGGGGGTGAGCGCCCGGCAGGGTCCCCTGTCACCAATACCTGGTATGCACCCGCAAACGCGCATTCGTCCCATGTC
CAGATAACGAAAATAAACGGAGCAAATATTGCCTGACTCCCAACACCCCTTGCTGGCTTTTTGTTTTCAGCAGACTTTTG
TTGACACATGTCTTTTATCTCCAATTTAGGCACCCCGAACATCGTCATGCCTCTCTCACGAAGCCCATCACCAAGTCCTG
GCGGCGGGTGGTCGAGTCCCGGTCTGAACATCCACGGCAGTGGCCGGTCTAGTCCATCTCGAGGCTTCGGCGCGGACTCC
AACGGGGCCGCATCTGGTGCTTGGGAGTCGACACGCTCTCGCAATGCTGGGACAAGCAAATACCCTTCTTTCTCAACGCA
AAACCAGGGCTTTTTTACCCGACATATGCGCCAGTTATCGAGCAGCCTGCCTCGCTTCCACAACAACACCAGGCATGCCG
ACAAGGAAAAGCATGGCCACCACTTTGCGGAAGGGACGAATGCATCGTGGGGTGGGCGCTTCCGACTCCTATTTGCACGC
ATGGGAAGAAAACTAAAGATTCGCGTCTTAATGGCCTCTTTGCTATTAATATGCGCCTACGTATTTTTCCACACCCGTGA
GCACCCCTTTATCACCTATTTTGCTACTGCTTCTACTGGGAAAAATCACTAAATACTGACCTTTGAGTAACAGCTCTTCT
GTATTACTGGCGGAGAACATCATGGCTAGGAGGCGGCGAGAAATTTGTCATCATTTTGGCGGCAAACGTTGGAGGTGGCG
TCATGGAATGGAAAGGTGCAAGAGAATGGGCGATCGAGAGGGATAGCACGCGAAACAAGAAGCGATACGCCGCACGTTGG
GGCTACGATCTAGAAATCGTGGACATGAGCACGAAGAAGCGCTATGCGCACGAATGGCGCGAGAGCTGGGAGAAGGTCGA
TTTCATCCGACAAGCGTTGCGCAAATATCCCAATGCCGAATGGTGCGTCTCGTCTCTATTAGCTGAATTGGAGCTGTGCT
AACAAACTACTCTGCAGGTTTTGGTGGCTGGATTTGAACACTTATGTCATGGAGCCGTCCTATTCGCTGCAGGACCACAT
ATTCAACAACCTTCAGGACCACATTTACCGCGACATCAACGATTACAATCCACTGAACATCCCCCACCCGCTTAATGATC
CATACCTGGACACGCTTTCTCGAAACGTGGCCGGTGATGGGAAGCCGGATTCGGTCAATCTCGTCTTATCGCAGGACTGC
TCTGGCTTCAATCTCGGTTCTTTCTTTATTCGCAAGAGCGAGTGGACCGATCGGCTCCTGGATGTATGGTGGGATCCCGT
GGCTTATGAGCAGAAGCATATGGACTGGGAGCACAAGGAGCAGGACGCTCTGGAGCAGCTCTATATCGCCCAGCCGTGGA
TTCGCCAGCACACTGGATTTTTGCCGCAGCGGATGATCAACAGTTTTCCCCAGGGCGCTTGCTCTGAGAACGGCAACAAC
ACGCGTTATCACTATGACCAGAAGGACCGCGATTTTCTGGTCAACATGGCTGGTTGTGAGTGGGGCCGCGACTGCTGGGG
CGAGATGTACAACTACCGCGAGTTGAGCTACTACCTCAACCGGTCGTGGTGGGAACGATTTAAGGAGGATTTCCTCTGCA
TCGTTTGGTTCAAGCTCACTGGTCGAAAAGTCAAGCTCTGATCGGAGAGAGACATCCTAAGACCTTTCTTTGACGACGCA
CGCTTGAGCTTAGCGCTCATACGACCCTGACGACGTTCTAGTATCAAACTCATACTCTGGGTATTCTATCCATCTTCTGA
TCTGAGAGTATATTTCATTTCACGAGGAAGTGGCGTTGCATTTGGAGGTCGCCTGTGCATCCCTTTATTGTCAGTTTTCG
TTCAGAGGCATCTTCTGTGTATAACACGCCTTCGTTTCTTTACGACACGAGGTTGAGGATTCCTTATGGAAGCACCTCGG
GCTGGGAGGGGTCAAGGTGTTGGCGTAGACTTGAAAAGTCAATGCAAGATACCATACCGGGTTTCTATTCATTTCCCCGT
TTAACCTCCTGTTTTGTTTATTTTCAAACTGTTCCGACTCGTTTGGCTTTCGTCCTTCCCATTTTTGGGAAGGGAGAACG
GGACTCCAGGTGGTAGAAGCAGCATGTGGGGTGCTGTTCTCGAACGATTCCATTTTTTCTCACTATTCCTTTCAAATGTT
ATATATATTTTTTTGACTCTTCCGTCTTTTTACTTTCTTCTGGTCTGGATGGTTTGTGTGCGGCCAGCCTGATTTGGGGT
GTAAATGCACAAAGGAGTATGGGTAGGAACAATATACAATAGAGAAGACGAACATTCTGTGCTCTCATGGCACTCGAACA
ACGAGATGACAACGTTGCTGAACAGATTGATCGGCCGTATACAACGTAAAACATTATTTGGTGGGCGCCAGGACGACGGT
TCAGAGCAGCCACTACACGATTCTAACCCGACATTTAGAACTTGTCCTTCATCCTTGTAATCATCCTTGTAATCATCCTT
ATTCTCGGGTTCATTGGCCCACCGCACAAGTCGCAATGATGCTTTCTGACCAGGCTGCAACATTCAAAGCCCTGCCTCCC
ACATCGTTGTTGGGCTCTGCCGTCCACAGTCAGGCAAGAGTACTCCGTAAGCAAGCGTCATATGCACGGCTATACTCCGT
ATACATCAAGTTGTCGAACATCGTAAGGGGAAAGGAGACACGCGTCCATCAGTGGGGGCGCATACGATTACATCAAAGAT
GGCCTGGCAAAAAAGGGGGCAAGAAACAAATAATCTGGGAGACCAAAAATGGGCAGGCAGATAAGATATTAGATATACTG
TGCAGCGGGAGTATACGCGTAGTATTTTGAATTTTTAGAAGACATACGTATGTCGTTTCCTAAAACACACACAACACAAC
ATGCGTTGCCCTGCTCCCAGTGGCATAATATCATTTGTTGCAGAAAAAGTATTGAAGTCCGCTGTTGTGTTTGATTTTCA
GAGGCTGTGTAAATTCTTAGCCAGGTGTTGAATAGCTTAGTTCGTATTTTGTCCAGCTTAAGGTCGCTTGTGCTTCTGTG
ATATCACTGATCCTTATTTTCCTTTGATCATCTTCTACCGAGCAAGACATCACACGACGCTATCGGTCAAACAAACCTGC
CTTGATTCCAATTCCTACTGCCACTTCACGAAGGCCGTTAAGTAACCTTTACCAGCTTTATCGGAAACTACATTAGTGGA
TATATACAGCATATATAAGCTTGAGGACTTGTTTCAAAATGGAAACAATTTCTCCTATTCTCCTCCGGATTTTGTAGGTC
TGAAAGGTTATTTATCTGATAAAGAGTACAGATCAGGGCAGTCAAAAAATTTGCAGCCTTTAGCTGCGATTGTAAGGAAG
CGGGTTATGCGACAAGCTGACTGGAAACCTACAACGAGGCAACATGGCACAAATAGACGTGACCACGATATGTCGCTACC
CTGGCTTCGTTTCGAAGTGAGAATCACACCATTAGATAAGCATGTGGTCCATTTTAACCTAGCCACGCTGTCCAGCATCT
CTTCGATCCTGGCGTACAGCATCGTTACAACTAACTCTTCAGCTTTGTCACTAGCGGCGTTTCGTTCACCTCGCTTACCT
TGTTGTTCTTGCTTTTAAATACACCTCTTTTTGTCTTGTCTGTTCACACTTCAATGTTTGGGACATATCAACAGGTCTAG
TGGCTTCAAGAAGAAAGCATTAAGCATCAAATTTAAACTGCATAAATCTGTACAAGAGAAGTGAAGGTTGACAGTGTCTA
TATGCAAGGGGAAGTTGCAGCGTATGTCACAAATTGCCGCCACGAACATTTTTTCTAAACGCCGGAGAAATGATGAAACC
AGTGAGATTTGATAGAAACTATGCCGTGCAGCGGTAGTGTAATGGTGGAGGATGTGAAGTGAGGCATTAAAGAGGTGCGT
TTTGGTGGAGTGGGCATTGGATTGGGTATTGGCATAGGCTGAGATTATATCAACGTAGGAAAATGGGGGTATTAGGTCAT
GAGGAAGAGAAAGAGACATGCGAATGAGAGACGTGGGGATCTGAGGGCAGGCGTTGCTTCATGAAGGGAATTTGTTGAGG
AGCTCGAGGATATAGCAGGAGGAAAAGGAAGAGGGTTATTATGCCATAAAGGGAACTGGCTTCACTGGCGTCTGCAGCGC
TGCCTCACGCTTGGAACTGGACGACTGCTGGTAGACCTTGATGCTGTTGATCAACCAGTAGGCTTCCGTGAAGGCTTCGG
GGTTCTGCTGGACGTATGTGGTACAGGTGCTCGCCTTTGCCGAGCAGGTTGCATCCTCGCTCCACACGTTTCCGGCCCAG
TCGCCACAGAGATCTGTGTTGATGACAATCTGGTGATCAGAGAAGAACGAGTCGATGTCGCAGCCAGAGAAGCGGGCGGT
CGGAGTGCCAAATGTGGAGCTATCGGGGGAAGCGGAGCCGCTGGTAAGGGTCGATGCTATGGAGCTGGAGCGGGAAAAGA
ACCACACGGAAATGAAGTCGGACGTCCACTCCATGGCATACACACCGCCGCCATTGTCATTGAAGCCGGTACCGTAGTTG
TTGGTGTCCGTGGTGGATTGTGCACAGCCATCATAGCCGTCATCGGAGCCACAATCGACAGTTTCAGTACCAGTGGTGAA
TTTGGTGGCGGATGATGAGCCTGTGTTGCTCATGGTGCAGCCCGAGGCTGTGTGCAGCGTGATCTCGTCGGTGGTCTGGC
TGTTGACTCCCTCGATGATGTCGATCTCACCGCCGCTGGGCCAATTGGGGCCCAACGTCCACAAGGCGGGCCAGACGCCG
CAGCCGACGGGCATGTGGACAATGTCGGCTACGAAGAGGCCCTTGGTGTAGGAGCTCTGGCTAGTTACCCGGGTAGACTC
CCGACCGCTGGTGGGGTCAACGGTGGTGTGGTCAACGCCGAGGTAGACCATGTCGTTGACATAGCCGGCAAGGCCGCTGC
CGCTGGCTTCGGAGGCTGTGGTATATGTGACGAAGCCATTGGTGGGGTCCGAGCTGGAAAAGAAGTCGAATGTGGAGAAG
AAGTTGGTGGAGTCGAATGTGTCGACGAGAGAATAGGTTGTAGCCTGGGCTGAGGCAGCCAGCAGGGATAAGATCAGGGC
GATAGATCTAGAATGCATGTTGTTGATGGCAGATATGACGTGCCGAAAAAGCGGTCTGTTTGAAATGGTACGAGAGAAAA
AAGGTTCAAGTGGAGGGTGGAATTGGAGAGTTGCTGCTGTTATGTAGTCGCGTGCAGTTACCGTTGGAAAGGACGACTTC
GCCCTTTGTTCGTGCACGAGGTCGCTGTTGTCGAGGTTGCTGTTCGGGTGGTGACTTGACTGTTCAGTGCCGTCCGTGAA
TGGACAAAGGCAGTAAAAGGGGTGTTGTCTTTATACAAGTGAGATAAAAGCTTATAAGGAACCAGTCCTACGCAAGCCAA
GGTATGAAGCGAAAATCGAGAGGCAAGAAAAGCCATCAACGTTCCTGACGGTGTGACAAATCTCTCCTGTTCTTCGTTAC
TGAAACTGAGGATGAGCAAAGCTAGAACTGGCCCAGCCACAGTCAACGCCGGCTAGTAGGGGTGAGAAAGAAAGACCACT
GTCCCAGAGTCCTGATAGCCTCGCCTTCCACAGGCACGAGAGGCTGGGGAAGGAAGAAAGTGAGAATTAAGCCCAAAGCG
GACACAGCGGAGGCCGTAAGGAAGAGAGGAATGGCGACAAGTTAGGAAGCTTAGCACGGTAGGTGAGACGGAAGCATGCC
AGAGGTGGGTTCTAGCGTATATGTGCAGCACAAAACGCTTTATATGAAAAGAGAGGAGAAATCCCGCCGGCCACTGGAAT
GGTGAAGGGTTCAAATAGTAGACGCAGAGTTTCTCCACCTCCACAGCGACCACGCTAGCAGAACATCTATTGCCATCGCT
CGCTGAGGATGCTCGGTCTGTGAGACGTCGCCCGAGTAGAGAGGCCAGAGAGGAGCCGTGGAAGTGAATAGCCAGTTGAG
GCCCAGGAGCCATAATGGAGGCCTTGCAAGGTTAAGGGCGGCTGGATGCCGGTGTCATAAGCGCCGAAGGTTTTTCTTAA
AGAAGAAGCCAAATGTGGGACGACCTGTCCACGGAGGCGGTTGTGCACGCAGGCTGGCTTACGCTGCATTCCAGCCATAG
CCTCTGATTGCGAGATCTGGATAATAGTCTGCGTTCCAAAGCTCACGGGAGACGAGGCAGAGTCCAGCCATTCTGCAACG
CGAAGTGATATTCAGGCACACTGACTTATTTGGATGCATTCCAGTTGGAGAAAGTGGGGCTTCTTTAGAAACAGTTGGGA
GGCGAACAATGACTGGGCATGGACGAGAGAGCAAGTTCTTTGTATTTGTTTCGTGAAGAAGCTGAATAGCAAGAAGATAT
TGATGTTCAGCAGGACAATAGGTTGAGACAGCGCAACAGTGGAAACAGGCGAGTACGAGGAAGGGGCGTTTGAATCGGGC
GTACAAGGGAGCCAATCAATGGGACAAAGTGACAGCCGTCGTACCTGCCGCTGTAGGGAGGGAAGGAGGGGCAGGCGAAC
AGTGTCAGTGACCCACTGTGGGCCAGTGCACTGTCATATCTGGTTAGGAGGCGACCGTTTCTACTCTGTAAGGAGTACCT
TTTTGTGCTATCGTTGGAATGCAGCACTGCCAAGCCCATCGTCAACCGTGGCACTGAAACTGCCGGCTGTGATCCGGGCT
AGATCTGAGCTGCCCCAGCCCCCAATCAACGCATCTTGCGCTACACTAGATGCGGCCGCCAGGCGGTTGACAGGTGACGA
TGAAGGCAAGTGCTTGCGTGTCGCCTCTTGGGCGGGCGAGCACATGGCCATAACGGCGGCTGCATAGAGCAACTGGCGGG
GACAGGTAGACGACGACGCCTTTTACGCGTCGGCCTATCTGGATTGCTCGAGACGAGGCGAGGCAGACGCCTGCGGAAAC
ATATCGGATGGTGACGGACAGATCTCGCTTAGACTTGGCTAGTGACGAGTGACAGCTTGGGGAATAATCGTCCTAAGTCG
GGTGGCAGGTTCCCAGAAATTCAACTAGAGGCCACACGAGCAACTGGTAGACCTGGGACAGCCACGAAACCCACGATGAC
TTGGGCCAATACATCAGAGACGCCTCGTAGTAGCACACAGTGATCTCAATATGTCCATGGCAGTACGGCCAAGACGTGCA
ACCGCTTGAGCCCGCAGCGAGACCAGGCTGGACTATCTGTCTTTATCATTCGTCGGCTGACCGCTGGCGATTCTTGCCCA
GCAGGCTAGCCAGATCTTTGAGAGCAGACAGAAATATGAGGCCGATATCCAGAACAGCCGCTGTGTCAACCATCTAGACA
GTGTTGTTTGTGCTGGCTGTAACTATGGCTGCTTCAGAGCTCTATCTGCAAGTATCACGCTCATATGCCGATGTCGATGA
CCACTTCTGGACTCCCCTAGACACAGCTTGCAGCCAGGACACCACGACACGGCAAAAACTGTGCCTCAAACTCAATATCT
TGAATTCCCTCTCTTGTCCGTGATGCTGTGCCTTTTAAGGCTGAACTCCGCCTGACTCAGTCTCACTCTTTTTTTTTTTT
TTTTTTTTTTTACCTCCTCTTTCTGCCAGGCGGGTTAGCCATGCAGTGTTCCTTTATTGCCTCAGGATGCAGAGACTTAT
ATTACTTGCGCTTAGGTATACTTGACAAACACTATTCTACCTCTTTTCGACTCGAGGTACGCATGCTCTACCATTGATGT
CTTTACGCATAAAACTGAATGGCGAAGGATCGCGAGCTTTGGTCGCAGCCCCGACACAAAGAATACGGTGTCTTTGGGTC
GTCCTCGTCGATACTGTGGTAAATTTACGAACCCCCCTTCCCTTACCGACATAGCAAAGCAGGTATATCGTCATGTTTGT
TTCTCGATTCGACAATGTCGCTTCTGGCTGTCCCGTCGATTTGACCGTCATCCAACAACGCCAGTTGCCGGTAGTTCAAC
GGCCTCCTCAGAATTTGTCTGTGCCCATCGAGCTGATATCCAGAATCAACGGCCTCCTTGAAACTTATGAAAGACTTTCG
TTCAGCCTGGCCTGCGTGTCCATTTTTTCCCTTTGCCTCCCCCCAAAAGAGGAGATTCCTCGCAAACATGTACATAATTT
TCTACTTTGCTTCGAACGGGCGCCTTCGAATCTGCTCTATTGCCACAGATGTGGCAGGCTTCATAAATGGAGCCAAGAGT
GGCGCAATCAACTAAACTCCACACAATCACCCTTCGGTCAATCTGAAGGTCTTATTCCGGCGTGCACGCTGCGGGATACA
GTTCAAACAGAATGGCGTGCAACACTGCCATATCACCTGGCCCATCTGGCCATTAACCGGCAATCAATGGGGCCCAGAAT
ACGGTATTCCGTTGCAAAATCTGGACACGAAGCACATCCAAAAATCTCAGTCGCCAACGGGACTACGGATTTTGCAAAAA
CCTGCCACAAAATAATAAAAGGCCAGCTCTCTCAAAAGTCCACGTTGATGATAGCCTTTGGGGAGAAGGAAGATTTGAAC
CTTTGAAAACATTTCTCAAAGATGATCCCGTTTCGTTTTGCGCTCATAACAGCAGCTCCAAAAAATACCTTGATTTTATC
TGGCCTTTTTCTAAAAAATAAACGCCATATATTACAGACGGCCGCACACTATTCCACCTCGCCAGGTTCAGCCTCACCAG
AAAAATGAATCGTGCAGAAACTGCAGCACTGATCAGTTTCTGGACTTCGTTTTCCCCAAACTGGATGGATTTCAAGCTGC
CAACATATCGTGCCATTTCAGTACAGAGTCCTTCCGACCTGGCTTAGAAGGCTATGAAAGGAGATAACTCAGGACGGTCC
GAGTCTTCAAAGCTACTCGGATGGGGCTGTACGGTTAGCGTGGAAGGACTATGTGCACTATGAAGAAGCGTAAGGGGCAT
GGGCTCTTCTCTCAGCAGCCTTCGTGATTTGAGCGTATCGCTTTCCGATCTCGTCGGAAACTCCAAGCGGATATCGCAGG
CGGTAGACGAGAAGGAGGCCGGCAGTCTTGTACATTCGGCCTTGTGCCAGCAGGGCAGAGGTCTCAACAGGAGTGTACTT
GCAATCTGATGGAAAGTCTGGTTCTCAGGAGCGAATCTGGCGTTCGAAAGAAGAATAGGCGTCGTCGTCTCGTCCCTGCT
TGTCAGTTGAGGTTGTCGGTATCGGCGCAGGGGCATGGACGCGGTAGCTAGCAGCGCATAGATCGTAAAGTAGTGGAAAC
TGCGACGTTGATATACCCAGGAACCGGTCAACCACTAGATGACCGGCAAGGTGTAGCCGTAGAACGGGAGTCTCACGACG
AACGAGGCACTGGACTGTGTCAACGAATACGGGTGTCAAAGTGGTTGGGTCCCATTCAGTGGTCTTCAGCAACACCGGAT
ACTATTCTCTGGCTGTTGGAAGCGCGCTGCGCACGATGATGTGCCTGCAAGGCTATGAGATCAGGACGTTGTAGACGAAC
AGGACCTGGCCAAGCATCAAGACGAGGGCGGCGTCTTCGACGCTCCCCAAGGTTTCTGGAGACCGGACAAGCTCTCGGAG
ACAGATTGCACCCATAGCCAGGTCGATGAAAGCGGAACTGTACCTGTTGAACTCTGGGCTTTGAGCACTGAGCATGTCGA
AAACGCACTGGTAGGCATTGGCAAGGACGAGAGGCGAGTGGCCGAAAAGCCGCCGGACGGTGTGCTGGCTGGTAGTGCGA
CGACAGACTCCTGGCAATCAACCTGTGGCGATGTAGACGGAGAAATCCATCGTCTGTCGTGAGAATGTGCTGAAGCTGTT
TGTAGGAGGTGCCACTGATCCCATACACCATCTTGAGATGCAGAGCCGGCGTTGGATCTAGCTGTGACCCACCGGTCCTG
CCTTTGGAAGAATATCTATTGGCTGGTTGCTGACCTGATTCTATACTGTTGCAGGTAGAAAGGCTGAACAGTCCAGAGGC
CCCGTGACCAAAAGTTTTGATCAGAGGGGGCTGGCCAATTCGCTTCCTGGTCCTTGGATGACAGGCTTTGCCTAAGCGAG
AGCATCTCGAGCAGGCCTGTTGGCTGCAGTCCCATTGACACTTCTCCTTGCTCCGATAGCAGGCTGCACACGAACTTATG
GATTGACAGGTCTTCATCTCTGTGCAAAAGCTGGCGTGGTTTGATGCCTCCGGAGTATCTGATTCCAGCCTTCTGATAAT
GTGATCCACTTAACCGGAGACTTTTTCCCATTTCGGGACTAGCATCAATCACAGCCACGGAGGATATAAGTCCTCGTTGG
GGCCGTGTTCTCGAGTCAGCAGAGAAACTCATTGTGTTGTTTATATTGTATTCGGTTGACACCAATAACAGCCCATAATG
AGATTTGCTAGTAGGTATATCAGTCCCATCGAAAGCGAAATATGACTTGCTCACAATGCTCTTCAAACAGGCCCCGATGA
AGTGCGGACGATCGTCCGCGAGGATCTAGGCTTCTATCATTCTGTTCTCGTCGGTGGTATTTACGAGTTCGAGGATGCGA
CATATGGCTTCATCAGATCTTTGCTCTTTGTTTGGCCGCTGAGATACTGCATCGACAGACATGCTGCCTTGGCAGTCGTT
GTCAAAGACAGGCACACGGAAAAAGCATTCTACAAGCGGGCGCCCACGATGGACCTGACCAGCCACATTCAGATTGTCCT
AGGCGAGGACGAGGCCGTGGATAAATTGTCGAAGATTGAGCAGCACTACCTGTCTGCCCTCGAACTCCCATGGACTTATG
CTTATCCGCCCTGGAGAGTGGTGGTATTGCCGTTGTCTGCGGGATGCTCTGGTCAGAGCCATTGTCTCATTACGTTTGTC
TTCTCGCACGCTGCTCGAAGCGTTGCACAAGCCCGTCGAAGCCGAGCAGACAAAGTCCACGTTGCGCATCGCACCAGACC
GGGAGCTGGACCTCCCGTTTGACACATCAGAACGATTTTCCATATCGTGGGGCTACCTCATAGCACCGCTTCTAGGCGCC
ATTCTTCCAAAATGGCTCGGTACACTGTGTAGTCTCAAGGCGGGTGTGGCCAGGAACGACGCGGGCACATGGACTGGTCC
TCCGATGTCTATCGATCCCAGCGACCCTGCTGCCACCCGGATCCAGCTGCTCGAGATCGGCAGCGCGGATGTAGAGAAGG
TACTCCGCGTTGCTCGAAAGTACGGCGCCAAGCTCGCGGCCGTCATGCACCAGCTGATCATCCAGGCTCTCGACAAGGTG
GTGCCAGACTCAAGGTCACCAACTGGCTGTCGCACACGGCCGTTAATATGCGGCCTGAAATTGGGAGCTTCAGATGATGA
GATGGGCCTCTTTGTCACCGGCTGCTTCCAGTCGCACCCACGCGTGAACGAGTCGTCACCGCTGTCTGAAGCCGACTAAG
CTACCGCTCGCCTACTTACGGAAAAGTTGGCTCTGGGCGCAACCATCACGGAAAACCAGCCCATAGGGCTTCTGTGCCAT
GTGCCCAACATGCGGAAGTGGACGGCAGGATTGATCGGACAGCCGCGTGATGGCTCCTACGACGTCAGCAATTTGGGCGC
GTTCTCGGACGTACAGAGCGGCTCCCAGAGACCATCAGTCCGGCGCTGTGCGTTGACGAAGATGGTATTCTCTCACTGCA
CTAGTCCTATCGCCGAGCCTTTGGTCTTGAGTGTGGTGAGCGTCAGGGGAGGAAGCTTGATATTCTCGGTTGGCTAGACG
CCCGGTTCTTTGGGAGTACCCGAGGTATCTGAGCCTGAGTTTGTGAGAGAAGTTTGTGCGTCTATACGTGAGGGTTTTAC
CCACTGGAATAACGATCCGGACGAGAACAGGCAGCACAGCTTTATGTAATACGCATGGCCTTTCTTTGCACTATCTGTTG
TCGAGCATAGCCAAGCCGGCACTTTCATGTTGAGCCACAATTCTCTGGAAAGCAAGATTTACCTATATTGGTTCTAGCAT
AATAATTAGATTTATTATACAGAGTAGTATTGTCAGGAAGTGTCTAGCATAGATCTCGCGAACTATGACGCACCCCGAAT
ACTACGGCCAATATTCTGCGACGGCCCTGGCATCATTGGGCACAAAATCGGTGACCGGGTACAGCTACCTCGGCTGTTCC
ACCAACGGAGCAGTACTGATCTGAGTATCCTTAGACAGACATGTCTTTGAGATGATACTAGGACAACCAATGGCAGTATC
TTGCGTCAAGTTGACGGCGCCAGATGACAGTGATGCAGACGACGAGGCTGGCGGGTCGCTGGAGACAGAGACAGCATACG
TGGTCACCTTTCTGGTGCGTCGAGTGGAGCATGTCGGCACAAGTCGGAAGCAGCTACACATAACAACACACGCTTTCTCT
GGGCACCCATAACTCAAAATCATCCCCCTGTCAAATATTGGAAACAACCCCCACTTATCTGCTTGGCTGGTGGCTGCTTA
GCTGGTGGCGATGTGCAGGCTGCGCCCCAGGTTCTCGTGTGCCTTCATGGTGCCGATGCACTCGCCCGTGATGGCGTCCC
AGATGCAGATCACGCGGCCGTTGCCGGCCGAGGCTACAAAGCACGCCAATAAGACGCCTACAGTTTCTTTTCTCTACTTT
TCGAAAATTGGATCGCCGGATCCAGGCGGTCACTGATACGACACCAAGCTAGCCATCCGCTCGCTTGGCTACGGCTCTGC
TACCAAGGTGGCCATCAAATTTAAGCGTGCCTGGTGGATCCACGATCTGGGTAAGTACAGCATCAAGTTTGGCGGGTTTA
GCTACTCCGATATGAACATGCGCACGTGCGTGTACCCGTCCTACAACATCTGTGACGACAAAATTAAGACGGCCGTGCTA
CTCTGCTCCTACAGCTGGCAACAGGATGCACAGCGCCTGGCGGCGCTTGTCTCCAGCAGCAAGGACCACGCGGAAAAGGT
CCACGCTGAGGCCGAGCTCAAGGAAGTGCTCATCCGCGAGCTCGTCTACCTGCACATAACGATGGTATGGACGACAAAGC
GCTTTACCGGCTCATGAGCGACAACTACGTCGACCACCACGCCTACGACTGGGGCGCAGACCCGACGACGGCCGGTGCCT
TTGCCCTCTTCCGGCCGCAGAAGTTTAGCACCCTGTGGGAGAAAATGATTCGCCGGACCGGAAACGTCGTCAATGTCGGT
GAGGCCACGAGTCCCCACATGCCTGGGTTGTCGGCGCGCTCGAGAGTGTCGTTTACGGCGTATACCACTGGCTGGACCAG
AAGAGCTGGGAAAACCCCTGGTTTTTGAAACCGATGGCGATCTTAGAGAAGGAGATACCCGGGAACCCGTTTGTGGGCTT
GCCTCCTTACATGGATGCTAACATGGTAAAATGGAGCGCGTTGCTGAACATCCTGCTCAGAAAGCAGCATGAGGACGAGG
AAAAGACAAAGATGGGAGGAACGCCCTGCGCAGTCGCAGACTTTTTGAGTACGACTTCTCTAGGTATAGGAGGAAGCTCT
CCTGTCTAAGACTGTTGCTTGTAAAAACATGATATGCTTGACAGCGAGGCACTTGAATAGGCATCCGTTGGCGCGGAGTA
CTGTTCCACTGTTGATACCCGCGTGCACTATCACGTTATGTGATCTGTGTGCATAACAAAAACCACGGCTGGCAGCCTTG
CTCTAAGCATATCGCTCGTAAGATTATAGCTCGTCATAAATATCAGTATACACGGAGACCCAGTATATAGCAGCCCTATA
GCTCATCCAAGACTAGTCTATATATATTGCCCGCTTTTCTTTTTTAGGTGGCCTCACAGGTTGCATTCTCATTATAGCAG
TCGCAGAAGCCGGGATATCCATAATGCCCCCCTAAAAAAGCATGTCAAGAACGATTACATTCTTTGGTTCTTTTCTCAAC
TAAGACAATTGGATAGATGCTTACACCTCCAGATAAGGCTGGATAGCACTGCGGAAACAGTTGGCCTAGTTTTTGTCACT
TCGGGGCTTGTAATTTAGGATTGAGATATATCCGTTTGGGAGTATCGTACCCTTCGCAATCGGAGCGGATGCAATAAGCT
GCCCATCTGTCAGTGCTGGTTTTGTTTCGCAAACGGCATAGCCGAGTTGGAAATTTTACTTTAACAGTAGAAGCTCTGTT
TTGACTACATCCAGAAGAGAAATCGAGTGTTCTGTAGGGGCTTGTAAATGTGCCGAATGAGAGACATTCTGAATGACGTT
TGAAGTTTTCAATATTTCCCCAAAGAATACTACCCAACCACTATCCTAGATCCAACCTGGATGTCTAACTGAGTCCTGAA
ACCGAATGTTCAAAACTTGGTATGATCCCGCTCCTCAGACAAGGACACCATACTCGACTTAGCCAGTCTAGGTGGACCTT
CACCAGGTGGAAAGGGCGCAAACTTATCAATGAGAGCATACATGTCCAAGTAAGCCCTATAGAAACGCTAGCCGCCTGGG
TGGAGTTTGGGTAAGATTAGAGGATACTCACCTCTGACGGACGGCTATTCCATGGTCGAGGTGATTCACAGAATATATGA
CATTGTAGTAGATGCTGTAGAGCTGATTTCTGTCGTCCCACTCCTCCCGGGGTTCGCTAGGCTCAACATGGCGCAAGTAC
GCACTCGTGTAGTCTTCGTCACTAATCCTGTTGTAGTAGCAGCGCCAGCTGCCGATCTCCATCTCGTTGTGGGCATAGAA
TGCGGCTGAGTCGAAAATGAAGACTTTACCATCCTGAAGAGACGTGGCCGTATTTCCCTCCCAGAGATCGGAGTGAATCG
AGCAGGGCTTGACAGTGCGTCCGTTTCGCTCCAGCGCGTCGAGCAGTCGGGGAATTACGTTTGCGACCAGCCTCTTTTCC
AGTACATCGAGGTCTTCCCAGTATCCATTTACATCGGCGTTCATATTAGTCACGTGCTTGAGGAGCTGAGTAAAGAATGC
TGTCCAGCTTCTCTGCCATGCTACTGCTTGTGGCACCCAGCCCTGACAAGTGGTGACATCGAAACCAAATTGACCGTTAG
GAGACTGGCTCTTGAAGTGGAGTACCGCCAGTTTGGAGCAAAGCTGATTTGCATCTGGCATATCTCCTGTGTTCTCAATA
TATTGTATGATAAAGAAGTAAGCCTCGGGACTTGAGAGAGAATATTCGCCCCAAGAATGTGGCTTTGGGACCAGTTCGGG
AGCCCATTTGAACAGTTCTGTCATAGCACTGTATTCGCCTTCCATCATGACGCGGCCATGATATCCAGGGGCTGACTTGA
GGAAGTATCGCTCCTCAGAGCCGTCAGATAGGCGAAGATGCAGCAGGGCAGTATTGGTCCATCCTGACGAGCGAAATCGA
CTTGCTGATATGACTATTGTGCCTTCCGGAAACTGTTCCAAAACACTGTCATCGACACGAAATCTACCCTCGTAAGGGAG
CCCAACTCCGTTTGAGCTGTTGATCAAGAGTTGGAGGGCACGGCTCATCCCGACCTTGCTAAGACTCCAGACTGATGTTG
GTGCGGTATTGTAACAAGATAGATTTTGACCGTAGTGAACAATTACGGCCATCTTCTTTCGCCATCAGCCTTTGACTATC
GAGATTATATAAGGTAGCATCAAACACGCCAATAAGATGCCTACGCTTTCTGTTCTCTACTTGTCGACAAGAATGGATCG
CCGGATCCGGATCGTAACTAAGGTACTTTGCAAAGCGATTGGTGCAAATGCAACGTCACGGAAAAAGGGCTTAGATTATT
GATGTACAACATGCAAGGGGTCTTGATGTGTAGTTGGATCCTTCAAATGGCAACAGTGTTAATATGACAGCACGAACAGA
GTATACACAGTGTAGTATTCTGGCAGCTTATGGGTCACGTGATTATGCGGAAGCGGTAGAGACGGCTGAAGTGTCGGAAA
CCAGAGGAATAAGATCTGGAAAGGCGCAACTCTTGATCACACATCATACGGACATTTGTGGCCTAATGACCGCACTCGAA
ACATAGCGCTAGAACCGTTACAAACGGTGTTCGTCGCTAGTGGTCCGCCACCATCCCAGCGAAGATGGTGTGTTTGCTGC
GGGGATCAGATTCCCCGTGCTGTGGCTCTACGTCGTACGGAGTACTCTGGCTGACTTCACCAAGTTTAGTCGCATTCGTT
CGAGACGGCAAGCAAGGGATGAATCCAACGCGCAACCACCTACAAACAGCGATCTTTCTTCGTCAACAACATCATGTGGC
CTCCCAGCCACAGCAGGTGGGACTCAGCTGGCACCAACGCTAACTTTTGGCACTCTCTTTCACCGAAGCTCCTCGACCTC
GACTGGGGACGAAGACCCAGGCCTCGGGCTTCGTGTCCTCCACAATCCCGAGGCTCCCTCTGTCGATGTCATCTTTGTCC
ACGGCCTCGGCGGGCACAGTAGCAAGACGTGGTCAAAAAAACATGACCCAAAACTCTTTTGGCCCCAGCTTTGGCTGCCG
TTTGAGCCAGAAATGGGAACGGCACGCATCCTCACGTTTGGCTACAATGCAAACTGGCACGACTCTTCTAACACTGCTGC
TAGAATTGAGGATTTCGCCAAAGCACTGCTTTATGAAATGCGCTTTGCCCAAGACGGCTCTGGCAAAAGCCTTGGCATTG
GATCCCACCCCCTTCTCTTTGTTGCACACAGCATGGGTGGACTAGTCGTAAAGAAGCTCGTTCTTCTCGGCATCCACGAC
GAGACTTACAAAGACCTCATTGCATCCGTATCCGCAATCATATTCTTGTCCACCCCACATCGTGGCACCCACCTGGCCGA
AACACTGAACCGATTGCTGGCTGCCTCTTTCCAATCGCCCAAGAACTTTGTCTCTGACCTCGAAAAATGCTCTCCAGTCA
TCTCAGATCTGAACGAACAATTTCGGCATTTTGCGACGAGATTCTCCATATGGTCCTTTTACGAGACCCTCGCAACTACC
ATCGGTCCTAAGAAGATGATGGTTCTTGAAAAGGATTCGTCTGTACTTGGATATCCCACCGAGATTTCTAAACCTCTGAA
CGCAGACCACCACGATGTCTGCAAATACTCCAGCCCCTCTGACAACAATTACATTAACGTCCGAAATGCCATACGATCTC
ATGTATTGCTTTATCGCAGGACAGACCGGGAAGAGAGTAAGAGTGACCTGGAGACAGAGGATATCCAAGAGCTTTTCTCC
GACTGTCCCTCTTCTGACGGAGACTACAACACTCTTCAGCAGAAGCTAGTTCCTGGTACCTGTGAATGGTTTGTTCGACA
GCCTGCCATAAAATCCTGGATTCGGCCATCACAAGAACCGCATGTGGCTTGGTATCACTCCAGCCCAGGCAGTGGGAAAT
CGATGCGTGCGTCATTTTTGATCAAACACCTGACGGCTTCTGGAAGCGCCTGCCAATTTTTTCTATTTAAATCCTCTGAT
GCAGCCAAACGCTCCGTTGCCAACTGCCTTCGCTCGCTCGCTTGCCAGCTTGCGAGGGATTTGCCTGCGTTCAAAAATTC
ACTGCATACAGCATCGCCCCATAGCCTGGGCTCTGGTTCCCCAGAACCCTTGCTTCTATGGCAAGATATTTTTGAGCGGC
GCCTGTTTCAGATAAAACAGGTCGATCCTGTCTACTGGGTCATTGACGGCCTGGACGAATGTGACTCACCAAAGGCTCTG
CTATACTGCCTACAAAACCTCGCGGAATCCAAACTGCCTATCAAGGTCATGATCATGAGTCGCAATACGTATGAAATTTC
GAGCCTTGTTAAGCGGCTATCCCACAGTGTTTCTCTCTCATCGATCGAAGAGAATGGGATGGTAAACACGGAACAAGACA
TACGGCTTCTTGTGCAAAACGAATTAGAGTATATACGTGGCAGTCAGACCTTCAAAGATGATCTCCTTCTCAAAATTGTG
AGTCGCAGCGAAGGGAACTTTCTTTGGACAAAGCTCGTTCTGGACGAAATTCTGGACTGCCACACAGAAGACAGCGTCAA
GGATGTTCTTGCCGAGGTCCCCGACGACATGATGCTTCTTTACAAGCGCATGGAGCATAATCTTGTGTTATCGAAGAAGA
AATCCAGCCCGTCTCTTGTGGCGTCTATCAGAGCTATTTTAGAGTGGACTACGTGCGCCCAACGGTCGCTCAGTGTGGCT
GAGCTCTCACAGGCATTGAAAGAAGAACTTCCTGGGCTTCTGGATCTCAAGCGGACCATCACGGATATCTGCGGCCAATT
TATCTTGGTGGATAACGAGGACACGGTTGCAATGGTTCACCACACAGCTCGCGAGTATTTCACAGGCATGCGAGGTAGTC
GATTCTTTATCGACCCTCGCCTGACGCACAAAAAACTTCTAAGTAGAATGTTACAAGTGCTCGAGGCACCGGCTCTTCCA
CTAAAACTGAAACAATCCCAGCATGTCCTCAGGACGAAAGAGCCCTTTGTATTTTACGCCGCCATCAACTGGTCCTACCA
CCTCGAGCATTGCTGTACAGCCACTTCCCACATCGAGGTTCTCCAACTCCTCGTAGGCTTTTTTAGAAGCTCTGCTCTGC
TAAGCTGGATTCACACTCTGGCTCTGGTTGGACGACTCGAAATGCTTGCAAAAACGTCGAAGGCATTGTCGTCTTTCACA
GGAAGGACGCCTCAGATACATAGCTGCGAGGATCTCGACTACGTCGACAGTTGCGCCAATGATCTTCTGAACATTGTCGG
AAAGTTTGGTCACAACATCGGAAAAGACCCCATGGTGATGTACGACATCGTTCCGGCCTTCTGTCCCGCAAACTCGATTG
TACACAAACAATTCTACGGCCCACAGTCGTCAAAGATCAGGGTTCATGGGGCAAACAAAACCGGTTGGAACGACAGGATT
GGGCGGTTTGGTCTTCCAAATGATGCTGAAGCTTGGAACATAACGTGCGCGGGGACACTGATCACCGTTCTGGGACCCAA
TGGTGTGATCACCCTCTGGAATGCTATTGACTTCAGTGAAGTCGGTATGATCACACACGGGGAACCTGTAACGGCTACCG
CACTGAGTGACAATGGCCAAAAGCTGGCAACATACGGCCTTGCCACCACCAAGCTATGGGCCATCCCTGCGGGAAAGCTG
CTCTCCTCCACTCAAAATCCGGCAAATATCAAAGCAGTCTCACTGGCATTCGGAGATAATGACGGGACGCTTTGGGTTAG
TGGCGACGACAATGTCGTGAGGCATACACAGCTCGAGTTTCTTGGCCAGGGGTGGCAGGTACCTCATCCACAAATGCTTC
GAGATAATCATCGTATCGTGGGTGCTATTACTAGCTCACCGACGTGTGTGGCGTTTGATGGTGACAGACGATATATGGGA
GCATCCTACAGAGGATCACCGCTCTCTGTGTGGAGGCTTGAAGATGGAAAGCATGTGAAAATATGCAAACGGGCAAAGAC
TTTCCAGCCGGGTGGTATGCCTCAGGCTTCGGCCAGCTGGGCTTCCGTTAAACGTTTCACGTGGAATCCAGTAACAGGCC
ACCTTCTTGGCATTTATGCTGATGGGTGCGTCTTCAAGTGGCACCCCATCACGAACGAAAATGTGGAGGAACAGCAAGCA
GCTGACGAGATTGCCGCAAGCCCGAACGGGCTCTTGTTTGTAACGAGCAGCAGCAACGGCTCTGTACTGATATGGGACTT
TGCACGCTTCAAAGTCATCTGTAAGCTCTCTTTGGAAGACCTTGTCACAGCACTCACATTCAGTCCAGACAGCCGTCGAA
TCTATGATGTGCGTGGCGGATGGGTCACTGCATGGGAGCCCAGCTGCCTGACGAGCTCTCTGGCAGGCGATGAAGTGACA
GAAATATCGGAGGCTGCAAACACCGAGCTTGTCACTACCTTGTCACCCGCTCCAGATGGTCGGACGTACTGCGTCGGCTA
CGAGGACGGGCGCTGTTTGCTTTTCGAAAGAGGGAGATGGCAGGGTACCATCCTGGCACGATTCTACAATCACCTTGACA
TTACGCATGCAGTATGGAGCAGGGACGGTCGCTTTGTGGCAGTAGCAGACCTCGCGGGTGAAATTCAGGTCAAGGCAATT
ATTCCATCCCCGACAGAAGAACTCGAAATTGTGCCGCTTCCAAACCCACAGATCGATCTTGACACCTACAGCATCGAGGA
GCTGCTTTTTAGCTCTGATTGCAAGCGGCTCTTTGTGGCTTCGAAGAAAAATGCCTTTGTTTGCTCTATTGAAAACGGCA
CCCTCGTCGCGCAGGCTAGCCTAGAGCATGAGCAGCCTCGAAAGTGGTTGTGTTACTCCAATCAAGAGGTAATTCTGAGC
TTTGGGGAGTTTGGAGTCGAGTACTACACTTGGGATACGCTTGTGTCTTGCAGCCTTCTTTCCTTCGACGACGATCTGCA
GCCCATAGAGCTTATGGCGAATCGTGAAACCGACCCAGAGACGGTATTTGGGATGGGCGAGTTGCGAAATTCTCTGACAG
AGAATTTTTCCAACAAGTGTTTTCGGGTGGAGAAGGTCATGATGTCTCAGGACAAAAAGCACGCTCTTTATTTCCAGTCC
CGAGTTGGCGATGTTGACGACTCTGATACTACTTTGGAGTTGTTCATTTTTCCCGGGCCGGAGCTTGTCAGACAGGCCTC
GTACTTGTCTTCTTCTTTGTCGTACGTCTGGCATTCTCGAGTTCAAAGAGAAGTTGTGGCCCTAATCAAGGTGCCTCTGG
GAGTACTTCCGAGTGGTCGAACTGTGTTCATTGATAACGACCTGTGGATATGCTCATTTCAGCTCGATGACCCGTTTGGC
ATTGTCAATACCGAGACATTGGTCCAGCGGCTCTACTTCATTCCACGAGATTGGGTCTATAACAGGAGCCTTAGTCTTTG
TTCTATGACTGAGGATGGAACGCTTTTCTGGCCACGCGATGGCTTTGTTGACCTGATCGAGTGTGATATCGATGATATTT
GTATGGGATAATTAGGAAAAGTGTATATCGACCTTTTTTTTTTTAACGGATGCACAACACGTATTCAAACACGAATTTAA
GGAAAGGCGCACGTCGCAGCCGGAGAAGTCCCGCTCCGATCTCGTCAGGGCCTATGGGTCTCAGCACCCAGCTCCAAACT
GGAATCTTCTCTGGTGTCCTATTGCTCATGAGTACTTGACCCCGGCCAACTTGTAGTAGCCCACATTGTCAACGCCAGCG
TGGGCGGGAGGACAGCGCAGGCTCTCTTTGTCTGCACGGCCGGGAATTCGAGTTCATAACCGAGTTTCGCAGTACCTCTA
CTTCTACTTTACACAAGCGTCGTGCCGAGGTACCGGGATACCAGAACGACTCTTCGGGTATGTTGTCGCCGACTTAGACC
CTGTGATCCTTAAGCCGTCGAACGGACCAAGCCCACATGGGAGGGGCGTGCACGATTATGCCGTGTGATGGAAGAATACA
TGTACTGTGTGGCGCATGGGGCTATTTAGTACGTGTTTGGATGCACGTCGGCATGAGCCAGCCATAACAGTACACACAAG
CTCATGGGGCACCCATAATTTGACAAAATCAGGTGTAGTGTAAGCAAATATATGTGTTGTACGGGGTACTCCGTACTCCG
TAGCAGATTCCTATACTCAACACCTGGATACTACATTGTAAAGATGTCGAGTAGACTAGGCTATAATAAGCTAGAAGTAA
GGACTTTCGGAATATAGCGTAATATACAAAGTAGTGCTGAGGTACTTATTTAGTAAGGGATTTTGTTGAAATAAAAGTGG
GCTCTCCAGCTGACCTTTGGGATTAAAACGTTGGCATCCCGAACCTGAATATCTCCAATGCTCCCGAAAAGCCTCACTCT
CGCCTCCCTCCCCCGGTACTCAGTGCCCTCTGATTGCACTTAGCCCTTTGGTCCCACCCTACCGCGGTAGCTTATGGGAA
TCTGCGGCAAGCTACTGCGGTAGTGACACGACAGATGTTGTATGTTATCGCAGAATTGTATTGGTGTAAGTCTAGTTTAC
GTGGGCTGTGGCATGTTCGAGCAAGCTGACTATTTTCAATGACTGTGGATTAGAACCGCAATGACATTATTAATCAAGCG
CAGTATATAAACAGACCTGGCGTCTGGTATAGATTCCTCCAACAGAAGTCATAGTCACTTGTAAAATCAAGCTAATAAAT
GTATTACAACCATCACCGATTCATACTTCAGTTCCAGCATTATCACAACATGTCGTGGCTACCACCAAAGGACTTTGCAA
CTCGTCCAATCACCATACTGGGAGCGGGAGTTCTTGGACGCCGCATTGGTATTCTCTAAAGTCTATTAGTCTCAAAAAGG
TCTAACCAGTCCTTACAGCATGCGCTTGGGCATCTGCCGGGTATGATGTTAAAGTCCGAGGCCCGAGTCTCGAGCAGCGT
TCTCAATGTTTGCAATATGTCGACCACAACTTGGACACATACCTGCAGCAGACATCCGGAAACAAGGGTACCGTTCATGT
ATTCGAGGACGCCTGGCTTGTTATAGAAGCTGTACCAGAGAAGATCGAGCTTAAGATCGCCACGTTCGCTGCACTGGACG
CCATCGCGCCGCAAGATTGTATTCTTTGCACCAACTCCTCCTCATACAAGTCATCTGAGATGTTCTCCAAGGTCTCGGAG
CCGATGAAGAATCGTATCCTTAACGCGCACTACTACATGCCTCCAGCTTGCATGGCTGTGGAACTTATGACAGATGGATT
TACCAACGAAGCCATTTTCCCCTTCTTGTCAGACAGACTCAAGGAGACTGCGGCTTTCCCATACACTGCTAGAAAGGACA
GCACAGGCTTCATCTTCAACAGACTCTGGGCGGCCATCAAGCGTGAGATATTAACGATCTTGTCTGAGGGCGTATCCGTT
CCCGAGGAGATCGATAGCATCTGGAGCAAGCTGTTCAATGGAAAAACGTTGCCGTGCAAACTAATGGATGGTAAGCTATG
GTCTCCTACTGTTGACATTGCATATTTCAAGTGCTGATAATGAGTGGTGCAGATGTTGGCCTCGATACTGTGGCATCTAT
TGAAAGCCATTACATTTCAGAACGTGGTTTGAGCTCGAAGGCCACTGTTGACTATCTCAAAAGCACCTATCTCGATCACG
GCAAATTAGGTTCCATGTCCCCCAATGGAGGCTTGTACCCGCCTAAAGCCAAGACGGAGGATCAAGATTGCACTACGTCA
CCCAGCTCGACTCTGCTCGTTCTCGATGTCGGTCTAGGTGCTGCTGAACCAAGCACAACATCAGGAGAGATTCTTCAAAT
TGACACCAACGGTGAAAACCTCAAGACAATACTCTTAAAGCAAGCATTGCCAGACGGAATCGCCGTCTCTCCATCACGCG
GCAAGTTCTACTGGACACAGAAAAGACCTCCCAAGGCATTATGTACTCTTCGCAGTCTTTGCACCGCGGCAGTAAGAGGC
TCTGTTGCGCGTAACTATGTAGGTGAGTTTGCAGACTTTTTACTGCTGCAGTGCATGCATCCGAGTAATACATGCACTTC
CATCAGAGTTCGCTTCTGACTGCCTCGCCGCCAAAATCAATCACGTGATAAACCATGTGCGGAACAATATTGTGGCAGTT
GTTCTAGAACAAACACTTAACGAATCAAAGTTGTCACTTGCATATGCTTGGATCACATTGATTCTTCCCGGAAGTTCGTC
CGACGCTAGTGAAACAAGAAACAAATGCCAGTCCAGATCTTCCTCTTCGCCGTTCTCCTAATCTTATCCCTTCTCTCCTT
TACTTCGTTCCCTTCACTTCTCCCCTCTCTCGAATCCCTTCTATCCTCCCTCCTCATCGAAATGCTAGCTTCACGTCTGC
CCGCGGCCACTCATACATGACATCGCCGCCGTAGACGTTGGTCGTGATGTTACCAATGCGCAGCTCGACCTCGCCGTAAA
AGGCCTCGCACTCGCGCAGGACACGGCTGATGAGCGCCTTGCTGACGACGGGATCATCGGGGTTGCTGTTCTCGCCACTG
GTGCTAAAGTGCTTCTCGACGCGCTTGCGCAGGGTCTCGATGCCCTTGCGCACCTCGCGGCCGTCATAGCTGCCGAGCAC
CTTGTTGAAGATGGCCTTGGTGTTGCTCGGCTGGGCGGCCACGGCAGCCGGCGCCTTTCCGGCGGCCAGCTGTGCCTCGA
CGTTCTCGAGATGCTCCAGAAGACGACCGAGAGGCCGGCGCATGACGGCATTGAGGTAGAGCCCCAGGTGCTCCTGGATC
TCGGCCGCGGCCGCTTCCTTCCAGTCGTCCAGCACCCGGGTCCCCCGTGGGTTCTCCACGTCCTCGAGGTAGTGGTTCAT
GTTCTCGATCAGCAGAATGTGGAAGTTGAGCGCCTCCTTGTCTTCGGGATCGGTCGCCGAGGCATTGCCGCCGTTGTTGC
CGCCGTTTCCACCGCCTCCATTGCCGGCCACAGCTGCTGCGATGCTCAGGCTGCCACCACCGCCAACGACGCCCGGAACG
AGCCCACCGGCAGCCGTGATCGTCGGGTTCTCGCGTGCAATCACCTTGAGCGAGTCGAACATGGATCGCAGGATTCGGTC
GTATTCGTGGTCCACCATGCGGCACACGCCCAGGTTCGGGTCGGCACCGTCCAGCATGTTCTCGACAGCTGCGCTGAAGT
GTGGGAAGATGCGCATGAAGCCGATGACACCCTTGCGTTTCTTGATCTTGACCTTGGTCTCTTCGATGGCACGGATCTGC
TCGTCGACAAACTTGGTGAACCGGCCCTGCAGGGCTGCGTGCAGTTTTTGCAGCACATTGTTGAGGAAATCCTGGTTGGA
ATGGCTGATGTCGACGAGCTTGTGTTCGAGCGTTGCCAACACACCGATTCCTTGTCTAGGGGGGTTAGTGGGGAAAGCAA
AAAGAAAGAAAGAAAGAGAAAAAAAAAGAAAAAGAAGAAAAAAAAAAGAAGAAAAAAAGAAAAAGACGAAAGAACACAAA
CTCACAATGCTTCCAAAGACAACACCCAGTTCACCAGGCTCTGCAGATCCTGCTCCAGTGACGCAAAGATGGCCTCCATC
GCCCGGGTCACACGGCGGGCCAGCTCCCGATCCGGTTCCATCGGCCGGTGTCGTCGCAGGTCGACGCCACGTCGGTCGCG
CGGCCTCGATACCGCCACCACGTCAGCAAAGTCGTGCTGCTGCAGCGTCGTCGCGTGGAAGAAGTCGATGACAAAATGCT
GCTCCATCTGCACCAGCGGCAGCACGTCGTCCAGCACGCTCGCAAACACCTCGTACGGGTGGCTCCGGCTCTCGTTGGCC
GCTCGCTCGGCCTTGTCCATCTTGTCGTACTTCTCATGCTTCTCGTGCTTGTCCGCCTTGTCGCCCCGGTCGCCCTTGTC
GCCACCGTCACCCAACGGCGACCGCAGCGTCCGCGCCAGCGTCTGGCTCCGCTTCACCGTCAGCTTGCGCGCCGTCGTCG
CGATGCCCTCGTCCTTCTTCTCCTGCAGCGCCGTAAACAGGATCTCGGCATCCTCACCCGCTATCGGCCGTCGCGCAGAC
TTCTTCCACGCTGTCAGCACGTCCCGGAACTCGCTGCGGTACAGCGCCTGGTTCTGCTCCTGGTACATCTGCATCATCCG
GTCCCAGTTCGACAGGTCCGTCTCGCGTGCGTACAGCATCAGCGGGCTGTACTTCCACAGCACTTCTCGACCAGCATCGT
AGTTGCGTGCGTCTGCTCTCTTCGACAGCGCTCCCTCCATCGCCCGCCGCGTCTCGCCGCACGCCAGTCCGAATTCGCCG
CCCATAAAGATGACCAGCCGCCGCATGAACGCGTCGCTCTCCATCATGTACATCTCCCTCTTCTCTCGCACGATCCGCAT
CTGCCCAAAATCGCTGCTCAGCACTCCGCTGCCACCACTGCTGCCGCTGCTGTCACCACTGCTGCTCGTCACGCCTGCCA
CCGCTGTCTTGCCGCTGCTGCTGCTGCTGCCTGGGTCGATCTTCGACATCGCCTTGAACAGCGTCACCAGCGCCGTCTCA
ATGTCCTCGATCCCTCGCGCGCTCTCCAGCGGCGCCGTGCGCAACGCCTCCAGGTCGCTCGACGTGATCGCGCACGTGTC
CAGCAGACTCTCCAGCTCCTTCATCAGCAGCTTCTGGTTCGCCGCCTGCACCTGCAACCCCTGGCCCTGCGCCTCAATGT
ACGCAATGTCGTCCGACAGCGTCGACAGCTCCACGCTGTACAGCGTCAGCAGGTTGTCCAGCTCTTCGCACTCTGCCACC
GCCACGTCGATTCCTGACTTGATCGACTCCACCCGTTCGTCGTCCTCCTGGAACCGGGAGAGGTAGTCGCCCGCCTGCGC
CCGATTGAGCTCACGGTCAATGTCCACCTTGAGATCCTCCATGTTGATCGTTCGCATCCGTTCGCCTGGCACCCAGCCAA
AGTAGTCCAGCCAGTGCGCAAACTCAATGGCCCGCTTGTCCAGGAGCGTCGGGTCGACTCCCAGCGACGTCAAGTACTTG
GCATCGTTGCCTGTGGTCATCGACTTGCGTCCGGCTTCCTCGGCCTCTGCTTCCGTTTCCTCGACGATCTTGCCGGTCTT
TGACGCTCCTGTCGTGGTCGAAAACGCTGCTACCGTCACCTCCCTGATCGGCGGGTGCAGGCTGGACGGCCGGTTCGATC
CCGGCACCGTGACCTTGACTTCTGGGATCGAGCCACGGTGCGGTGGACCGCTTTGCTGCTCTTCCCCTGTTGCCACCGGC
TGAGCCTTCTCGGCCGATGACGGCCGCGGTGGCGCCGGGACCACGCTCGTTATACCGTCGGGGCCCTCGTTGCTCTTGTA
CTGCGCCTGGCGGAGACGCTCTCCAGCACCTCCAGGCCGCGGCTTGAACGCGTTGGCCGCCGCAGCTGCCCGCCAGAACG
CGCCTGCAACTTCTGTCTTGCCCTTCTCTGTCTTGCCCTTCTTCATGATCATCGGGCCTAGCCCGGGTCGATTGTCTTCC
GACTCGGATGGTGCCGGCGAGCCCGCCCCGTTCTCTGGCATTGGCGGTGGTGATGACTGAGGCTCTGTTGTCACTGCTTG
GTTCGGCGTCGACGCTGTCGAAATGGAGACCGGCGTCGACATGGGCGTCGACTCGGCTAGCCTGGACGGCGTTTGGGCTG
GTGTCTGAGGTGCCGGAGGTGTGGATGATATGGGTGTCATGAGCACAGCAGCCGACGAGGCAGCCACGGCTGCCGGGAAA
GGCCCGCTTTGCGGTGTTCGTAGAGACAGCGGGATACGGTCACGGTCAGGCCGCCCGGGACTGGCATCTTGGAGGGGCGC
CCCGCGGTTGGAGCTTCGGGGCGGTGGTGCCACGATATCCCGCGGTCGTACCGAGCTCATCAGGGGCGCCGGCACGAGGC
CGTCGTCGAGGAGGCCTTGCGGCCGTGACGGATCCATCGGCGGCCGCTTTCGTTCCGGAGGTGGCTTATCGCTTGTTGGC
GCCGGGGCAGCAGGGCCTGGACCCGGACTGGGACCTGGACTAGGACCCGGACTGGGACTCTCGGAAGGGTGGATGGGACC
GTTGCGTGAGCGTGGTGGCAGGCTGACGGAGCCGTCGTCGCTTCGCTGCGTCGTCGAGGCGGCCACCGACTCCTGGCTCT
TGTTGCTGCCGGCAGCCAGCCGTCGCGTGGCCGTCTGGATGTTCGGGTTGGCCGACCGGGACGAATCGATGCTGGTCGCC
GGTGACGACTTGCCGTTGGCCATTATGGCGCTGCGCTGCAGACCGCCTGGGCCGCCTGGGCCCGGGCTGCCGCGGAACTC
GGCCTGGCTGAAGGCCGGCGACGGCTGGGGGGCATAGCTGCGCGACGAGGGTGGCCGCTTGTGGCTGTCGGACGACGGCG
GCCGGCCAACACTGCTGGACAACGGCTGGGACGGTGTCAGGACCTGTGGCGGTAGCAGTGGCGTTGGCACGGGCAGACGG
GCGGAAGGAGGAGGTGGTGCCGAGTGCGCCGAGTGCGCCGAGTGCTGAGACGGTGACGGCTGCCCCGGATTGATCGGCGG
AGGCACGCGGCGCTGAGCACCGCCCTGGATCTGGTCTAGTTCGGCTGGGTCGAAACCGGTGAGTACCGGCACCTTGCCGC
CTGAATACTTGCCGTAGATCTTGAGCAGGCTGGAGATGAAAAACTTCTTCTCCTTGTCCGTCTGGGCTTGCCAGTAGTAC
GGCTTGCCTAGCGTGATGAGGAAGCCGACATTGCCGGCCCACTGGCGGTATTCGTAGTTGGTGCTCGCCGCCGTGTACGA
CTCGATGGCCGACAGGTCGTTGAGGTCCCACGTCTTGCCGATCGAAAACGTCCCATTGGAGTTTTCCTTGGATTTGTGCA
CCCGCACCCGGCCAGACTTGCGCACCGCCACGATGATGATACGGTGCTTCTCCGAGTGTGGCGACCGTGTCTGCGGCGGC
GGCGGGCTCGCCGGATGTGACGAAAACTCGAGGATTCGTATGTGGGTGATGTACGTTTCTAGCACTGGGCGACACCCTGT
CAGCATCCCGACGCCAATACGACCTCAGCCCAGCTCAGTCAGCTCGGCCAGCTGGGCAAGCTCAGCCCAGCCTCGCTCGC
CAGTCTTACCAGAGCCATCGTCGTCCCGCTTGCTGAAACAGCTCTCGATGATGCGCCGCTTCTCGTCTTCAAACCGCTCT
GCCCGGCCCATCTCGCGAGCACCGGGCATGGCCATAGCCAGCAGCCCGGACGACAGAGAGGAGGAAACAAGGGGAGCAGG
ACCGGACGGCCGTCTGTTTGTTCGCTGTCTGCGGCTCGGCCTCCCGGGATGCGTCAGGCTCGATGCTTGCTCTCACGAAC
TCTGAACACGCAGCCGGGACGGCAGCATCTTTGGTGCCGAGCCGGTCGGCGAGAGAGGTCGGCGCGTCGAGAGAAAGCAA
AATCCGTCGCGGCAGGATCAAAATTTCCCGCAAGAATTGGTTCGGCAGCGGCGCGATGGGCGATGGCGCGGTTCGGCTGC
TCGTATCGCGTTGGCTCGGAGGAGGGTGAAGAGACGGATGGCAATGGCAATTTCAGACTTGCGAGGTTTGGGCAAATGGC
GTCCAAGCTTCAGGGACAGCCACACATGCCACAGCAGTCCGAAAACAGCTTAGCGCCACTGCCTCGCTGCGGCGGAGTTA
ACGCGAACTGCTGAAAGAATGCATGCCGAATTACGAACCTCGCATTGTGACGCCACTACGTCGTAAGCACGATGCCCGTG
CTGCTCCTGCAGCGGCTAAGCCGGCTCCTCGACAAGCCGAATTTTCGTCGCCGGCATCGCTTGTTTTAAGGGATTCGATC
CACAAAAACGCCCTCGTGCCGTTTCAAGCAGGCTATCCTGATACCGGTTTGCTGCGGCTAACCAACATCACGTGACTGTA
TCCACCCCTATTCAACGCGAGTAGGAAGCCTTACTAAGCAGGGTCGACACAGAGCATCTCAAGGCAGAAGTTGGACTTGT
TTCTTTCCTTTAGTTTCCCTCCCATTCATGAGATAGACACATTGGATTGGAAACAAAGGACCCGCATGACACCGATGGGA
CGGACGGTTCCACGGGTACGCTTCCCCTACGTAGACGTAGCAGACGACCTTCTCACTGTCGCTTCTTGGGTCTATAGTTC
AAACTTGTAGACTAATACAAGCGGTAGAAAGATTGCTTGGCTTGCGAGATGAAAAATCATATCATCTGAACTTTCAGTTT
GAAAATTGATGGTCAGAACTGAGAGCTATGCTGTTATCTGCTGCCTCTTTGGCTCGGGCCATGCGTTCTGACTTGACGAC
GTCCGCTGTCCGTTTTCTTCCATATTCAGACACCTAGGACTGGTTCACTAGGCTGTGTTGTCACCAGGCTATTTCTGTCG
ACTAAGACAGTGTTGAGGTATCTTATCAACGACGAAACAGCAACTGTAATCTGGAGATCTTTCAGCGTTATTTATAGAAG
TAAGTTCTCCAGGATAAGGAGGCGTAAGACGCCCGGACCGGAACAACAATATCCATCCCAGGGAAGTTTGCAGAAATTCA
AAGCACCGCGCTTGTAGGCTGCATTCAGCGTGCTATAAGTTGCAGTTGTGCGTGCAACATGCTTGTTTGGCGGATCTGCA
AATTGCATCCTGTCCTACGGGCTGTAATGTTTCCGCTTCATCTTCTTTTTAGTCCCATGTAGAGAAAGCTTCCCCTATCC
ACTTGCCGTAGTCAAGTAATTTGCTTGTACAACTCTTACATCTGCACATCTACAGCTACGTGTCTAATAGTCGTCTAGGA
TTGGTGTAATGCCTGCGACGCCGGACGTAAAGTGTCAGCAAAACTTTCAAAGCTGTCCTTCAATTTACATTTCTGGCCGA
AAATACTGCGTCGAAGTTATGCATCTGCAAGAGCCTGTAGTAACTACGTCTTTGTTGCTGCAGCTCTAGCTCTCGATATC
CGTACCTGTCAGTCTGAAGGTCACATTCTAATTTTTCTTCCTGGCGGGTATTAAAAACTTGTCCTATCTTGCAGATCTTC
ATCGGGCCGGTGCTACGCGGCGATCACCGCGCCGATGGAAGCCCTGCTAGCCTCCTCTTGTTCTGCTGCAATCGGTTGGC
AGTCGGTAAGTGGACTGGTGCTGTCATATGAGAAGCCGGGCGTCCACCGTCGCCACCGCGAGGAACTGTCCTTACAAGAC
ATGTATGCGGCAGAGACCCTACCAAACAGCTGGAGATCAACATGACCCTGACCTTATATGCTATAGTCATATTGTACCCC
CTTGTCGGCTTCACAGCCCTATAAGATACGTCTGATAGCAAGCCGAGCATCTATAACTTGATCTTGATAATCTATTGTCT
GTTCGTATTGTTCATCGTGCCGCTCCAGCCGCGTACCGTCATCTAAAATGCTTGAAAACGTCAACAGAGCTGGCGTTGCC
CCGTACACTCTCACGTCTAAAATGTCTAGCCTGCTCTTCACCATGGACCTTCCCTATGCGCTCGTAAAGCGCACAGTATC
AGCGTCAACACCATAATAGTCAGGCTTTTAGGCGGGCTGTGGTACTGGGAGGAAATGCGCGGGCTCACGCTCGAGGAGAC
CGGCAAGATCTGGTGGCGAGTGTGAAAGTAACTACGATTAGCTTTGTAAATACTTTCTCCGGCCAGATCCGGCTTATCTA
CATGTGTGCATCCACGTGACCGCGATCGCAGGCAAGTCGAGAGCCGACATCGCTGCTACACCGAGATATGGCACGATGAC
ATATCGCGGATGACGCATAATAAGACGCTGTGATACGGGTGTGCTTCGGCTGGCAGGCGAAGGTTTCCCAATATGGAAGA
AACAATCATGTGGCAGGGGTGTGCATAGAAACTAGACAATCAAGAGGCAGTCAAAAGGTCCCAGAAAGGCCGGGACGCAG
GATCTACCCGCGGTGCGGCGCAGCTGTAGTCCGTATCTGCAAAGCGAAGACCGAGTCTCGGAATGTGTGCGGAAAGACGG
AACACGAGGCCTGCAGAATGTGGGCTTGCCGGCCAAGAATCCGGGGAAGCGAAATGAATTACTCTGCTAAGCAAGACGTG
CCGGGATCGGATGCGGAAAGCCAACACCATTGATACCGAGACGGCCAGCTGATTGGCCAAGACGGACGCCAGGCGGGGAA
AGCCAAGCTGGCGCGTGTGTGCTTATCTCGAGAGGCGCCAATGAGGGCCGATTTACGTGATTCTTTATCGAATATGTCCC
GATTAGGCAATTTCATTCGACCATTAGCCAGGCGCCCAGAACCTACAGTACGGCCGAGTAAGAGGGCGCAAGTGGAGCCG
AGTCTGGCACTCCAGGTACGGAACGATAAGCGGCTTCGCGAGAAACGGCAAAACAGACGACGATGCGTACTTAAGTCGTT
GGCTTCCCTTGTCTCGGTGGCCTGCCTTCATCAAAGCATCCGATCAAGATCAAGACTAGAAGCTTCTCAGCCTGAAAGTC
ATTCTTGTATCAGCCCCCCCCAACCACATACGACAGAACCCCCCGACATCAAGATGGGTGCTGCAGTTCCATACCCGCTG
GACCCCCTCAGCGCGGAGGAGATCAAGGCAGCGGTGGCCATTGTCAAGAAGGCGCACGGTGACGAGCTGCTGTTCAATGT
GGTCTCGCTGCACGAGCCACGCAAGGTGGAGATGACGGCCTGGATGGCCAACCCGGGAGTGGCGCCGCGGCCGGTCCGCG
TGGCTGACGTGGTGGTGATTGCGCCGGGCTGCAAGGTGATTGACGGGCTCGTGGACCTGTCTTCGGGCAAGATCATCAAG
TGGGAGGGCCTTTCGGGCGTTCAGCCGATTGTGAGTGTGGCCTGCTCCTGTATGATGGCCAACGGCTGGTCAATGACGAC
TAACGGCCCCAGATCACGGTCGAGGAACTGCAAGTGGTGGAGCACATGTGCCGCACAGATCCCAAGGTGATTGAGCAGTG
TGTGATCAACGGGGTGCCCAAGGACGAGATGCACAAGGTGTACTGCGATCCGTGGACGATCGGGTACGACGAGCGGTTCG
GCAACAACGTGCGGCTGCAGCAGGCGCTGATGTACTACCGGCCCAACGTGGACGACAACCAATACCAGTTTCCGCTGGAC
TTCTGCCCGATCTTCGACAGCATCAAGCAGGAGATCATCGCGATCGACGTGCCCAAGGTGCGGCGGCCGCTCAGCAAGGA
GCCGGCGCTCAACTACCACGTGCCCGGGGTGGAAGCACAGGGTGGCTTCCGCAAGGACCTGAAGCCACTCAACATCTCGC
AGCCGGAGGGCGTGTCGTTCTCGCTGGACGGACGCGAGCTGACGTGGCAGAGCTGGAAGTTCCACATCGGCTTCAACTAC
CGGGAAGGCATCGTGCTGAGCAACATCACGTACAACGACCACGGCAAGGTGCGGCCGGTGTTCTACCGCATGTCGCTGGC
CGAGATGGTCGTGCCGTACGGCTGCCCCGAGAGCCCGCACCACCGCAAGCACGCCTTTGACCTGGGCGAATATGGCGCCG
GCTATCTGACCAACAGCCTGACGCTCGGCTGCGACTGCAAGGGCGCGATTCACTACCTCGACGCCGACTTCCCGACGCGC
AGCGGCGACGTGCGCACGGTCAAAAACGCCATCTGCCTGCACGAGGAGGACGCCGGGATCCTGTTCAAGCACACCGACTT
CCGCGACGATTCCGTCATCGTCACGCGGGCCCGCAAGTTTGTGGTGCAGCAGATCTTCACCGCGGCCAACTACGAGTACA
TCTGCCAGTGGATCTTCCACCAAGACGGCACCATCCAGCCCGAGGTCAAGCTGTCCGGCATCCTCAACACATACGCCATG
ACGCCCGACGAGGACACGCACGGCTGGGGTGTGCAGGTGCATCGCGGCGTCAATGCCCACAACCACCAGCACCTCTTCTG
CCTGCGCATCAACCCCAACGTTGACGGCGGCCCGAACACGGTCTACACGTCCGACGCCATGTCGGGCGAGGCCCCAGTCG
GCAGCCCCGAGAACAAGTACGGCAACGCATTTTATGCGAAGCGCACGCGCCTCGAGACCGTCGGCCAGGCCATCACCGAC
TACGACCACATGACCAGCCGCTCGTGGGACATCTGCAACGAGAGCAGCATCAACCCACACAGCGGCAAGCCGGCCTCGTA
TAAGATTGTCAGCCGCGAGGTTCCCCGTCTGCTGCCCAAGGAGGGCTCGCTCGTGTGGAAGCGCGCCGGGTTTGCGCGTC
ATACGGTGCACGTGACTCCCTACGAGGAGGACCAGCTCTGGCCGGCCGGCCGTCACGTGCCTCAGACCAGCGGCGAGCCG
TCGGCCGGCCTGCCGCAATGGCTTGGCGACGGCAAGGCGAGCGTGGCCAACACCGACATTGTCGTCTGGCACACCTTTGG
CCTGACGCACTTTCCCTCGCCCGAAGACTTCCCAGTCATGCCGGCCGAGCCGATCACGCTGCTGCTGCGGCCACGCAACT
TCTTCACCAGCAACCCGGTCATGAACGTGGCGCCGTCGTTCAACAGCACGCCCAGCCAGGTGGCCGCGGGCAAGGGCGTG
TACGATGCCGCCGACAAGCTGAGCAAGCTGGCCTTTGCTGACGGCGCCACTGGCGGTAGCTGCTGCTCAAAGTTATAGCC
AGAGAGCAGACAAGCAAAGAAAAAACAAAAGAATGAGAAAACAAGAATAGGAACGCGGTGACTTGGGCGAAAAGAGCATT
GTATTTCCCGTGGGCAGACAGACCAGATAGCATATGCCATAATTGCAAACGACTGAACATACGACTTGTGCCGTATAGGC
AGGTGGCCTTTGCGGGCATCGCGGCCAACGCGCCGTGAATTGCCGGCGGTCCGCCGTCTCTCAGGTGTGATAACTGACCA
TTGACATTGATGGCAAACGTAATGATGTCGTTATGCAGTCGCTGTACGTCGGCCTTGATTGCAACGGTTCGAAGAGCTAG
ATCCGTTTGGTTAGCTGGGTGACAGACCGGACAGACCGACGCGCTCGCCGGTCATCTATGCTATCGCTGTCGTGCTGCCG
ATCACGATTATGCATACTCGTATTACCAGGGTCGAGAAGCCCCAGTTTCTGCACGGTGGCCGCTGCGCTCCCTGCATGCT
CCTTCCTATCGCGGTAGCATGCGGGTCGCCGTGCGCTGTTGTGCTCCAAGATCGAGCCATGCAAGTCTGCCGGCTCAAAG
CTTGACTCTCTTCCGCATCTGCCAGAAAGTCCCGCCCGGGGCTCCATGCCGAAAGAAGAAGGCCGAAGCGTCACGAGGCC
GCGGCTGGCCGATGGCCGGACAGCAGCCCCGTACCCAGCTTTGCTATAAGGGAAATGAACAGAGGACATGGACAGACAGG
ACAAAAGACCTCTTTTCAGTCGCCACTGTTCAGCACTTCGGGCAGCCCTACCTTGCCGTCATGTCCACTCGACGGCCCCC
AAGTTACCCACTCACAGCACGCAATGGTTGTCTGGTCGGCAGATGCCTCTCTTGCTGCCGTCTAGCGCCGTTGCTCTCGT
TGCAGAGATAAGGGCCAAGACGGGAACGGCTTCTCGTCCGTGCAACCCCTGGTGCCTCGACTAATCACCATTGCACCCCT
GTTTGCCGTCCGATGTTTCATTGCATGGGCATCTAGCTCCCTCATTCGGACAGGATCTTCGGCCGACACAGACGGCCAGA
TGCTGCACCTCCTGCCATCCCATCTCTCTGCACAACCGCCTTCCGTTCATAGCCCATGTCACGTCAGCACACGCAACCGC
GACATGCTGCCGTCGCCACCTCCCTCTTTCTGAAGCATTGCCGTCCTCCTCTGCCAGAGGTCCACTTGGCGCTGGAGGGC
CCACATTCAGCGCATATCGTGAGCTTCGCCACCTAGTAGAGAATAGGGAAGGTGGATGACCTGACCCAGTGTGTCTTCGT
CGTATCCCTTTTGGGGGCTTCGACATCGAGTATACTGAAGCAACAGGCCGAGAAGATGGTGAGAGCAATCTGAGAGAAAA
GTATATAATGGACCTGAGGTCTGCTCTCCAAGTCGGTCTTGTCTATCCTGCACCATCATCCAGTTCCCGGTTCCTCTTGA
TAGCACATTCGTCTTCCTGCCTCTCTTCGACCAAGCTCTTGTTCAGCACTCCCCGTCTTTCAACATGAAGTTCACTACCA
CCGCTTTCTCCGCCCTGCTGGCTGCCGAGGCCGTCTATGCCGGCCCGGTGACGCTGGTGCCGCGTGCATCGCGTTCGTCC
AAGCGCAGCGGCGTTGCGCGGTCGTCGCGGCCCAACCAGGTCATCAACGGCCCCGACGCGTCCAACGTGTCGAACGTGGC
CTACTCGAGCAACTGGGCCGGCGCCGTCCTGGACGGATCGGACTTCACCTCGGTGACGGGCACGTTTGTGGTGCCGACGC
CGTCGGAGCCGTCGGGCGGCTCGTCCAGCAAGGAGTACTCGGCGGCCATCTGGGTCGGCCTGGACGGCTCCTCGTGCGAC
ACGACCATCCTGCAGACCGGTATCGACGTCAACATCCAGGGCGGCGAGGTCAGCTTCGACGCCTGGTACGAGTGGTACCC
CGACTACTCCTACAACTTTGACGGCTTCGGCATCAGCGCTGGCGACTCTATCAAGCTGACCGCCACCGCTTCGTCCACCA
CCGGTGGCAAGGTCATCGTCGACAACCTGTCGACCGGCAAGAGCGTGACTCACTCGTTCAGCGGCGAGTCTGCCGCCCTC
TGCGAGACCAACGCCGAGTGGATCGTCGAGGACTTTGAGGAGGGCTCCAGCCTGGTGCCGTTTGCCGACTTCGGCAAGGT
CACCTTCACCGACTGCAGCGTCACCTCCTCGGGCAAGTCCCTGGGCGTCACCGGCTCCACCGTCAACGACATCAAGCAGA
GCGGCAAGGTCCTGACCTCGTGCTCGTTCGGCGCCAGCACTGTCACGTGCTCGTACGTCTAAGCGACTGACTAAGGCAAC
GGAAGGAGCATGTCCGCCTCAAACCACCACATGCTCGCTATCAAGAGGAGGACTGGCGGATGCACTGACGACGATGCATT
GGCCGTATGATTGGGAATGAATGGTTATCTAACGATACTTTGTATATACTTTGCATTCGTACATAAGTTCCGGTGCTATT
TGCGCCATCTATGTTTATATTGATTGACATCAAAGTCCGAGTCTGCTTACGTGAGATGACATGGTGCAATGTAGCAGGAG
ACAAGGTTTCAAGGAAGATCGATATGGCCGCCATGTATGCGCTGCATGTGCGTGTATACGAGGTCGCCGCTGGAAAAGGT
GCTGAGACAGACCCAGCAGATGTGGGTGCGACAGGCGATGCAGATCATATGGTTGCAGCCGGTGACTTTCTCGATGGCTA
TGCCACACTTCGGGCAGTCCTTGACGCCGAGTTCCTTCTTGAGGCGCTGGAAGGCAGCGTGGCCGCCGGAGCGCAGGTCT
CGATAGTCCCCGCAGGTCATGGCGCCGTCATGCGGTTCGGCACAGGCAGCACACGTGACCTGCAAGCAGTTAGCGCAGGT
GTGTGAGCGGGAGGACTCAGATGACGACGATGACGACGATGGCAGCAACCGATAGATGTGACCGCAGTCGGGCGTCGGAC
AGAAGCGCAACTGGTCTGGATGACGCTGGACAAAGGTGGCAAAGGAGTGGGCGAGCAGGCCCTCAAAGGCGGCCGACGAG
AGGTGCTCCTGCAAGTCCCGAAGTGGCAGTCGTCGTCCACAAGCAAGGCTGTGGCAGAGCAGGGTGAATTCGGCTTCACC
GGGCGCCGGAGCGGCACAGCCGTTGTCAAAGCACTCGTGGCAGTAGACGTGGCCGCAGGCGGTCCGGACAGGCGCAGCAT
CCTCGGTCCAGCAGACGCAGCAGTCGGCGGCCTTGGCGAGCGTTGAGCTGGTCATCTGGCTGGTGTTCTGGCTGCAGACC
AGATCCCTGGCCTGGCAGAGGTCGTGCAGAGAGCCCTGGATGCAGATCTGTTTCGGCGTGGACACGACGTCGAGCGAGGC
CTTACCAGGGCCGATCCGGTCGGCGATCGAGGCGAGACCCTCGCGACAGGCCCAGAGAAATTGGTTCGGCTGCAGCGGGA
TGGTGTGGGAGGTCTTCTCGTTGTCGAGCAGAAGCGCCCGCAGCCGAGTCTGGGCGTGGTCGCAGGCCGCCTGCGACCCG
AACAGGAGCATCTGGGACCTGGTCTTGCTGCGGACGACGATGAGGCTGTCAGGAGAGTCGCTTCTGGCCTGCCGCTGGAT
CTCAAGCCAGAGGCTGTTGCTGCTGCTGATCGCCTCATCCCAAAGCGGCTTTTCCTGGCGATCGCGAGCGACGGTGCCGG
CCAAGATGCGGTCGAGCTCGCCCTTGGCGACGGCGACGGCGCGGTCAGACTCACCCTCGAGCTTGAGGATCCGGTATGCC
GGCTGTAGACGTGGACTCGGATACGCAAAGAAGCGCACGTGGGCCGTCTTCCAGGCACTGCCAGCGAGCGCCGAGATGCG
CGGTGCCAGCGCATCGTAGACGCTGCTACCGACTTTGAACCGGACCGAGCAGACCAGCTGGACCGTCAGCCGGCCGTTGG
CGTGAAAGGGCAGCCGGGACCCGTTGAGCTGGGTAGCTGCTGCACGCGCGTCTGCCTCGTCTAGGAAGCGCGCCGTGGCC
TTGACACGCTTGGCTGTCGACTCCAGCGTCGTCTCCCAGTACTCGACCGTGCCTGACTGCCCGAGGAGCGACCGCACAAT
GGCAGCGCAGTAGTCCTCGTCCTGGTCGCCCGTGCTACTGATTCGGCTGCCCGGTGCAGCCTGGTATGTCGGCTGGCTGA
CTTCGATGCTCAGTGGCCGGTCTGCCGGCTTCCCGATGGCTCGGCTGATCACATCTCTGGTGTCGGCAGCCGCCGGCAGG
TCGCTCAGCCGGACGGTCCATTCGGCCGCAACAGTCCGGTAGCCACCACGTGTGCTGACTGTCCGCTCGGGCTCCCCGGC
TACGACTTTCTGGTCCAGGACCCGGTATACTCCCGCCGAAAAGGCCCGGCTGACTCGCTGCGCCGTCCGCTCGTTGCCGA
AACGCAGCCACGCCGTCCGCACCGGTTTATGCCACGAGATGTGCACCTTGCGACAATCCACCCGGCCTGCTGTGTGGTCC
TTGGGCACCGGCGCTGCAACGCGCACTGCCCGCACCACAGACGACCCCCAGCGACTGCCGGCTGCCATGTGGGCGCAGAC
CCGCTGCGAAAAGGTCGCATCCTCTGCCCGTACCACCGCTGCATCCCCATGTGGCAGCAGCCGGACATCCGTAACCGCTA
CGGAGAAGCCGAGCCCGCCAAGGAACGCTCTCACGCTCTCGGCAGAGACCCCCTCCGATGGCAGGCTGCTCAGCTGTACG
GCTGAGAAGTCCTCCGGCAGACTCACCTTGGCCACACGGCCACCGTCCTCGAACCGGACAGAGGCCCCGGCCATGGCGCG
CTTGAAGTCGTCTTTATCCTCCTTGTCATCCCCGTCTTTGGTCATGTCGGTGTCCGCCTTTTTCCCCACATCGGACTTCT
CTTGCTGCCGTCTCTGCCAGCTTTCTGTCGGGGAGGACTGGACAAGGGGTCCGTCGTGGGAAAAGGGGCAGGACAGACCG
CTGCGGCACTTTCCCCACGCAAAAAAGCGGCAAGGCGCATTGGAACGGCTGTCAGCCATTTTGTTCTGTATCGTTGCTGT
TTCGATGACCAAGTCTGGAAAGCAGGCAACTGTTGGGCTGCATTATTGAACCCCTCTATCGCTACCAGTGATTGGCCAGT
CTCTAGAGAGTACAACTCAAGGCCATTGGCTTTAGCATGGCCTGTGCATTTACGAGCTGTTGCCTAAAGTCATCGACGAC
TGCTAATGTTCACATGGTCCTCTATTACTATTTCCGCTTACAACTATATTCCATTAGATACACACTATCTTACAAAAACT
GAGGCGCGGATCCATCCACAGCCGAGAAGAACTGGGCAGACCAGGCCATCGAGTCCAGTATCTCAGATGGCCATTCACCA
TATAACGGATGCTCACCGTTCTGGCCCAGGAGAGGCAGGCCTGGCAGCGAGATGTCGGTCTCCATAGGCATTGGGTCCAA
GCTCGGACCAGGATCGCTTGGCAGGCCACTACTGACATTGTCCATCGCCGGAAGAGTGTAAATTGTGTCTTGCTGCTGCT
GCTGCTGCTTCTGTTGTTGCACTTGGCCATGGGACTCTCGCCAGCGCCGGCCGCGTGTCCTAAGGCGGCGCATCATGTCG
CGAGCGATACGGGCGCCGTCCGAGTTGGCCCCGAGCGCCTCAAACACCTTGAGACAGGTCTCAGCGTCGTCTTCCAGGGC
AGCCACGTCGACGCGGCCAGTGAGCTCCTGCTCGTCCTCGGCGCCGCTGTCGGTCTCGTCGCGCCTCGCAAAGACGCTCG
CCACCACGAGGATAGAGCTCGCGCAGATCAGACACGAGATCATCTGCCACCAGGGAAAGTCGTGCACGAGGCTCTCCTTG
TCGGCCACGTTGTGCAGCAGGTGGGCCGTGTCCTGGGCCTCGGCGATGCACGTGCGTTCGTGGCGGTCGAGTAGCCGCCG
GCTATGCCCGTCCGGCATCTTGTCCTTGCGGCCGCGCAGCAGCGGCAGGCAGAGGTAAGGCCGGTAGATGAGCGCCCGCA
GGTGGTGGAACTTGATGGCCAGCATGTTGCGCTGGCGGCGGAACGCCTGACTCGTCTCAAACGTATGGCCGAGGTCGAAG
CGCAGCGCCCGCGGAAGTGAACGCCTCCACTCAACCAGCTGGCCGTCCAGGGCCTGCGTGCTCGGCAGCCAGCCGGCGAT
GCTGTCGCGTGTTCGGGGCGGACTGTAGAGGTCGCGCATCACGTGACCAATAATCCGTGACAGCGAGATCATACACACAA
AGTAGTCGCCCAGACTGGCCGCCGACGACCTTTCTTGGGCAGCCGGACTCCAGCGGCCGTCCTCACCAGCACCGTCCCAG
TCGATGTTGGCGTCGCCCAGACGCGAGGGCAGCCGTAGGTGGCAGTCGTCGTCGTGGATGGCCGGCGGCCGGCCAAGCTG
CAGGGCCAGCAGGCGGTCGAGCACGTAGATCGAATACCACACTCGACGACGAGACTCGGCCCGGAGCAACAGCGGAGCCG
TCTCTGTGCCGGTGTCCACGTCCACGTCCACGTCCACGTCCACGTCCACATGCAGGCCGATGCTCTGGCCAACACGAACG
GCCAAGCCTAGGGTGGTCCAGCACTTGTCGGTCCGACAGGCCGCCAGCAGGTAGAAGCACTGGGCCAGCAGCAAAGACAC
GCGGCCGAGAGAGCGCTCAGGAGTGTCGGCATCGGACAGCATCAGGGCGTGGCGGTAGTACTGCTCGTGAGACTTGTCAC
CCGTGTCGCCCGAGATGGAAATATAGTATGCGCCGATGGCGAAGAGGACGTCTGACTTGGTTAGGACGGCAGAGAGCACA
AATGGCTTGATCAGCACAACTCACACAATGTGGCCAGCCAAGTGCTGTCAATGTTGGCGTCAGCGGTGCGTCCGGTCGCA
CGATAGCGGTGGTAGGTCCTGACAAAGAGCGCACGGGGGATGAAAGGATATGCCATATGGATGGTGGAGAAGTAGACGTC
GAGGTAGCGCTCGGCTGCGTCGGCCGGTGGCAGAGCAACGGCCAGGCGCTCCAGTTGGACGGCGGCTACCGTTGCCGCAC
CACTCGACGGCTCGTCCTGCTCGTAGCTGTCGAGGGCTGCCCCGCTGCCGGGCTCCTCGGCCGAGCAGCTCGACCCGCCC
TCGTTCTTCTCCTGCAGCGCCCGGTCGATGAGATTGAAGAAGCGCACATCCGAGACCTCGCCGAGATAGCGCTCGGCCAC
GGCTGTCGGACGGGCGAAAGAGACTGGTGCTGGCACAACCGGCATTTGTTGTTGCTGCTGTTGCTGCTGGTGTGGCGATG
ACGGGTCGACCGGTTCGCCTTCGGCTCGGAAAAGCTCGCTGACGCGCAGTCGCAGGCCTGCCAGCCGGTCTGAAGCAGCT
GCCTGATCAGACAGCGAAAGGCTGGCCAGGGTGTCCACAGCCAGACGTTCATAGTCATCAAGGACCTGACGCAGAGCCTC
GGCCAAACGGCTGCATGTCGGCACTTCATGATGCTCCTCATGCACATGCTCGAGCTTGGACCGCCGCTTCTCCGACACGG
AATAGACGCATCGGTAGCCGTAGCCGGTACAGCGCCCACAGGCCGGGTGGATCCCATCGCACTGAAGCTTAGCAATGATG
ACGCTTGAGAAGAGGGTCTGCATCGTCAGGGCCAACGTCACCCACCTTGGACTTCATCGAGCGGCATGGGTCACAGGCAC
GGAAAACGCGCTTTCGGCGAGACCCTGGAGTTTCCAGTAGTCCGGCCATGATGACGCTGATCAAACATCATTCAGCGGCT
GGACGAAGCCGAAAGGAATGAAAACAAAATATGCCGATTTAGCCGCTCTTTCCAGGTTTACGCCAGAATTCATAAGCGGA
CCACGCGCTAATCGCACGTTCTTCTCCTCTTGTCGACACTATATTTACAGCACGTAGGCCACCTGATCCCTGATGTCATG
TGATCACATGTCTGACCCACAGCTCGTCGTCACTTGGGGCTCCCAGCTGGCAAATCACCGCGTTAGCTACACACGTAGTG
CCAAACACTGTGAAATTACATATGCAGACAATACGGGCTACTCGTACTCGTTTAACCGTTATTGACAGGGAACTAAGGCT
AAGAAGCTGTTCTGACAAGGCTAGTCCTGTATGAGCAAGAGGGGCATCACGGAGTATGTACGGAGTACCCCTCTTCAGAA
TTGCTGACATAATTTCCCAATAGCTCCGACTGGATCAATGGAATTTAGCCTCTCAAGATCCGGTCACATTGCCGTGCTCA
GGGGTGCTGTCTACCCGGTAACATATTTACGTCTTCGCATCTCCACAATAGCACATCGGAGCAAAGATGGCCAACGCGAC
TAAGCTAGCGGTCCTGATCGACGCAGACAACGCGCCCCCGACCAAGGTCGATCTGTTACTTGCCGAAGTTTCCAAGTATG
GCACCGCTCACGTCAAACGGGCGTACGGCGATTGGACGGGCCAGGGCTTGACCAAGTGGAAGGACAATTTGCTTCGTCAC
TCCATTCAGCCCATCCAGCAGTTTGCCTACACCCAAGGCAAGAACGCGACTGATTCTGCCATGATCATTGATGCCATGGA
TCTTCTCTACACCAACCGCTTGGACGGCTTCTGCATTGTTTCTAGTGACAGCGACTTCACCCGTCTGGCCTCCCGTATCC
GGGAGTCTGGCCTGACCGTGTTCGGCTTCGGTGAGAAGAAAACGCCACAGCCGTTTGTCTCTGCGTGCGACAAGTTTATA
TACTTTGAGATCTTGAACAAGGATGAAGTAGTACACAGCCCGACTGCGACCTCGAAACGCCCGAGAGGCAGGTACGAGGA
AAGTGAAAAAATGGTAGACGACTCGGACCCGGATCCTCCTGAAGTTTCTAGAAACAAGATGTTGTTGAATACTCTAGGAG
ATGCCGTTCGGGCAACTTCAGACGATAATGGATGGGCGAACTTGGCCAAAGTCGGCTCTTTCGTTACTAGACAGAAGCCG
GACTTTGATTCTCGCAATTTTGGTTATGACAAGCTGATTCATCTTGTCGTTGCTACGAAAGGGTTCGAGACTGAAGTCCG
TAGCCCTGGACCACATAAGCCACCGGTCGTCTATATACGCAGCCTGACTTAATCTTATGGCTGCATTTTGTAGTTTACGT
TCCGGATATGACATTTTGGAGGAAACGACAGCTGGATGCTAGATGCATAGATAAAACTCTGATTTATGTTTTGGTTTGCG
CATTTTGTGTGCACCTGCAACGAGGCATTTGTAAGTTGTTAGAGACGAACTAATACGGAGTACTTTTGTTTAAAGTAGAA
AAAAGGTGAGCGGCAAAACCCTGAATAATTGACTAATCGCGGCGAATGAACCAGTCACCGCCGCCAGCAGCTAAATCTGT
CTCATTTAACTCAGCACAGACGCCGAAAAGAAGCCGCACATCGCGGAGCAAAGGAAGAAGCCTGGACCTGAGGCAGTTTG
TGAAAAAATTGCAGAAACCGCAAGAGGTCGTGATCGACACCGCGTCGCCGGCAATCTTACCGTGGTTCGAGCGCGACTCG
TTCTGGCCAAGATTGGTCCAAATCAAGGAAGTCAGCCAAGACAGGGATCAGATTCGTACTCCGTACGCGACGTCATGCCA
CAGTCTCACAGCTTGGCCAGGGTCCGTCAGGCTGCGGGTATTGGGCAGCCGTCTCAGCTCTGTCGCGCTTTGGCATTTTT
CAGGCACTAGGCCAGCAGGGCTGGAGACTAGACGTCTGGAAAAAGGGTGCCAGCTCGATTGCTGCCCAATTGCTGCCCAG
GTCCGCTGCAGCCCTGTTTGCCCCGTCTTTGCCGTTGGGCCAGGTGAGTCCGCCGATCGGCCCGCCCGGACGTCACAGTG
GACCCAATCTCCCAGACTCTTCCAAACAGGAGAGGCCAGGCGTGAGATTGGAATAAGATCACGGTAGCAGAAACCGAAAC
CCGAAAAGTGGGCCCAAAGACCGACAGGGTGTTTGGGCGAAAACATAAAAAGATGGAGGCCAGGACGAGGTTGCGTTCGG
ATGCAGTCGACTAATCCGCCAATCTGGTTCATCGCCTGTCACTTGTCATTTCCACCATCTACATACACCCCAACACTGCA
GCTATGAAGTTTTTCGTCCAAGTCGAGGAGCATCTGAACGGCCGAGCCTTTGGTCCTGGTGACGAGGTTCGGGGACGGGT
AGAGGTGCCGGCCGACATGGACGCAGCCGCTGCTGGCCGACGTGTGCCAGACGTCTCCGTCGTCTTCCAGGGCACCGTTC
GCCTGTCCATCGTCCCGCAGACGAGCCTGGATGCCGTAGCCCAGGTGCCCAACGCAGCCAGCCAACGAACACATACTTAC
ACGGTTAGTGCAACTTGCGAAAGGCAGCCAGCTGTTGCCAGCTGTTGCCAGCTGTTGCCAGCTGCTGCCAGCTGGCAGCA
ACGGTAAAACAGGATAGCCGTGTACTGACAACCGTCTCCAGCTCTTCTCGCACTCCGTCACAGCCACGCCCAAGCCGAGC
ATCGCGACCGACGGCCGGATCGTCTACACGGCACCCTTCACCTTCCGCTTCCCTACAAGCAGCACCTGCTGCGACAGCGG
CTCATCCTGCGCACTGCCACCCTCGATCGACCTCAACACGGCCAAGGTCCACGCCAACGTCGTCTACAGCGTCACGGCCT
CGGCCCGGCGCCTGAAGCAGAGCGGCCTGCAGCTGCTGCCGCAGTCGTGGCGCCGCCCGCTGCACGCGCAGCAGGTGCTG
ACCTTTGCACCAGACCTGCCGGTCACCGTGTCCTCGGCCCAGCCAGCTGCCGGAGAGGTCGACCATGCCGTTAGTGCCGA
CGCCATAGCGCTGTCGCGCATGCACATTCCCAAGACGACCTTTCTCGGCAACGGCAACGACGACGATGATGAGTCAATAC
CGCACACCCTGCCACCCCCCTACACGTCGTCCATGGCGCAGGCACTGGAGCTCGTGATGCCGCAGCCGGCCGTCATTTCA
CCTGGTAGCGGAGGCGTCGCGCTGGGCGTCTTTTTGCGCACGCCGGCCGACCTGTTGCCACCCGGCAGCTCGGGCGCTAT
TCTCCGCGGCGTCCGCGTGCAGCTGCGCCGCGAGACGGCTGCGCGCATCGGCAGCTTGGTGGCCCGCGCAGCACCCGTCA
GCTGGCCGCTGTGGTCTGTTGAGGGCGCCGTGCCTATGGGTCGGGAACGCGTCGACATTACGGCAGTCTGTGGCGGTGTC
TGGGCAACGCAGTGCTGTGTGCCGGCGGCTGCTCGTCCTAGCTTCCGCTCGTGCTATCTCTCGCAGTCATACACCATCGA
GGTTGAGGTCAGCGTGTCGGCCTCCCCGAACTCGACAGACATACGGGTAAGCCACAACTCGCTTCACTGGCCCTGTTCTC
TCGCAGAAAACTGACAGTCAATAGTATATCCATTCATCAATCGATGTCGTCGTGTCCGATCCGCCGCCAGAGTACTGCAC
CCAGACGACAAGCGTCCCAAATCAAGACCCGTACAGCACTGTCGACCTACAAGTTGGGATGGGGGCCCCGTCAAATTGGT
CTAGCCCTTCCGTAGCGGAGGTGAGAGTTTAGGGGGGTTGCCCCGGGATTAGCTTTAGCGTTGCGTTGTTTGCTCTTTTT
CCAGTGTAATACCCAATTGATCTCCTATTTACCACAATAGCGGGGCGCATTTCGTGTCTCACGTTACTCTTTTATTAGCA
TACCGCCCGTATTCTGCCCATTAACAGCCATCTTACGGAAGTACTTCTTTAACCTCTTATTGACAACTTTACTATGCTTT
CTAGCACAACTATACGTCTTCGAAATCTCTCTGTCAAAGGGGCCTAAGGAGCTCTTAGGCTATAAATTCCCATCGTTGGG
TATCTTTCATGGACAGTCTGTAGGTTAAGAATAAAGCTCCTTAAAAACCGCACGGTAGCTTGTTTCCTGAAATCATGCGT
GGTTGGTTTGATTATAGCGGGGTACAAGGCGGTGGAAGTACTCCGTACGGAGTAATACGAAGTACGAGTAGTGCGGATAG
CACCTTTTCCATTCATTCACCGCAAATTCCGTATTATCCGACAGCTTGTACGCTAGGCGGCAAAACCGGCCACATCCAAG
TACTTCTAACTGGGCCCGAAATTTATGTCCTCTGCTACAGGATGATGAAAACAGGGATGGCTCCCGTCATAGCATATTTG
TGATTGCAGGCCGCTCTCTCTTCTTTGGCCACAGGGCGGACATGCTGAGATGGAGCTCCAGCAAGCTGCCCGCGATGGGT
CAAGCCGCCATTCTGGGCCCCATTATGAGGGCTACACACCCGACCGCTTTGAAGATCTCAATGAGGTCCGCAGCCCGCCT
CCGGTCGAGAACCCGGACGAGGCGGCCACATACCGGCACCGCAGCATCGAAGAGGACGTTGAGGACGAGCGGCGCCGGTG
TCGGAAGCCAGAGTCAAAGCACGCCAGAGTCCACGCTCCTCGCACCGAGCTGTACACTGTCGGCCACCTCGTCTTCTTCT
CGCTGCTCGGCACGCTGGCCCGTCTTGGCCTCGACGCGCTGACCAATTATGCTGGTGCACCAGTCACCTTTGGCGTGCTC
TGGTCCAACTTTGCCGGCACTGCCGTGATGGGCTTCTTGGCTGAGCTGGCGCCCGCCATCAATCGGCACTTGGCTGTGGA
AAGTACTCCCGACAGTCGCAATGTCGCTGCAGCTGCATTGTCGTCTCCTTCGGCTTCATCACCAACACCATCGCCATCGC
CATCGCCATCGCCATCGCCATCGCCACCACGGAAACTCCCTCCAGTGCCGCTGTATATCGGCCTAGCCACCGGCTTTTGC
GGTTCCTTCACGTCCTTTTCGACCTTTATGCTAGACGCCTTCGAGGCCATGGCCAATTCGCTGAAGGCACCACGCTACCA
CCAAAATGAGGGCGGCTCGTCCTCGCCCGTCTCTCGGGGCGTCGGCGACGACATAATGGCTCTGCTCGCCGTCCTACTGC
TGACCATCGCCATGTGTGCCTCGGCCCTCAAGATGGGTGCGCATCTAGCCGTTTTTGTCGCCCGCTGGTGGCCCTTGCCG
CCTCCTCCATCGCCACACTCGTCCTCGGCCTGGTCGCGCCACTTCCGGCTCGGCCTCAATGCCTCCGCCGTCTTTCTCGG
CTTCGGCTGTTGGCTGGGCGCTGTCCTCATGGCCATCTTCCCTCCTTATGGCACCGGCTTCGGCAGCTGGCGTGGTGACG
CCGTCTTCGCCCTCGTCTTCGCCCCGCTTGGAACCCTACTGCGCTTCGGCCTTGGCCTGCGGCTCAACGGCATCTTCGCT
GCCTTCCCCCTCGGCACCTTTGCCGCCAACGCCATCGGCACCGCCATCCTCGCCATGGCCTGGGACCTGCAGCACGCCCA
GCCGTCCACTGGAATCGCCACCAGCATCACCGCCTGTCAGCTGCTCCAAGGCGTCCTCGACGGCTTCTGTGGCTGTCTCA
CCACCGTCAGCACCTGGATGGCCGAACTGAACGGCCTGCGTCGGCGCCACGCCTATGTCTACGGCGCCACCACCGTTTCC
ACTGGTCTCGGCCTGCTTGTCGTTATCGTCGGCCCTCTGCGCTGGACTGTCGGCTGGCACGAGCCCACGTGTCAAGGGAG
GTAGGCATTGCTAGGCTGAAACGATGGACTGCACATGACATGGACGAGCGATATTGCACGAGCTTCTGCATTTTTTGGTT
CATAAAGGCCGAGCCCACGGTCACAGAAGTGACCCGTTTCACAGGTGTGCACCACCGTTGTCTTCTTCTTTCCACGGACG
CACGACAAAATTGTGTCGCGGAGCGTGCAGGCGGACCGTTTGGCCGTTGGAGGCCGACTCCACCGGGTCCAACTCAAGCA
CCACCTCGTCTGCCGTAAGCTTCAGCAGCCGACCCACGTCCTGCCCAGACATTCCCGTGTCTGTGGGTTGTATCACGACG
CGCACGCCTTCTCTCAGGCCAGCTGCCTGTGCTACGGGATCGCCAGCATCAACCGACGTAGCCACCGCAATGTCTTCTGC
AAACGGAGCTGCCAGCACAGCTGCTGCCGCCTGCCGGCCGTCAAGAACCTGCGGCTTCTGCGGCAGGGCGTTGCGGGCTG
CAAGCATCGTGTTGCTGAAGCGTTCGATCCAGGCAAAGAGACGAGGGAACTGCACCGGCGACAGGGCGGGCGTTTCCTCG
CCGTCTCCACCGCCATGCAGAAACGCACCCGGTATGTTGGCCAGCCAGTGTAACGGCCAGACCGCATCGATGTCAGCGAG
CGACGGCTTCGGCGTGCCGAGGATCCAGTCACGGCCATCGGCCAGCAGGGTAGACTCAAGTATGGCAGCCCCATGGCGGA
GCTGGACGAGGGCCTCTGCACGGCGCAGCGCCGTGGCAGCAGCAGCAGCCTCGGCACTCTGTCCTCCGGCCTGTCTATCA
CCCCCACCAGAAAATATCATCGGCGAATTCCCGATGAAGTCCATCCGATCCCGCAGGAAGGCCGGGTCACGCAGCGGCGA
AGTCTCTTCCGGGATCAGCTTGGATGCTTTCAGGAGCACGCCGCTGTCAAGGGTCAGCAGTTCCAGCAGCTGCTCGATAG
CCCGCGCCTCAGGATTATCCGACGATGACATCCCCAGCCGGGGCGCCGACGGGTACAACTGCTCCAGCTTGCGCAACATC
AGGGGCGTGTCCACGTATATGTCTCGTCCGATGGCCAGCACTGGGATGCGGCGGTAGTGGACACCCAGGCGGCCAAGGTC
GGGCCGCGGCATGATGAGAGGTTGGAGCTTGGAGAGATCGTCAGGTCTGTAGCATCAATAGCAAAAAAAGACAACTCACG
CATTCACTGTACGATAGCCCCCGGAGGAGCAAATACCACTCAATCCGCCTCGCATAGGGCGAGTAGGAATAGTGGTAAAA
CACGATCGGTGGATAGGCGTTGTCCGGCATGGTGAAGACGTTTATCAGACTGCATTTGTCGGGTGAGAGTTTATTTCGAT
ACAGGTGCGGGTGAGCCTGGGTTGCGTGGTCTCATGTTCGTATCGTGGGAATTGCTAAAGCGGCGGACCCACGTGACTTA
TTCGGCGGTCAGACAGCGGCAGAATTTCAAAATCGTCGTGCAAGTCGTGATAAATTCAAAGTTAAAAACACAAAACACTA
AATACGAACAGAAAGGACTAGCCACCTCTGCGTGCGCTGCGACTAGTGAGTATATCTAAGCCTCTGGCGCTGCCTCTTAC
ATGGCCTGCGTATCCTGTGCCAGTACTGCCTGTACCACTTTTACACGACATCGAGATTCTGCCGATCAACACCGCCAATT
CAAGTCACGTAAGCCAGTCGCAGCAATCGAGAATTTGCGATCTTGACCTTTAGAAGCGGGCTGTTTCTGACTAATACTTT
CACCCCGCGTTCACGCTGGCATAGACTGGTGCAGGGACTGACATACAGACTGGTATACTGCGCAGAGAGACTTGGTAACA
GGTTTTGGTTATGTGATAGCAAATTGTTCGGCGGCATCAAGGGACGTTCAGGTTCCGTATCTGACCGCCTCGCCACCCGT
CGAGTAACCTTCTGCTGCATGTGAGGCCATCTTGTCTACTCTGTAGATGCAGTTTATCTCGATCTTTCGTCGTGGAAACT
GCGATCTGGGTTGTGTCACCGCACGTGCATTTGCCATTTGTCAGGGAAAGACCGCTTTGATGCAAGATCGACGCTCCGGT
CGGCCGCCTCCGCCCACAGCTCCCCAGCAACAAGCTATAATCGATAATGACGTCGCTTTGCCTATCTTCCCTCCTCCATC
CATGAGATAGCTGCGTATCGACATCGATGTCCGCTATTAATAGTCGTCAGCCTTTACCACGGCTGTCTGACAAAGCCAAG
CAACGTTGGAAAGGTCAGGCTCGATCGCCGCCAAGTAGATAAGCTTTTTAATGGGTCTTCTCAAGCAACTTCCTCTTTGG
GCAGCTCGTGGAGCAAAAATCCTTCACACACTTTTGCGCCTGCCCCATTTTCTCGCCATCTCGAGTGGGGGGGAAGTGAG
GAAAAAGGCAGCATCAGAAACGTAATAATTAAGCAGTCCTTCTTGACAGCGCCGATCGACCTCGTGTCTATCTCCTGTTC
CAGACAAGTTCCAGTCGTGGTGGCTGGGATCGCTGACTACGATACGTCCGTCTGCATAGCGTCCTAACACCAGCCTCGCA
CGGTCTTTCGAACAGGAGCTGCTTTATCGGGGGACCACACGTTACTCGCCAGTTTTCCCTTGCTGCTGTCGTATGTCTTT
TTGCCTCTTCTGGCTGGCTCCCGCGCCCTTTCTAACCGCTTAAAGCTCGCCGCCGTCCCACCGACTAAGCTACCGGTCCG
GCCTTTTTTTTCCTGCTCTGCTCTCTGTCTTTTACCCTGTCACCGGCCCCGTCCACTCCTTCTTTCGCCTCTTCTGTCCC
TCCAAGTATCTGTTTTCTCTTCCCACTCCTCAGCCACATCTCCCCCTCATCCACCAGCCCGCCAGCCACGATGAGCGACT
CGGTTGAGGAAGAGAAGAAGATCGGCTTTGACGCCATCGTCGCCGCAGACCTTGCTGGCACCAGCCACCGGAGCTCGGCC
GATAACGATGTCTACGGCGAGGCTTCCGCACCGAGAAATTGCTTCACCCTCTTTCTCGCCCGCTTGCGCTCCTATGAGGC
ATGGCTCGACCGCCTGCTCGGTGTCGAGGCCGAGGGCATTGCACGTCGCCGGCCTGAGGATCGCGACCCCAAGTACGCCC
GCTGGTCCAACCAGATCGTCATGTTCATGCTCTGGATGAGCACCACGATGAACCTCAGCTGCTTCACCTCTGGCTTCCTC
GGCTGGGAGCTTGGCCTCGACCTCGGCCGTTCCGTCACTATCATCATCTTCGCCACCCTCATCGGCAGCGCCATCACCGG
CTGGTGCGCCACCATGGGTCCCGGCATGGGCCTGCGTCAAGTCTCCATCTCACGCTACTCGCTCGGCTGGTGGCCCTCCA
AGGTCGTTGCTGCCCTCAACGTCGTCGAGCAGGTCGGTTGGTCCTCCGTCGGCTGCATCACCGGTGGTGTCGCCCTCTCT
GCCGTGTCCGACGGCCATGTCAGCTCGTCCCTCGGCGTCGTCATTGCTGCTGTCATCGGCTTCGCAATCTCCTTTGTCGG
CCTGCGTGCCGTCTTCACCTACGAGAAGTTTGCCGGCATCGTCCTCTTCATCGTCTTCATCGTCATGTACGGCGAGGTCG
GCGGCTCTGGCGACTCCGTCACTCCCACCCTGCTCACCGGAGCCACCCTTTCTGGCAACGCCCTCAGCCTCTTCGCCGCC
ATTTACGGCTCCTCTGCCTCTTGGTGCTCCATCGTGGCCGACTACTATGTCGAGTACCCGGTCAATACTTCCAAGCTCAA
GGTCTTCCTTATGACCACTGCCGGCATTTGTAAGCCTTTCTTATTTTCTAAATCTCTTGTCCTCTTTCCAGCACATCAAC
GACCTCTTAAAACAGAAACTAACCCTCCAAGGTCTGCCGACCTGTTTCGGCATGTGCCTCGGTGCCACTGTCGGCTCTGC
CCTTGCCCACCACCAGGACTGGTCGGATGCCTACGATCACAGCGTCGGCTTCCTTATCGCCACCATGATTCACCCCGTCG
GCTTCGCCAAGTTCCTGCTCGTCCTGCTGGCTCTCTCTGGCATCGCCATGAACGCCGTCGCCCTCTACAGCGCCGGCCTG
TCTGTCCAGCAGTTTGCCCGCCCCTTGGGTGCCGTTCCCCGCTTCGTCTGGACCACCATCATGTTTGCCGCTGTCATTCT
GCTTTCTCTGGTTGGCCGCAACAAGCTGCTCACCTTTTTGCAGAACTTTTTGTCTCTGCTTGGCTATTGGAACACCTCCT
TCTTTGTCATCCTTTTCGTCGAGCACTACTTCTTCCGACATGGCTTCACCCGCGGCTTTGACGAGTACAACCTCGAGGCC
TGGAACAGTCCCAGTCTTATGCCCGTTGGCTATGCTGGAGGTCTCGCTTTTGCTGCTGGAATCGCTGGTTGCGTTGTCGG
TATGAGCGAGTCGTGGTACGTCGGCGTACTTGCACGTCTAATTGGCGACGACGGCGGCGATATTGGAAATCAGCTTGCTT
TGGCTTTCTCCTTTGTCGTATACGTACCTGCGCGCTGGGCCGAGTACAAAGTTATCGGTCGGTAGGTGGACATGCGTACG
TAAGACGAGGAGTAAATGCTCAAAAGGGTTTGACTGGTACTTTCAATTGCTATTGAAATATATGACATAATCTGTGCAAG
GCATCATTTATGCACTTCCACGTTGTACTCAGGGCAGTGCCCAAAGTGTTTCCCAGGGTGCTTTTCTCCGTCGTACTACC
TTCTTCACGACAACACAGAAGTCCCATCCATCGGCGAGTGGCCCGAAATTTTGTGTCACTGTCCCTGTCATCCGGCGTCT
TTTCGTGGATCAGTGGCGCGCGGCCGATTTTGACATCTCGGATGGAAGAAGCAACTCGATAGCCCATGAAACTCTGCAAC
AGGAGTGCGGCAAGGCTTATCCCGGCCGACACCCACATGAACACAATCGCAGTCACGCCGATCCGATTCCCAATATTGAC
CTCTTTCTGAAAGGAAAGGCCGACCTTGATTGCGACGGAAATTCCTGTGGCGATGGACGCACCCATGAAGTTTGACAACG
TTGACATGGCCGCGATGATGGACACGGGCAGACTCCACCATCGAGAAAAGAGTACGATGGGCGTTGCAAGAAGCAATATG
CAGTCGAGGATGGCTCCGACAAAGAGGGTGCCGAACATGACTTTGGACGTGATACGAAGAGCCTTTAGCATTGCTACTGC
CGTTGACGGAAGAATGATTTTGGAGCTCTGGAGAAGCTCATCCAGAAACACTTGCTGGGGGTTAAACCAGAAGAAGATCC
GTGGACGGGCACAGCTGGCGACGCCGGTGTCAAAATAGCCTTTGCAAAAGCTCCAAAGCCCCACTCGGTAAAAATCGTGT
AGGCCAATGCTGCGAGCAGTGGAGTTAATGAGGCTCGTCTTGTCCTTTGTTGACGGTATGAGGGAGGATAAGTCGAGCTG
AAATAAATAGATATTGCTGAAGGCCGGCGCCCTTCTTGTGCTTCCCAACTGGACCTAAACACAGTCAATTGCCATCATCT
GCTGCTCAGGATCCGCAGACGTACCGTGATATTTAAGGCCGTAGACAGCAGATACAGCAAACAAGTTGCGGCAACAATGC
TGTGGCGCAGCCTCGTTGAACGCAATATATCAGCCCTTGTAGGCACCGTTTCCGTTGCTTCGGCATTTTGCCCATTGTTC
AATTGATCAGCAAGCCCGATTTCTGACTGCGTATGCACGCTGACAGTGCTCTGACTGTAGACACTTCCCAGTTCGGTCTG
TAAGATAGAAGGCTGTCTGCTTCTCGAGTAGCCATACTCGAAAACGCGGTCGGTAGTGTCAGACTCTGTGTCTCCTGCTT
GATCATGGCTACCAATATCAGAAGCGGGCGTGTATCTCGTGATTTGTGTTATTTGACGATCCTTATTAGGCAAACTTTCA
ATGTCCATGCCAAAGGGCATAGTTGCAGAGCGCTATAGGTAATTCCTGCTAATATGCGTAATTTTCACTGAGGTTAATTA
TACTCGGTAGAAGAGACATCGGATCCAGGGAGACGCGGCCATGCTGTGCTCGAGGGATGACTTCTAGTGACAAGAAATGT
TGGCAAGATACGCGATAGATAGTGACGCTGCCAGGAAACATCGTGTACTGCTCAGCAGTTTGTTGACGTTAAAACGGGCA
ACCTGGACAGGAACGACTGCCGATGGTTCCTGCAGAGTGAAACCGTTGACAGTGTCGCTTCAAAATTAGTCATCGTTTCA
TTTCTCACACACTCGCTCCTGCATGCTGAATACGTTTGGCGCCTTCTCTCCTGGCTGAACATTACTATTTCTTTTTGTTC
AAAGAGTTAAAGCGGCGGTATTGCGAAATGTTTTTGTGGGTCTGGGGAACTGATGCCATTGTTGACATCTTCGTACAGGC
TCATCTCGAGTTTCCTGGCGCAAGTTTCTCGACCCAATTTCGATCTGTCTTGAATAAGTCTTGAGCGACAGTAGGCTTAC
GTTGAGCGGTGTAGGTGGCCTAAAACTCCACCATAAATCGAGGGGAAATCTGTACTGGCTGGCTTCCTTCGCTCCTTCCC
ATGCTTGGTTCCTTCCTACTGCTGAAATCCTAGTTGCTGAGGCACCTTCCACTAAGGAAAGTAGAGTAAATGGGTCGAAG
GTATTCTCAGACACAACTTTAAACATTCATATCTCAAGTCCTCTTCTTGAAAAGTTCATAAAGGAAATCAGTTCCAAAAC
TCAGTATTCTTACGGCACATGTCCTCAATAAAATGTATATCTTAACTTACCTTCCTCAATTACTCTTCGTTTCTGCCTAC
ACGGCCACCTTATGCCTTGGAAAATTGACTTGGAGCCATGCTACACTATCCGAAGCCTGGCAATCAGCCTCCGACGTTGT
AGCTACACCATCTGTTAAGAACCCTATCCGTGGACATGGTGGAAGCGCTCGAAGAGTAAAGATAAAACGCTCGATCGATA
TCGATGAACTTGAGGCCATGAAAACACTTTCAACAGAGGATGAAAGCGATGATGAGACCGAGGATCTGCCAGTCTGCAAC
GGCTATGCCGAGCTCTGCACGCGCCGATACGGCGACGTCACCATGGTGGGCACACACAATTCAGCTTTTGTACAGCGCAA
CAGTCTGGCTGCCAACCAGGAGCTTTCTGTGCACGACCAGCTTGATGACGGAGTCCGTTTCCTGCAGGCTCAGATGCACT
GGGCGCGAAACGACTTGGAGCCGCATTTCTGCCATACGTCCTGTGATCTTCTCGATGCTGGCCCCATCACAGACTGGCTT
GGCCAGGTCAAGGACTGGGTGGAGCGCCATCCTCGTGACGTGGTCACGATCCTGTTAGGAAACGGAAACTACGCGAGGCC
CGAAATGTATGCACCGTACATTGAGTCCACTGGGCTGGTTGATTTCGCATACGCCCCGTCAAACCCGCCAGTGAATCTGC
AAGACTGGCCGACTCTGGGAAAGATGATTGACAGCAGACAACGTGTGGTAATGATGCTGGACTACAAAGCCGACGAGACT
GTCTATCCCTGGCTGCTGGATGAGTTCAGCTACATGTGGGAGACGCCCTTTGACCCGCTTATCAACTCGGGCATACCGTG
CTCTACACAACGACCGCCCAACCTGTCCGATGAGCAAGCCAGCAACATGCTATACCTCTTGAATCACAACATCAACATCG
AAGTCTCATTAGCGGGGCAGTCTGTTCTGATCCCGGCTGTTTCCATTGCCAACCAAACCAATGCTGCCACTGGGAGAAAC
AGCCTGGGCGAGACGGCCGAGAAATGTCGCGAAGAGTGGACGCGGCCACCAACAGTGCTCAATGTGGACTACTACAACCA
CGGTCATCCGCCTGGGTCTGTCTTTCAGGTGGCCGCCAGAATGAACCGTGTCACATACAATACGACGTGTTGTAGGAAAG
CAAGAACGTCGGGTGCTATCCATTCCGTAGCCTTGTCTCCGGCAGCCTTGGGGCTGGTGGTCATTATGACCGTTCAATTT
TTTATGTAGTATCGATTATGGCAAAGCATATTAGTCACAACTATCTATTCAATGAGAAAAATGAGAAATAAAAGACCCTG
CGATTTGGAAATGACGTTGTGGTGGAGTAAATACAAAACACAGATATGCAAGCCACGGGTGAGGGTCCGTCAAGTGACGT
ATGGTCTATCTGCCGACAGTGACCGGCGCGTAAAAGAAAACCCAAGTGCTCGGAAGACGGCAAGAAAATAGCCGGGTTTT
TTCGATGAGGCCTGGCTCTGTATACGAAGCAGGGCGGTAGATTCTTTGTGTTCTGATAACGGCGGTTTTGCGGCTGCTGA
CGTCGAATTGCCTGCATCTTGTCTAAACAGCTGTCTTTGCCGCAAAATCTCACGGCCAGTGCGCACAAACAGTTCCGAGA
CATTATCGCCAGTCTTAGCGCTGGCCTCAAGAAAGCGGCCATCCCAGGCCACACACCGCTCGCCGTCGTCGGCATCACTC
TTACTGCCCACCAGCAATAAGGAGAATGGACGGCGCCGCTGCGAGTGTAGAGACTGGAGGACAAGTCCTGAAGCAGTATG
TGCTGCTTCGGTCTTCCGCCCTCGATGTCGCGTCTTTTTCCGTGATGTCTGCGGTTGCGGCTGTGATGCTTCGCCGGTCT
GCCACTGCAGCAGCTCATACAGGCTCCAGGCCTTGAGAAACGAGGCGGCGTCGCCCACATCGTACACCACAACGGCAGCC
TCGGTGATGGCGAGCGCCTGCTCAAGCATCAAGTTCGCAGAGGAGGCGGCAGCCGGCGCCAAATTTGCTCCCTCCTTTTT
CTTCAGTCTTGTTCTGTTTTTTCTGTCCGCGGCTTCCAGCACTAAATGCTGCGAGGGCATCTCTAGAATGCCCATGGTGT
AGGTCTTGCCGTCGATTTCGAGAGTCCGTCGGCCTCCATGCTCGAACCGAGAGTCTGGAGGGGCAGCCTCGCCACGGAAG
GAGTCGTCACAAAACTAGCAGGTTAGTACAGACACACTCTTTCGTGTGATTATCCGCTGAAAAGCATCAGGGTACGCACC
CGTGTCACCAGCGCTGTCTTGCCGACACCCTTGGGGCCTATGAGAAGCACGCGGAATTCACCGGTGATGGCCTTGTGGGC
AGCAGCCGCAGTCTTTTCGCAGCCTCTGTCAGTCAATTTTCCCTGAAGACGGTCCTGCCACTTAAAGATAGCCTTGAGGT
AACGGGACTCCTCCGCTGTCCAGTACATGGACCCCATAGCGTTTTTCTTTCTTTTCTGATATCTTTTTATTAGATCGGTT
TCTATGTTCTCTGATTTCTGACTTTGTTTCTCACTTTGGGTTGAGACTGAGGTGCAAGCTGGCTGGTGATGGGTATTGAA
GAAAGACCAGTATTTTCGACGGCGCGATTGTTTTAAAGGAATAATAGAGCGAAGGAGAGTTGATGAAGGGCGTTTGCAAA
AAGCAGACTGAAGACCGGGGTGTAGTGAATGAAGAAGAGCCGACGAAGGAGCCGAGTTAAAACAGCGTGGCACATTTCTC
CATTTGGAGGCATGGCTTGCATTACGCAGAATTGTTTTCCACGCTGGTACTCCGTACAAGCACACAGACAATGCACGAGC
ACTTGACGTCTATTTTTCCGGCTGTACTAAATGTGCTTTGATATGAAACACCGTTTTATGTACGCCATGCAGTGCATCCG
GTAAGACTCTCTCTAATGCAAGAGAGTGTGATATGGTTGGGCTGAAAGTATCTGAGCCATTGAAAGGCAGGGTAGTACAC
CGTATCTCTTCACTGTTTCCTGGTGTCGGCTAATGGAAAAAAGAGCAGAGACGATTGGAAGCCCGTATGCGCCCTGAAAG
CATGGGATATCGACGGAACGAAACCCAAAAGCTGTGCACACGTGACACAGACAAGAATCCCTGGAATGAATCAAGGCATG
TCCACGTGTAACTGACCCCCGTGTTTGTGTTCGTGCTCTACAAGCTCGTCAACTCTTCAGCTCGCATTCCGCCCTTCACT
TCCCGTGGCCCTTCTTCTTGGACGTCGGTTCGGGCACCAGTCCAGCGCGCACAAAGGCGTCGCGAGCAGCCTGGTTGATG
AGGGCGAAGCGGTGCGGGCCCAACTTGTGGCCGCCCCACCAGCGCGTGACGACGACCATGACGTTCCAGATGTCCATGAG
CTGCATCAGGTGCAGCAGACGGCCACCGGCGGCGGTCTCGCCGTCATCATCGCAGTCCTGGAAGGTGATGGCAGCAGCAG
TGGTGTTGGTGCTCGATGGGATCCCACGAATGCGCCAGGCGGTCATATTGTGGGCAGCTGTGCGGACGCGCCGATCGGTG
GCCAGCAAGTGCTGTAGATAGGCGGCAGCCTGAGCGGGCGACGACACGGGGGCACAACGCGCCACGAAGACGGACTTGAG
CTCCTCCATGCGTTCCGACACGATCCAGGGCGGGGGCGGGTCCAGCATCTCGGGCGGCAGCTCTGGCGTCGGTGGCCTCT
GTCGTGGACGGCCCTCGCAGTCATTGTCGTCGTCGTCGTCTCCGTAGTCGAAGCCGGCCAACCTCTCGTTCTTGGCCACG
GCTTCGGCCTCGGCCTCGGCCTCCTCGGCCTTCCACCGCATGAACTCTTCGACCGCGTCAAAAAGACAGACCTGGCCTTG
CTGAAAAGTAGCATCCATGGCTGCCCGGAACAGGTCAGCGTCTCGTGCTGCTGCTCCCGGCCGCTGCCGGTGGCCGTCTT
CCCCGACACTCTGCACGCCCAGCACCGACGGCGGATCTGTGCTGACCGGGTATCCCGGTGGGAAGCGGAGTCGCAGGCTT
AGCCGCCGGCTGGCAGCCCCCGCGTCGTCTGCATCCGCAACGTCGGCCGCCGACGACGGCAGCGCCAACACGGCCACATC
ATCGTCGTCCAGCACGAGCGTGCCCTCTCCATAGATGGAGTTAATGGCCTCGACCTCGTCGACCAGATCCTCCGAGGGTG
CCATCACAGTCGGTCTTCTCGACGAAAACGCTGCTGCTGCGTCGGGGTGCGCGAGCGTGGCGGGTCCTTCATCGCCCAAA
AATGCCAAAAACGGGCAAAACAAGCGATGCGAAAAAGAGGAAAAAGGGACTGACCTAAGGATTATATTTTTATTATTCAT
GATTTAATAGCAAAAATCCATGCTCGTCCATTGGCTAGACTGCTTATCAACGCTTATCGCGTTATGACTCTCATTGCTAT
TGTTGTCGTCGCCGACAACGGCTGGTTTTCTCTCTGCGGTCCGCAGCTGTGTTCAATGCGGTCTCTGTCCATCAAGCCGT
CCCCATAGACAGCTTCGCACCGATCGTCTCTCCTTCGATCATGGCCGCCGCATCGTCAGCAGTTGCGCCCGTCGAGGACG
CCGCCACCTCGTATGGCTTCTTTTATGGTAGGGATGAGCCAATGCTCATATTTTGTGTCTTCTCGTCCTTCTTGGCTAAC
GCATATGCAGGTACACTGGTGAGTACCTGTCCCTCGGTGACAGCCTGAGCTGTGGCCGTTGCCACCAGGCCACCACGCTC
ACCACATCTCAGATGGCCCCTGAGGTCTTCTTCATTGTCTGCTATCGATCCAATCCACCACCGGCTGCACTCATCCGTGA
GCACACCTTCCAGCCGGCCGTGCTCCGAGGCTTCTGCCGTCACCGTGTCCTCAACCAGGACTACCCCGCCATCGTGGCCG
ACAGCAGCAGCTCAGTGCGTGGTATGCTGGTAGCCGGGCTCACTGCGGCCAACATCCACCATCTCGACGTTTTTGAGGGC
AGCGAGTACGACCGCGTGTCCGTGCAGGTTCAGGTCGACGGCCAGGATGCACCCGTAACCGCCCAGGTCTACGTCTTCAA
GAACGCTGCCCGCCTCGAGCGGCGCGAATGGGACTTTGACGAGTTCCGTCGCGAAAAGATGCACTCTTGGACCCGGGCTG
ACTACACCTTTACCGGAGAGTGAAAGAACCGCGACTGTTTTGGGTGTTTGTGTCTCTCAGTGTATCTGAGTATGTCCGTG
GGCATGATGGACTGACCAATCCTGTACCATCCCGTATTCCTAGCTAGCCTATTGATGGCCTGTCAAAAAACATTACTAAT
ATTTACCGTGCCGTTCCTGAGTTGGTCGCCCTCGGTCGACGTCACTCTGCCTCGAAATAATTAGCGCGGTCAGAAATGCG
GGGGTGCGACGTGATTTAACGGCTGACCAACCAAGTCTGACCCAGAAATACTACTACAGGACGACCTCCTGCCTCGTTTG
TTGATTTGTCGTCGTTTGGACAAACATCCAGCGCAACCAAGTCTGCTCCTCGACCGTCCGTACAATGGCTCCCTCGGAAC
CGGCTCGTGAGCGGCAGCGACGCCGCAAGATCACGCTCGCCTGCGAGCCCTGTCGCGAGCGCAAAGCCCGCTGCGACGGT
CGCAAGCCCATCTGCTCCACCTGCGAACACCGCTCGCTGGGACTGGAGCAGTGCATCTACAAGGTCGGAAATGCACGCAC
GGCTTGCAGTGAAGAGTGAGTTAGTGCGAGCGATGTGCAAAGACGGAGGAAGAAGGATGAAACATGCCCCGGCTTACCGT
TCCCCCCCCCCCACAGTTACATGAGGGCTCTTCACGAGCGCATCCGCAGACTCGAGCAAGCTTGTGCTGCCAATGGAGTC
GACATCTCGGCCATCGAAGGTCACGGATCAGATCCGAGCGCCTTTCAGCCGGCACCGCCATCCGCCTCGCTGGTCCGCAG
TCCGACCGAGCCCATCCTCGGCCTCGCGGACCGTCCTCCAGAACACCAGACGACTGCTGCATCGGCCACATCTAAATCCA
CGCCTGATCCCGAATCTACCGATCCCCCTCGGGGTGTCTCGGGCATGGGAACGGTGCTCGAGGAGGACGACCTCGACGGT
TCTGCGCGTCCTGGTGACGACTTTTACGGTCTCTCCTCCGCGGCCTCCTTCCTCAAGGAGGCCGCCAACTCCATGCGTCG
CCGCAAGCAGCTCGACAGTCCTCCGCACAACCTCGACGACTTTACACAGCCGTACCAGCAGTATCAGCAAAACCAGACGC
TCCCCCCACCTGCTCCTCCGCTGCTTGGCACCGCCTCTTCGTCGTCCTTGCTGCGCTTCGCCCCCGTCGACAAGTTCGCC
CTGCCGCCACGGGCGCTAGCCGACCACTTTGTGCAGCGGTACTTCGAGCGCATCTTCTATCTGTACCCTTTCTTTGACCG
TGTCGCCTTTGAGCACACATATCGCAGCCTATGGAGCGCACCGGGCGAGGATGGCCACGGCAGCAGTAGCAGTGGTAGTG
GCAGTGCTTCTGGGCATGCCACCGCGGCTACCGGTGCTACCACTGCTTCCACCAACGCCAGCGCCTCGAAGCCGCTCAAG
TTTGACGGCTGTGGACTGGGAGACAGCGACGCCGGCGCCAGCTCGATCCCGTTCCACTGTGCACTCAACGCCATCTTCAC
GCTGGGCTGCTGTTTTTCAGACCTGCCCGAGGCCGAGAAGACGGCGTCGTGCGAGGTGCTCTTTAACCGGTCCAAGGCCT
TTGTCGGCCTCGACTTTATCGACGAGAACAACGTGGGCGTGGTGCAGTCGCTCCTAATCATCGCCCTGGTCCTGCAAGGC
ACCCCCTTTCCCAACCGCTGCTGGAATGCTGTCGGCATGGCCTGCCGCGTGGCCCAGGGCCTGGGACTGCACAGTGAGGC
TGGTCGACGACCACGCAGTGCGCGAGAAAAGGAGATGCGACTCCGGACGTGGCACGGCTGCGTTATCATGGATGTGTAGG
TGATCCTTCTACTGACGGTTGTGTTTGCGTGCTGACTAAGCAGTCTTGTGGGCATGACGTTTGGCCGGCCAACCTTGTCT
TCCAGCCTATCGATCCCGCACAGCACGTTCAGTATGTACCCAAGCGTCGGGTCCCCGGCGCTCGAGACCAGGTCGGAGCA
GTTGCGCTTCCTCTTCTTCCGGGAGAGCGTGCGGCTCAGCGTCATCCTCGAGGGCATCCTGCAAAAGATCTACGAGCCGT
GGATGACACACGACAACAATGCCAGCGGATCCTCGACCACTGGACAGCTGCACATCCACCACAGTCTGGACACGATCGTC
GAGCTGCAGGACCAGCTGACCGGCTTCGAGCAGTCGGTCGCCCCGTATTTGTCATGGGTCACACCAGAAACGCCCGACAA
TGTTTCAGCAGAAGACCTGCACGTGTTGGAGATGCAGAAAAACGTGCTACACGCCAGGTTAGGTCCCGTGTACGAGTATG
CGGACGCGTGCTGCCGAAAAGAGTTGTGCTGATTGTCTTTTTGACGGCCTAGGTTCGTCTACATGCAGCTCATCATGCAC
CGCCCCATCCTGACGCAGCTAGTGGCGCCCGAGGGCACGGCACAGCACGGCAGCAGCGAGAGCCGACATGAGCACAGAGC
GGCGGCAGGCTACACGCCGCTGTCACGTGACGGGCTGCACTACGCGTTTGCGCTGGAGTGTGCCAAGGCGTGCGTGGAGG
CGGCGAAGCGGTTGATCCTGCTGGTGCACCGCACGTACCTAACGGACCAGACGGACGCGTGGTGGTGGAATGTCTTGTAC
ACGTGCACGGCCGGGCTGGTTCTGATTGTGCTGCGCCTGTGTCCGGACTTGTGGCAGATGCTGGACCGGGACGAAATCGC
AGAGCTGTGGGGCCGATGTCAGTCGGTGCTGCAGCAGCTGGCATACTTTAGCGTGTCGGCCCGCAAGTCGATGACGCTGC
TGCTCAAGGTGAACGAAAACGTGCTGCTGAAGCAGGCCGCCATGGAGGGTCGAGGTGGGGAGGGCGAAGGTAGCAACGAC
GTCGGCGCCACGGCGAACATCAACAGCCAACAAGCAGTGGATCCGACGCTTGACCGGGACCAGGACGCTGCCGAGGCCCA
GCTGCAGGCCCACGTCGACGGCATGATGGCTCAGCTCGACCCGGCCGGGATGAGCCTCGACAGCGCCTTTTCATTTGCAC
CGCTCTTCAACTGGGACCAAAATTTGGACTTTATGTACACGACGCCTTGAAGGTTTGGCCGTCAGCTGTCAGACAAAGCG
CGACTTCGGGCTCCATCGGCATTGCCAGAGCATCGTGGACATGTATATGCTTTTGAGCAAGCTTGCCTTGCTACACGACC
ATTGCAGAGCAGGAGCGTGACGAGCTATGGGCTTCACTGTAAGCACACAGAAACTGCTGAGCGGGCGGTGAGCGAAAACG
AGTGAGGCTGGCGGCCGACCTGGCGGGCAGCATGCACGCCATGGCCGTCTGCCAGGCGAGCAAGTCGATCTACGAGCTGT
TCGACCGCCCATTCTTCCTGGCCCAGAGCCACAGCACCGTCTAATTTGCCGCCATGGGCGTGCGGCGCTGTGACGGCGTC
GAGAACCCGGCCGAATGCATGCTCTAGATTGTCACCATCTTTACCATTTTTACCAGTCTCGTCCAGTAGATTTAGCCGTT
CTTCGACACGCAACGGGCCCTCTACGAGGTGCGCGAGTGCCCTGGAAAAATGTTCTCGTTGGTAGCCTTTATGATGGCCA
GTATCGTGGTCGAGTAGCCATACCTTTGCTCACGGCCGCGTGTCGCTGCCATTAGGTGTTGACCGCGGACGAGAATCTCT
CGTCGGCCGGCATCCGCTGGGGCGAGCGGTGGCGCAACTTTGGCAGCGTCTGGGGCTACGTGGCATTTAACGTCGTTGTG
GCCATCTCGCCGTATTACATCTTGCAGGTGCGGCGGTGGAGCATGCTGGAACTGTCGCTGTGTCGGAAGAAGAAAAAGCA
GAAAAAGCAGTGACGGTTAGCCGAGAGAGAAAAGTTGAGTGAAAATTGGACCGACAACCTACCCAGGGTTTTCCAATCTG
TTTCTTGTATTTCACGGAGTAGAGGGGGCTTCGATAAAGAATCCTAATGTTTTTTACTTAATCAGCATATTTTTCTATAT
TAATATCAAATAAACTCCATGCTCGAAACAATATGGACTGGTGACGACAGCAACAGGGTAAACGGCAGACCAGACGTTTC
TACGACGTAGCGTGAGACCAGTTTTTTGGCCTCTACCAATAGGACTGGAAGGACGTAAGATAGGACGAATGAGCAGACTG
CTCCGTACTTGCATTCGCATATGCAGCCCGGGCATGAAACAATTGGTGGGCCCACGTTATCTCTGCGCTTGTGTTTCAAG
ATCGTAAGGATTCTCCGTTTGGGGGCGAATGTTCGGGATTTACGTCGTAGATAGCATCGAGAGCGTAGCCATTTGTGGAG
CTGCAGCTGATGACCTCCTTGGATTGGCCAACAGTCATTATCAGTGTGAACTGCATGAGAAAATGCATGAGAACGTGGAC
GCCTGCAGCTTCAAAGCAAGGGCAGAGATGTGAAAGAAAATGTGGGGGAAAAGCAGGGTGCATAATACATCAATGGCTGT
TTGCAGCCACCTAAAAGTGCTTTCAGACCTATGCCTGCTGCAGAGAGAGGACGAGGAGGGCTTGGCTTACCAACATAAAG
TCCAAGTCTGAAGGAGGCAATGGGCCGAGCTGTAACAGAAGAAATAAGCCAGGCGACTTACAAGGACAATACTACTTAAT
TACGATTGGAAGGAAGTAAAAACTGTATCAGACGGATTCGCCAAGCGCCAAAAAAGCTGTGACAGCTCTATATGCATAAA
TTTCTGGTGGAAATCTCACAAGCAGAGAACTGACGCATTCGTATAGGAGACTTCAGATTTAAATCAATCGTCTACAAAGT
AAATACAGCAGATGAGACAGCAGTATAGTCACACGTCAGCCAAGATAATCTCTCTAGTGTTGCACTAACCAGAGTACCAA
GTCCTATTCCATATAAAAGCTGAAGTAAAGGTATACAGCGGGACGGCTGTGTAGACCTCGAAAAAGTAAAACAACATAGG
TAAACATTGCTACGTAATTGGCCGGTTAAAGTACTCCGTAATGAGTGTTTAATTACCCAAGTCAAACTTCAACTGACATA
TAGAGCCAGTACTCCGTACAACGTACCCTCAGCTCCGTCCTGGCCTTTGCAGATTCACATCGGAGATGACTTCTCGTCCC
TGGTTGCACCTGATGCTGTGCGATCAAAGCAATGCCGCTTGTCAGCAATTTCTCTCAAGTGGCTTTTCCCACAGCCAATC
GGATCTTGATCGAGACCAAGCACGTGACTTATCACATGCCCCTGAAAGGGGTTGGTCTACGGCAAGCGGTGCTTCTGTCT
CGTTACTGGCCACTCCCATTTTTACAGCTGAGGATTACCCCGAGCCCATGCCAAAAGGGGACATATATTGAGCGAGAAGA
AAGGAGATCGCCAGGAAGCAGACCGAATGCCCGCAAACGGACAAGCACGACGATTGATTGCGAAACGGCCGGCCGCCAGA
TTCTTTCTTCCCTCGCCCCTTTTCTACACCATATCCTATCCTACGTGTTGGCTGCTCAGGTCCCCCTGGCTTCTGACGCA
GATGCCGCGCGTTTGCAAGATAAGATCATCCCTCTACTCCGTAGGCCTGCCCTTTGGAATCGCATCAACGGAATGCGAGG
CTCGTATTGTCGTGTTCGCAAGGGAGATCGCATTCCTCCAGCGCCACCACGAGAAATTGAGCGACGGCCGCGGCCACCCC
TGTGAGCGGTATTGGCTCGCAAGACTTGTTTGTGTCTGCCATTGCCAGCAAGTAATAAAGCGCCCTCGCCGTGCAGCGGC
CACGGCCATTCACCGCCGACAAGCAGAAAGAGGGAACCAGTGAAAGCGGCAGTTAGACGGTGAACAGGCGCCGGCCAACC
GATTCGGGCATGCAAAGTGAACATCCTACGCCGTCTGTCGTCCCGATTGCCGTCGATCGATGGGGAAGAGCATTGGGAGA
CATGGAACGGCAGAAGCTGCTTGTCCGAGACAGGCAGGCAGTTCAGCCAATCGTCAGCGCCGACAGGGGCTGGTGCTTAG
TGGCAAACGCCGCCTCTACAGGGCACAAGCGCTGCAAGCGGCTGCCGGTGGCCTACTCGTACGTCCCACCCCTGAGCGGC
TGCCTCCGATTCAGGGGGGCTATGGCATCAATTCTTTTCCTAGCGCGTCCGCCACAAGGCCGACTTTCATGCGTCTGCGT
GCGCGTGAAGTATGGAGCTCCTCGTAAAGAAAACTGGAGAGGCAAGATTGAATCCGTACTCCGTACTCCGTACATACTCC
GTATCTTACATAGCATCTTAATATTACTTGTACAGCTCAAAGTGCAGTGGCAATGACCAACAGTCAAGCATTCGAGCTTG
TTGGCTTACAAAGCACGTGCTAACGTTACAGGTCATGAGCATAAAGAGGCCGTTTTACCTTTCACTCCACCACGACCTAC
CGCTTCGGCTCTAGGATGGACCGACCAAAACGCCAACGATCAAACGTCCGGCCTGGTACCTGCATGCGTGTGGTTGGGCG
CCCTCCAGCAGTTTTTTCTTGTCTCTGCCTTTATCCACTGGATCTGTGGGCCTCGGCGAAGATATCCGGGCAGGCTTTTG
AGAGCAGAGAGGGCCCGGGACAGGGAAGCGGTCTTGTTCGCTTTTGAAACACGCCAATGAGAAAGGGAGTCAGACGCTGA
GCCTATCAGAGCGCCGACTGTCGTTTTCCCCACAGAAGTGCCCCTGTCCAGCCGCAGTGCTAAGCTACGGGCCTTCGCCT
GCCAGATCCACTGTGGCCTGCCTCAAAGTGCGATGGAAAAGTTCGCGATGCAGATGCATGACTGGCCGGCAGTGCACAAC
GCTACAGCATCCTCACCCCCTGGCGAGACAGTAGCCAATCGTTTGCCCTAATATCGTCACTCGCGCACTGCCCCTCTTCG
GTCGTGTCTGTCCCCTGGCTCGGGATATCCGCCCCCCCTTGTCTTGCAAAGGCGCCTGGATCCTGGACCTTGATTCTGCC
CTTTCTGGCAGCAGTAGATCGCAATCCTTGGTTTGGCTCCCGCACGATGGATCCCCCTCGTCTCATGTAAGACGTCTGAG
GTATAAGATGCCCTCGTCGAACCTCTCCTTGCCAAGCATTTTGTTCTTCCCTTCTCTCCATCCTCTTGTGTTTCGTTTCC
TCCAACTTTCCTGCTATCTTTGCACTCCCGACCTTGCGTCGACACTCTCCTTCAGGCTTGGCCCTTTTGTTCTTCTTTTC
AAACGCATCCAACTTTTGCCTGGGGCATTGTTATCCTTCCTTTGAGAACTTTGTTCACTCAAACCGACAATCGACTTGTT
CTTGCCCCTGTTCACGGTCAAGATCATTGTTCAACGTAAGCTGCGCAAAGAGGCCTGTTCGCTGCTTGTGCTGGATTTAC
TGACACGGATCCTGATAAATAGTTCACTCTCGCCTCAGCATCTCCAGCACAATCTTTTGCATACACAAACAGAAACACAA
CCACTACTCCCACAAGGAAACAATTTTTCGTCTGGAACGAATCCCCCCATTCTCACATACAATCCTTTGAACGACATACA
CAACCCACAAGCAAAAACAAACCAACACAGCAACAATGTTTTCCAAGACGATCATCGCCACCGTCCTGGCCGCCGTGGCT
AACGGACACATGCTCATGAACACACCGGCACCATACAGCTCACCGGCTCTGCACAACGGCCCTCTCCAGGCGGACGGGTC
CGACTTTCCCTGCCAGCTGACGAGCGGCACCTCACTCATGGCCGGCAGCGCGTCCAACACGTTTGCCCTGGGCTCAGAGC
AGGCCCTCAAGTTCACCGGCGAGGCTGTTCACGGCGGCGGTTCCTGCCAGATTTCTCTTACGTACGACACCGCCCCGAGT
GCGAGCAGCACCTGGAAGGTCATCCGGTCTATTGAGGGTGGCTGCCCGGCCGAGGGCCAGAGCGGCAACATGGGCGCCGA
CGCCTCGGCTGCCGATCCCTACACGTACAACTTTACCGTTCCCACCGACATTCCGACCGGCAGCGTCACGCTCGCCTGGA
CCTGGTTCAACAAGATTGGCAACCGCGAGATGTACATGAACTGCGCCCCTGTCACCCTGACCGGCACTTCGGGCACCCAG
GCCGCCTACGACAGCCTGCCGGACATGTTTGTTGCCAACATTGGCGACGACTGCGGCACCGTCGACAGCACCGATCTGCT
CTTCCCCAACCCGGGCAGCGATGTCGTCCAGCTCAACGGCGCCACCTCGGCCTTCTCCAAGCCCACCGGCACTGGCTGCC
AGGTCGCCGGTGCAAGTCCCGCTGCTGCCAAGTCTACTGGCGGTGCCGCCACAACTGCCGCTCTCTCTCTCTCTCTCGGT
GTCACTATCGCTGGTGGTGCTGCTGCCACCAAGTCAACCACTGCGGCTGCTGCTGCTGATACCGGCATCACTGGTGCCGT
CTTCATCACCGTGGCCACAGATGGTGCCGCTGGTGCCACCAGTACCCCCGTCGCTGCAAAGACGACCTCCACCCCGGTGG
TGGCTGCGTCTCTGTCAACCACTGCTGCAGGCACCAAGTCAGCTGCTGCAGAGACAACAGCTGCTGTAGAGACAACCAAG
TCAGTTGCTGCAGGTACGACCAAGTCTGTCGCTGCTACGACCTTTGCCACCGCCGCTGCCACCGCCGCTGCCACCGCCGC
TGCCACCGCCAGCTCCTCGTCTGCCACTTCCGGCACCGAGCAGACTGCCGGCTCTGCCTGCTCTCCCGAGGGCACCTGGA
ACTGCATGGGCTCTTCGTACCAGCAGTGCGCCAGTGGCACCTGGTCGGTGGTCATGGCACTGGCTGATGGCACCGAGTGC
ACGGTCGGCAAGGCCGCCACACTGAGCCTGGCTGCCATTGACGGCAAGAAGAAGCGGTTCGCCATGCGCTTCCGTGCTTA
GGCGAGCAGCTGACGACGACTCTTTTCTGTTCTGCATTGTATCATTATTGGCATGACCTTTCCACCACGTTGACGCTTTC
ATTCTTCTGTCCTTTTTTTCTTCTCACACGGGTTATGTGTTCATCTTCAGGATTTCTCTCATTTCGTTCTCACCTTCATT
TCACTTCAACACATTCGTTGTATATTCAAAACACATTAGATACCAAGGCTTTTCAGTCGGTCCTTTCAGGCTTGGCTGAC
GGAGTTGTGATAGCAAGGAAGCACAATAAAAGTTCGGCTACTGCCCATCAAATAACATGCTTACAAGACGAGTGAAGTGC
GTACGTCGTAACCCGCAAAGCTGAGAAGTATTAGTGCATCTCCCCTGAACCTCGCAGATCCAGGCAATAGAAAGGCTGCG
TTGTGTCCTGATTGGGAAATGCGCTGCATATCTGCTGATTGGTTGACGAGCCCTTTCCACAGGGATATGCCAGGTGGCTA
GAGCTGTGATTGGCGGGAAAGTGGCCGCTAAGCAGCCTGGCTGAGCCGGAGAATCGTTCTTGCAGCCCCTAGCGCAAAAG
GTTTTGGCAGACTGTCCGCCCAGCTCTCCCAACTCTTTGCAGCGAGGTCTGGCAAAAAAATAGAGCTGTCGCGACTTTTT
CTGCTTCTATGCTTTCTGCCCATCGCGTCGAGCACCACCAAACCAAGGGTGCAGCACCATCTTATGCCCGGACCGTCTTC
TTTTCTATCCATTCTCTGGGACGACATTTTTTACATCAGAGACAAACGACCGTATTGTTTAATATTAGCTATTCTTTTTA
CAAGGTTTTCAGGCGACGCCCGATCTAAGCGGCTCTCACGAGGACTGGCCGATTTCTGCATATTTTGCGCGACCACTGAG
AAGCCACGATCCTTGTTGGTGCCAAAGAGTTCGGTCGCCCTCCTATGGGGCTCGGGGCGGTACGCACTCGCCTTCCTCCT
GACGAGCGACCGTCGCCAGCATGGCGTCCGTAAGCATAATCGACAGCATCCTGCGGCAGCTCGCCACGGCAGATTTGGGT
GCGTTTGCCGTCTTCTTTCTCTGCTCTCCTGCTCTCTTGCCTGCGGGCCACTTCTAACCGGACGCAGACGCCAAGGCAAA
GCTCGATGCCGCCGTGACCCTGCGCGACTACCTGGACCACTACACCTCAGGACCGATCTACGCCCAATTCCTCAAGAAGG
TGATGCCCATCATCTTCAACATTCTCAATGGACCTCCCAGCTTCCAGAGCGAATCGCCCGAGCAGGTACGGTCTCGCCCC
CCTGCCCTATGTCTTGTGTGTGTACCGTCTTGTCCCGCTGACACGCTCAGAAACTGCGCAACTGCATGCTCGAGATCATC
CACCGATTCCCCTCCATTCCCACTCCTGTCGAGCCGTTTGAGCCCTACGCCGAGGAGACGATCGACCTTCTTTCCAAACT
GATCCAGACCGACAACGAAGACAATGCATGCCTGTGCATTAAGACCGCTGGCGACATTCTGCGCCACCAGCACAAGGTCT
GCGCCGCCAAGGCGCAGTTGTTCCTCAAGCTCATCGAAGAGCTGTTCTCGCAGACCGAGCGCATCGTCAAGGAGCAGCTC
GACAACGAGCCGGCCGACGGTGGTACGACCGGCTCCGTGGCCGCTGGCGCTGCAGGTGCTGCACCATCGACGCCGGGCAG
CTCACAGGTCGGCTTCGCGCAACACCAGCCCGGCTCGCCGGGCGTGACTGGCGGACTGGAGGTCGATCGGCAGCTGCTCA
AGGGCATGCACTCGTTCAAGGTGATCTCGGAATGCCCCATCATCGTCGTGTCGATCTTCCAGATGTACCGCGCGAACATC
CCGCAGAGCATTAAGACGTTTGTGCCACACATCAAGTTTGTGCTCTCCGTCCATCCCAAGGCACAGGAACAGGCACACAG
TGAAGCCGCCAAAACCGGCACATATTTCTTCGGCATGAGCCCCAACATCAAGAACAAGACAAGCTACGGCGACTACATCA
CTTTGCAGGTCAAGATGATGAGCTTCCTGGCATATGCGCTTAGGCAGTACTCGCAGCAAATGTCCGACTTTCTCGTTCAT
CTGCCGAAAACGATCATCCGACTCCTGCGCGACTGTCCGCGCGAGAAGGCCGCCGCTCGCAAGGAGCTGATTGTGGCTAT
CCGCCACATTATCAACTTCAACTACCGGCGCATCTTTGTGACCGTGATCGACGAGTTCCTCGACGAGAGAACGCTGTTGG
GTGACGGCCTGACCGTCCATGAGACGATGCGTCCTTTGGCCTACAGTATGCTTGCAGACCTCATCCATCATGTCAGGGAC
CACCTCCAGCCGGCGATCATCCGCAAGACTGTGGCGATCTACACGAAGAACCTGCTCGACGATTTTCCGGGCACCAGTTT
TCAAACCATGAGCGCGAAGCTGCTGCTCAACATGGCTGAATGCATCGCCAAGATGGAAGACAAGGTAGAGGCACGCCACC
ATCTGGTGACCATTCTCAACGCTATTGCCGACAAGTTCGCCGCCATGAACCGCCAGTATGACAACGCCCAGAAGCTGTCC
AAGGAGTACAGCGACCTGCTGGATCTGCAAAAAGAGCGGGCCAGCAAGTCGCCCACCGCTCTGGGCATGGCCGCCTTCTC
CGAGACCTTCCTTGCCGATCCGAAAGTGCGGCCACAGTGGGACGAGATCGACCTCTTCACGGCGGCGCCGCCCATCAAGC
TGACAAACGCGCGTGAGCGTGGCCATGACCCCGTGGGTGACAACAAGTTTCTCTTCAAGACATTGATGCAAGGCTTGCGT
AACACCGTCTTTCAACTGCGCAACTGTGCCCAAAATCCGACGATTGACCCGGCCATCGCGCCTCCGGGATGGTCTGATGT
GGCTAGCGGCTTCAATGCCGAGGAGGTCAAGGTGATTATCAAGCTTTTCCGCGAGGGCGCCCGCGTGTTCCGCTACTATG
ATAGTGCTGAAAAGGTCACGGCTGAGCCGCCGTTCGCGTCCATCGTGGAGTACATGGCCAACTTTTATATGGTGTCCAGC
TCCAAGGAGGAGAAGGATTTGCTGGAGTCGTTTGCCACGCTCTTCCACGTCATCGATCCGGCCACGTTCAACGAGATATT
CGAGCAGGAGGTGCCCCATCTCTTCGAGATGACTTTTGAACACACCGCTCTCCTGCACATTCCACAGTACTTTTTGGCCA
GCGAGGTCACATCGCCAACCTTTTGCGGCATGCTCTTACGGTTTCTGATGGAGCGCATCGAGGACGTCGGGCTTGCCGAT
GTCAAGAAGGCATCGGTGCTGCTGCGCATGTTTAAGCTGGCATTTATGGCAGTCACCTTGTTTGCGGCGCAGAACGAGCA
GATCCTCCTGCCGTATGTCGTCGACATCATCAGCAAATCGGTCGAGCTGTCGACCCGTGCCCAGGAGCCAATGAACTACT
TTCTCCTCCTGCGCTCTCTCTTCCGGAGCATCGGCGGCGGCAAGTTCGAACATCTCTACAAGCAGATCCTGCCGCTGCTC
GAAATGCTTCTGGACGTGCTGAACAACCTGCTCCTGGCTGCCCGCAGGCCCATCGAGCGGGACCTGTACGTCGAGCTGTG
CCTCACGGTGCCGGCTCGACTGAGCAACCTGTTGCCCCACCTCAACTTTCTTATGAGGCCGTTGGTGGCTGCGCTGCGCG
CTGGCTCAGATATGGTCGGCCAGGGGTTGCGAACACTGGAGCTTTGCGTCGATAACCTCACGGCAGAGTATCTGGACCCG
CTGATGGCGCCCGTGCTGGACGAGCTGATGCCTGCACTGTACGACCAGCTTAGGCCGCATCCGTACAGCCACTTTCACGC
CCACACTGCCATGCGCATTCTGGGCAAGCTGGGTGGCCGTAACCGGAAGACGATGACGGACCATCTCCCGCTGTCGTTCA
AGCAGTACATTGACGACTCGCCGAGCTTTGATGTCCGGCTTGTCGGCTCAAAGAAAGACCGGCCGTTCAACGCAGACCTG
GGCCTCGAACTGGCCCTGCAGAAGATCATGGAGATGCCGGGCAAGCCGTCACGAAACCCGATTTCGAAGCAGTCCGACGC
GTTTTACAAGAAGCAGGCCCTGCATATGATCAAGGCCCACGTCAAGATGCGCATTGGCTACGACAACCTGCCCGATGACC
TACCGCGGCTGGTGCGGTTGCAGGCACAGGACCTGCTAGCCAAGAAGCTGGACGTGGACCTAGCCGTGTTTGAGGAGAGC
CACCGCGAGCGGTCGGTTGCGAAGAAACACGAGATGGAGGACATGCTGACGCGGCTGATCAAGGCGCTCTTTTACGCAGA
GTCAATTGAGGACCTGCGGGATGAGGCTGACGGCTTCCTGATGAACATTTGCCGGCACTTTATCTTTCTCGACATTGGGC
GCACGCTCATTAGCTCCAAGCGGGCCATCACGGCCTTTAACGCGACGACGGGCGAGGGGCCGCTGGTGCTCGACTCGCAT
CTCCTGGCCGACGCCATCCTCGAGTCGCTCTCGTCCATGCAGGAGGACGTGCGGAAGGCGGCACAGCGGGCGATCGAGGT
GATGTTCAAGACGGCGGCAGTGATCTTTGGCACGGAAGACGGGGTGCATGTACTAGAGTTCTTTAACCACCTGGCTGCCA
CGTTCACGCACGGCTGTTACGTGGAGGAATGGTTTCTCAAGACGGGTGCCTGCCTGGGCATCCAGACGCTCCTGACGATG
GTCGATCTGGGCGATGCATGGGTGGGATCGATGCAGATGGAGTTTATCCGGTCGCTACTGTTCGTGGTGAAGGACATGCC
CCCCGACCTGCCGGAAACGACGCGCAGCCTGGCGCAGTCGACGCTGGAGATCTTGCTGGAGCGGGTGACCAAGGGCCTGA
CGAAAGAGGACGTGATCCCGTCGACGGACGACAAGGAGCAGCGGGACAGCGAGACGCCGAACGAGCAGAGCAAGCGGAGA
CTAGGACCGCGGCGGCTTCCGCAGACGTGTCTGCTCCTGGCGACGGAGCTCTCACACATGAACAGACACGTGCGCAACAC
GGCGAAGCGGTCACTGGAGCAGATCGCCAAGGCGGTCAACATGGAGGTCTGGGAGGTGATTGAGCCGTACAAGGAGCGTT
TGTTGTCGCCGCTGTTCCAGAAGCCGCTGCGGGCGCTGCCATTCTCGATCCAGATCGGCTACGTGGACGCGCTGACATAC
TTTATGACGCTCAAGTCGGACTTTGTGGTGATTGACGAGAACGTGGAGCGGCTGCTGACGGAGTCGTTGGCGCTGGCCGA
TGCGAGCGACGAGTCTCTGGCCGGCAAGTCGGCAGAGTTCCGGACGCACAACTTCATCGTGGACCTGCGGGTGGCCTGCA
TCCGGATCCTCAGTACAGCGATGGGCTTTGACGAATACCAGAAGGGCCAGGGCAACGCAGCGCGGTCCAAGATAGTGTCG
GTCTTCTTCAAGTGCCTGTACGCGGAATCGAAGCCGACGATCGAGGCGGCCAACGAGGCGATGAAGCGGGTGCTGATGTA
CACGAACAAGCTGCCCAAGGACCTACTGCAGTCGGGGCTCCGGCCGGTGTTGGCCAGCCTGCAGGAAGCCAAGCGGCTGA
CGCCTCACGGGCTCGAGAACTTGTCGCTGCTGCTGCGTCTCCTGACAAACTACTTTAAGGTCGAGATTGGGACGCGACTG
CTAGACCATGTCAACAAGCTGGCGGAGCCAGCAGCGGTGCAGCAGATCTCGTTTGTGCTGTTTGAGCAGAGCCCGCTGAT
GAAGATCATCGTGGGCGTGTTCGGCGTGTTCCATCTGCTGCCGGATGCGGCGCGCATGTACAAGGAGCGGATCATCGAGG
CGGTGCTGGACCTGGAAGACAAGCTGCGCCGGACGCACTATAGCGCGTTGCGGGCGCCGGTGTACAAGTACATGGGCCGG
TATGCAGACGACGTGGGGCAGTATCTGATGGGTCGGATTGAGGAGCTCAAGTATGGGCGGTTCCTGTCGCAGGCGCTGCT
GGACGGCGAGAGCCGGTCGCTGCGTGACTACTGCAACGCCCACGTGGACGATCTCATCAGCAGGTGCAACACGATTGTGC
TGGAGCAGAAAGAGACGGAGTCGATTGCGGTGATCAACACGATCCACATCCTGTATGCGCTGTGCATCCGCAGCACTGAC
AATGCGGAAGCCGTGGCGGATGGCAGCAGCAGCAGCAGCAGCAGCAGCAACTCGGCGGCCTGGCTGGAGAAGAAGGAGCA
TCTGGTGTGGCTGAAGACGGTGGGCCGGACGCTGGAGGAGCGACTCAAGGCCAACTCGCTGGCGCCACATCTGCGGCTCG
CGGGCAACCAGGCGGCTGAGCAGCTGATGACGATCCTGACGCGCAGCCTAGAGCTTCACGTGGAGGACACGGAAATGCTG
CTGGGGCTGGTGGAGACGGTGACGTCGGAGGACCTGCGGGCAACGCCGGTGTTCTTTGCGCACATCTACCGGAACATTGT
CAGCAACGAGCGGGTGGAGTTCAGCAAGGTACTCGTGCTGCGCTGTCTGGAGGTGTACGCAGGCAAGACGGCGACGCACA
AGACCAAGTCGTTTCTGCTGCACTACATGGTCAACCCGACGGTGGCGATGTCGATCATGCGCAACTGGGACGTTCTGGGC
GAGGAAGAGCGGGAGAAGGGAGCGCCGCTGCTGGCGGACAAGCAGATCATCGAGTCGATCACGGAGAAGATCTGGAAGAC
GAACATGGTGGACCACCAGGATGAGGTGTCGACGCGGTCGGGTGGCGTGGACTACACGCGGATGGAGGTGATGCAGCTGA
CGGCAATGTTGGTCAAATACCACCACGCGATCCTGCAGGATGTGCGCAAGGACATTATCAAATTTGGCTGGACGTACATC
CGGAACGACGACGCGATGAACAAGCATGCGGCCTACGTGGTGATCGGGTACTTTATCCAGCACTACGACACGCCGGTCAA
GATCGTGTCGCAGGTGTACTACTCGCTGCTGAAGGCGAACCAGAGCGAAGGCCGGGCGCTGGTGAACCAGGCGTTGGAGA
TCATTGCGCCAGTGCTGCCGACGCGGTTTGGGTCGAGCGACCGGAACGCGGCCTGGGCAGCGGCACCGCGACGGATCCTG
GCAGAGGAGAGCCACAACGCGCAGCAGACGAGCAGCATCTTCCAGTTCCTGGTGCGACGGCCGAACCTGTTTTACGAATC
GCGCGACAAGTTCACGATGCTGATTATCATGTCACTGCGACGGGTGGCGAGTCCGGGCAACGCGTCGAGCGAGAGCAAGC
GGCTAGCCCTGAACCTGATGTGGCTGATCTGGCAGTGGGAGCATCGACGGGTTGAGGGCACGCTGATCGACGAGAGCCGG
CGAGGACGAAGTGGGAGTGCAGCCAAGGCGTTAGGATCGCCACGATCGACATCAGAGTCGCCACTTTCGCGGAAGCGCAA
GCTCGAGACGGCCGAGGAGAAGCGAGAGGGTCCAGGCTCGCCGATGGTGTTGACATCAGCCAAACAGGAGTATCAGGTGC
CGGCGATGGGCCGACAGAAGATGCTGCGGTTTCTGATCGAGTTCATCGCGCAGCTGAACGAGCGATACGAGCTGCCGACG
TCGAAGCCCAAGGACCCGGCGACGCAGCCGTCGTTTCCGTGGAGCGATCTGTGCACGCGATCGATGGCACTGCTGTTCAA
CCTGCTGCAACCACGATTCTGGGGCGTGGCAGACGTGGAGCTGCTCTCTCACGCAACCGAGCTCGTGCTGACGGGCGATA
AGGCGACACAGGCACTGGCGACCGAGCAGGGCGACCGGGACCCAGCGGACGATAAGTTCATCGGCACGATTGTCAACATG
CTGCAGGTGGTGCGGGTGATTCTCAACTTCCAGCCGGACGAGTACATTGTGACGAACATGGAGGCGATTCAGCGACTGTT
GGACAAGTGTCTGCGGTCGGACAACGCGGAGGTGCAGGACTGTCTGCACACGGTGACGACCGAGTACGACGACGGCCGGC
AGCTCAAGTCGATCATCGGACGGATCCTCGAGACGGTGCCGGAAGACGTGCACATGGAGGATGTCGACGGCGAGGGCGAG
GTGGAGGCGCAGCCATCCGAATTTGTGACGTTCTTGTCCAACGTGGCAACAGAGACGCTGGGAGCCAACAACTACATAGC
GGGCATCAACATCCTGTGGTCGCTGTCGAGCCGACGGCCAAGCGCGGTAGACCCACACATCCAGGCGCTGCTCAAGACGC
TGCAGTCCAAGCTGGGCCGCGAACACTTGGCCCATTACACAGCAGCAGCAGCACAGGCAGCCAATCCACACGGCCGAGCC
TCCCATGCAGCCCAGCAGCAGGACCCAGGACTAGCCGGCGCAGAGATGACGCCGTTCAACCTGATGGTGCAGTCGGGGCT
GATCGTTCGGGCCATTGACGTGCTGGCAAAACGGATCGAGACGCTGGGCGACAACCGGCGACCCTTTCTCAGCGTGCTGG
CCAACCTGGTGGAAAAGTCGCAGGACGTGCGGCTGTGCAGCACCATTCTTGACCTGGTCGAGGGCTGGGTCTTCAAGTCG
GAGGGCACGTGGCCGACGCTTAAGGAGAAGACGGCGGTTCTGCATAAGATGCTCGTGTTTGAGCACCGTACCGATCTGAC
GATGTTGCAGCGTTTTCTCGACCTGGTGCTGCGCATCTACGAGGACCCCAAGATTGCGCGTACGGAGATCACGGTGCGGC
TGGAGCACGCCTTCTTGATCGGCACACGGGCACAAGACGTCGACACGCGCAACCGCTTCCTGGCCGTCTTCGATCGCAGT
CTCGCCAAGTCGGCCAGCAGTCGTCTCGGCTTCGTGATCGCGGAGCAGAATTGGGACACGCTGTCGGAGTCGTTCTGGCT
GGCCCAGGCGTCGCACCTGCTGCTCGGCGCCGTCGAGATGGGCGGGGCCGCACAGCTGCACGCCGACGACGTGCGCGTGC
AGCCGCTGTCGCAGCTGTGCAGCATCTACGGCACCGATGGCCGCGAGCCGGCGCTGATGGTCGACGATCGCTACGAGGCT
TTGGTGGGGACGTTGCGACGTCACGTGACCAGTCTGGCCGATGTCCGTGTGCGCGACCTGCTCGAGCCGCTGACGCACCT
GCAGCACACAGACGCGGCGACGGCCGGAGCGGTGTGGGAGACGCTCTTCCCGCTCTTCTGGGGTGCGACGCTGCGCGAAG
ACCGTGCCGAGCTGGAGCGCGGCCTCGTCGGCCTGCTGGCCAAGGAGTACCACAACCGGCAGATGGACAAGCGGCCGAAC
GTGGTGCAGGCCCTGCTGGCCGGAGCTGCGCGCGCCTGGCCTGACTGTAAGGTTCCACCGCATGTTCTCAAGCACCTAGC
ACGCACGTTTGACGCCTGGTACGTGGCCCTGACGCAGCTGGAGCGCGCGGCCATCCGGCCAGAAGTGGCGTCGGTCCACG
TGCGCGAGAGCAATCTGGACGCGCTGGTGGAGCTGTATGCCGACCTGAAGGAGGAGGACCTATTCTACGGAGCCTGGAGG
CGACGCTGCCACTTTCTCGAGACCAACTCGGCCCTGTCGTACGAGCAGAACGGCATATGGGACAAGGCGAAACGAATGCA
CGAAGCCGCTCAGATCAAGGCGCGCACCAGCGTGATTCCGTTTTCGCAGAGCGAGTACATGCTCTGGGAGGACCACTGGG
TCATCTGTGCGCAGAAGCTGCAACAGTGGGAAATCCTGCAGGACTACGCCAAGCACGAGAACTTCCAGGATCTGCTGCTC
GAGTGCGCGTGGCGCAACTTTGACATGTGGCAGGAGCAGACGAGCCGGGACCAGCTGGACGGCCTGATCAAGGGCGTCAT
GGACGCACCGACACCGCGCCGTGCCTTTTTCCAGGCCTTTATGGGCCTGCTTCGCTTCCACCACAAGCAAGACACGATCC
AGGAGTTTGGGCGCGTGACGGACGAGGCAATCCAGCTGTCGATTCGCAAGTGGCACCAGCTGCCACGACGGCTGACTAAT
GCGCACGTGCCCCTGATGCAGAACTTCCAGCTCATGGTCGAGGTCCACGACGCAAGCATCATCTGCAACAGCCTGGCGTC
GACGACGCTGATGAACCTGGACGCCAAGTCGGCCGAGCTTAAGCTGCTCCTGGGCTCATGGCGTGACCGGCTGCCGAACA
TGTGGGACGACATTCTGGCGTGGCAAGACTTGGTCACGTGGCGCCAGCACATCTTTAACCTCATCAACAGCACCTACCTC
AACCTGCTGCAGCCACCGCCGCAAGGGGGGGCGGCCGGAGCGAACGGACAGGCCGGAGCGGCAGCCGGACAGAACGGCCA
GGCCGGACAGGCGACGGGATCGACAGCAGCCGCGACGGCAGCAGCAGCCGCAGCAGCAGCAGCAGCCGCGGGCGGATCGT
CGTTTGCGTACCGCGGGTACCACGAGACGGCGTGGATCATCAACCGGTTCGCGCACGTGGCACGCAAGCACGACCTGCCG
GACGTGTGCATCACGCAGCTCGGACGGATCTACACGCTGCCCAACATCGAGATCCAGGAGGCGTTTTTGAAGCTGCGCGA
GCAGGCCAAGTGCCACTTCCAGAACGCAGACGAGCTGACCAACGGGCTGGACGTGATCAACAACACGAACCTCAACTACT
TCAGCCCGCCGCAAAAGGCCGAGTTCTACACGCTCAAGGGCATGTTCCTCGAGCGGCTCAGCCAGAAGGACGAGGCCAAC
ACGGCCTTTGGTACCGCGCTCTTTTACGACATCACGACAGCCAAAGCGTGGGCCGAATGGGGCTTCTTCAACGACCGGAT
CTTCCAGGCCGAGCCGACCAACTACACGGCGGCGCGCCAGGCCCTGACGTGCTACCTGCAGGCGGCGTCGAGCTACAAGA
ACGCCAAGGCGCGCAAGCTGATTGCGCGGATTCTCTGGCTGCTCAGCCTGGACGATGCGGCCGGCACCATCGCCGGTGGC
TTCGACGATTTCAAGGGCGACATTGCCACGTGGTACTGGATCACCTTTATCCCGCAGCTGCTGTCGGGTCTGACCTACAA
GGAGGCCGTGCGGACTCACGCGATCCTGCTGCAGATTGCCAAGACGTATCCGCAGGCGCTGTACTTTGTCCTGCGCACGA
GCCGCGACGACATGCTGGCCGTCAAGAAGAACCAGGAAGCACGCGAGCTGAAGGTGGCCCAGCAGCAGGCAGCCAAGCAG
CTGTTGCAGCAACAGCAGCAAGCAGCAGCAGCTCAGCAAGCACAGCAGGCTCAGCAGGCTCAGCAGCCGTTGATCAAGAT
TGAAGGAGACGGCGGGTCGTCGTCACGGCCGAGCACGGCCAACGGTGTGGGAGGTGCGTCTGGGACGGCAAAGAGCGAGA
CCTCGGATGGGGCGAATGGGACGGCAAATGCAGCATCGACAACGACAGCGCCCATTCTAGCACCTCCGCCACCACCTCCA
CCACTCCATCCGACCAAACGACACCCGTGGGACTTTATGGAAGACGTGCTGGTGGCAGTCAAGTCGTCGTTCCCGCTGCT
GGCACTGTCGATGGAGACGATTATCGACCAGATCCAGAAGCACCTCAAGTGCCCGCCAGACGAGGACGCATACCGGCTGA
TCGTGGCTCTGCTCAACGACGCCATGTCGTATATCAGCCGGTCACCGGCGTCGTACAGCCGAGACGTCAAGCTTCCGGCA
GCGACCGAGTCCAACATCACGCGGTTTGCCGAGACGGTGTTGCCGACACACATCCGGCCCATGTTTGAGGAGGAGTTTGT
GGTGGTCAAGCCGACCATGTACGAGTACATCCAGAACCTGCGGCGGTGGCGCAACAAGTTTGAGGACAAGCTGGACCGAC
GGGCAGGACGGGTGCCGCTGGAACAGCTGTCGCCACACCTGTGCGAATTCCGATACCTCAAGCTGGACGACATTGAGATT
CCGGGGCAGTACCTGCAGCTCAAGGATAAGAACTCGGACTTTATCCGGATCGAGCGGTTTATGCCGCAGGTAGAACTGGT
ACGAACAGTTGGGGTGTCACACCGACGGATTCGGATCCGTGGCCACGATGGCAGCGTCCATCCGTTTGCGGTACAGCAGC
CGACAGCACGCAACTGCCGGCGCGAAGAGCGGGCGCTGCAGCTGTTCCGGCAGCTCAACCAGCGGCTGCACCACAAGAAA
GAGAGCCGGCGACGCGACCTGCAGTTCACGCTGCCACTGGTGGTGCCGGTGGCCCAACACATCCGCCTGGTGCAGGACGA
CCCGACGTACGTGTCGATGCAGACGATCTACGAGGAGCACTGCCGCGAGAACGGCTTCAGCAAGGATGACGCAGCCATCT
TCACGATGGAGAAACTGGCCGCGTTGAGCGATGCGCAAAAGGGCGGCAGCAACGGCAATGGCAGCAACGGCAGCGGCAGC
AGCAACAGCCACGGCGGGCCGCCGAGCCAGCAGGCCATGTCGACACGGCTGGAGGTGCTGGAGGCCATCCAGGCGACCAA
GGTGCCGAACACGGTGCTGCTGGAGTATTTCCAGCGGACGTTTGGCGACTTTGCCGACTTCTGGCTCTTCCGCCGCCGGT
TTGCCTACCAGTACGCAGCGACGACCTTTATGACCTACATCCTCTGCGCGGACAAGCGGTACCCACACAAGATCAACATT
GGGCGCGGCTCCGGCAGCGTGTGGAGTGCCGAGGTGATGCCGTTTATGCCGATGAACCAGCCGTACTTTAAGAACCCGGA
GACGGTGCCGTTCCGACTGACGCCGAACCTGCAGGCGCTGATGGGCCCGCTGGCGGTCGAGGGCATCTACGGCAGCTCCA
TCATGGCCATTGCCCGCAGCCTGGCCGAGCCAGAACAGGAGCTGGCCTATGCCCTCACCCTCTTTGTCCGGGACGAGATG
GTCTTTTGGTTCACGAGCAATAGGCACGCTCAGCAGATGACCGAGGACAAGCTGCGCCGCGCCGTCCAGGCCAACATCGA
TCTGGTGACCAAGCGGGCCGCCAGTCTGGCCCAGACGCCCGTCGGCAACCTGCCGGCCCATCAGACCGCCATCGACCTGA
TCGCCAAGGCCGCCAACCCGGCCAACCTCGCTATGTGCGACGTGCTGTGGATGGCGTTTTTGTAGGGCTGGATGCCTGAG
AAGAGAGCATCTTGGTGCAGAGATCTGAGAAAGATCTGGAGATGGAATGGTCATGGAATGCGACGTCTTACGATAGACTG
GAATGGTGGTTTAGAGTACTCCGTACACGATACTCGGATAGTAATGGAATTGTCTCGTGATCACGCGGATGTGAAGTAGT
CCCAATCCCAGCCAAGAAGGAGAAGGAGCACCGCCCGTCGCTTCCCCGGACTAACGAGAACGACCACCACCTGGCCGTCG
TTTTCCAGTGTGAAGTCACTTGTGTAAGCACGTGATGTTGATCAATATAGCATTCGTCCACATCTCTTGCAGTCCTCTAC
TCTGCAATCAACTTGTAAACCCTTATTGTTTCCGCACATTCAGCTATCTTAACACTCTCATATACATCAGACGATCCACC
CACAACAAATCAGAATCCATATAAAACCAACCGAAACGCACAACCAAAAAACCCCCAAATATGATAGTACTATACATGTA
TGTCATCGTCCCGTAGCCCCTATTCCACGATTGGGTATCAGCATAATATGCCTTTGCATCCGCACGGCATTCGTATCAAC
GTAAGAAAGATTGACGAGATCGGAAGAAAGCCCGAGATGCTCAGAACATGATCCACTCCACCTCGATTCCCGGCCCCCCA
ATGCACCGGTTCCAGCTAAACGGCGCCCGACAGGCCATATCGCCCTTGACCCCGCCCTCTTCCTGGCCGTTGTTGGCCCA
GAGGTGTTCCAGCACGTCCAAGGCTGCCAGGTTGTTCATGTAGCCCGACCGCGACATGATCTCGCGGCACTTTGATCGCA
CAATCGTCTGCTGCAGCTCATTGACACATTCGCTGCCAGCAACAAACAGAGGCCACAACAGAAACTTCTCAGCCGACGAC
CCTGTCTCCAGGCTCGTCGCATAGTACACCACCTGACTCACAAAGTTGCGGAAGCTGCTGTCCGTCGAAGGCGCATTGGG
GTTGGCCAGTCGCTCTGTATACAGAAGCGCTGCATATCGAAATGCCTCCGACAGCGAGCAGAGATCCCGCAGCTGTGCCG
GCGTCGGTGTTCCCACACCGTGCAGCCCGTTGACAATCTGCTGAGAGTCGAACTCCCACGATTGCAGCGCAAGTCGCGCC
TCCTTCCACTCCGTCCAAAATGCTAGCCGCTGGTCTTCGTACGCAGTCGGCGACAGCAACATGTCTTCGTCATCCAACGA
CGAGCCATACCGGTTATTGTACACGTCCGTGTTGATGTGGCGTGGATGGTGCTGGCGCGGATGGCTGCTGGTCGGGCTGT
AGAGTTGGCCCAGAGCGGAGCCGAGGGGAGACTGCGAGCGCGACGAAAGCGCCCGCGCAATCGCACTGTTGTTTCCGCCA
TTGTTGCTGCTGCCACTGCTGCCACTGCTGCTGCCCCTGCTCGCCGGGCCCTTCACTTGCCGGCTCTGCGACAGGAGGTT
GAGTCGGCCAAGCTTGATTATGGTCCGGAATAGCTCACGGTCACAACCAACCAGGTTCTCGGAACCTGGCGGAAGGATCT
GGGCATCAGAACTGGCACCGTGCACAGAGTTATCCAGCTGGCTCTCGCGGTCATTGATGCTGGCAGATATGGCGTCAAAG
TAGGTAAATAGGGCCTCCATCCAGGCGTAGTCGCGCGACGGCGGGAATGGTGATGCCCGTCGCATGGCCAGGATCTTCTT
TACACCGGCAAAATGCGTATGGAAACGAGCAATGCCCGACTCGGCCATGCGATAGTGGCACAACAGGAGAATGGTAGCCA
GCACCGAGTCATGACGGGACTTGACCGGGTCATTGAGCTGCTCGTTCAGCAGGTGCACAGCCATATTGCGGTGCTGGTAC
TCCTCCGAGACCGACTGATCCCCCTGGCCGGCCGAGTCATCGACAGCGTCCGAGACGTCACGTCTGTGCTGGCCCCGGCT
CAGCTTGCGCTTCATCCGCAGGTTGCACGCGGCCAAGGCGCAGATGGCGTGCTGCAAGCTCCGGCTTGACCGTGCAAGCT
GCATGATATGATAGCGGAAAGGGTTTGTGGGCCCGTCAATGAAGACCATGGAGGGGCACATTGTGTTTTCGTAGTAGTCG
ATAAAAAAAGGCATTTTGGCAATGAGATCCAAGTTGATGGAGGTATTTTGCCCATCCATCATGGCGGGCCACGCCGCAGG
GGCGGCATCCGAGCGCATCGGGGGAGACGCATCCTCGTCACCATAAGGGCCCCAGTACTGACCAGCAGACTGGGCACTGG
TGCTGTAGGCGTCAATGTCCGAGGGGGTGCCTAGATGGTGGAGTCAGGAACGCTGGTCGGTAACCTCCCGAGGGAACCGT
GGATGGAGCGGATGGAATGACAAACTCACCCATCGAGTCGCAGTCCTGGAGTAGCCTTGCGCTAAGGTTTGAATCGTAGT
TTTCCGGGTGCGACGAGGGTAGGCTGGAGCTCTGTTCAGACGTGGCGTATATCAGACTCGGGCAGGACGTCGGGGCCGGT
CGGCGGTGCTCGATCATAAGACTGCTAGTGGGACTCTGGGGCACAGGGGAGTTTTGGCCAGTGAAGCTGTCGTAGACCAT
GCCTGCAGGACTGTTCATAAAGTTTATTTCGTCGGGAGGGAAGGAGTGGCTGATGGGCGACATGTAGTCCACATCGCTCA
GCGAGTCAATGGAGGCAGAGAGGTGAAGCTCCGGGCCGGGATTCTGACGTTGCCGTTGTTGCCGTTGTTGGTGTTGTTGG
TGATGCGGATGCGGGTGAGGGAGCTGGCGCTGGTGCGGGTGCCGTTGCTGGTGCTGGTGCTGGTGCTGCTGGCTGTAGGG
ACCAGAGTCTGCCGGCAAGCTGGAAGAAAATGGAGGGAGATTCGCGGAAACAGGAGAGGGGGTCCAGTTCTGGTGGGCAA
GGCTTGCCGGGACGGACACGGAAACAGACATATGAGCGGATGTAGCAGCCACGTGGCCGGGCGACATATGGGCGAGCTCG
TACGAGTTAAAGGAGGGAGTCGACATGGAGGAAGAGGTGTCAAAAGCCAGCTCGACGTCGTCTCGGAGAGCCCGAGGCGT
GGTAGCGATGGAAGAAGCGCCACGTGCCGACATGTTGGCGGAATTGACGACAGCCAAGACGTCCGAGTCGTTCCATGAGC
TGACGGCCGAGGCGACAGATTCAGCTCTCTGGCGGGCAGGCGTCGAGGTGATGGACTTTTTGGACACGCCGGACCCGATG
CCAGGGTTGACGGGCGGTGCCTTGGCAATGGGCAGTGAGAGGCCGCGAAGCTTGCCACGGCTGGCCACGCCGACACCCCA
GGTCAGCTGGGTCTTGTAGCCGGAGCACTCATTGCCGACCTCGAGGCATTGCGAGCAGTACGGCCGTCTGCGGTCGCACT
TGATGTTGCGTTTGGAGCAGGTGAAGCAGTCGTCTGCAGCCCCGCCAGTAGGAGCACGACGTCTGCGCTTGCGCACAGCA
GCAGCCGAGGCGGCCACGGCAACATCGGCAGCCTTGGGCGGTTGGACGTTCAAAGGGACAGTCATTGTGTCATTGACTGC
CGTGTCATGGAAGGATGGATCGTCTAGGTCGGATTTTCACCTTCTGCGTGGCGAGTGCTTCTTCTGTTACCTCTGTCTGC
GTTGTTGCGAGGCGAAAAAGGATTTGCAGTAGCGGGAGGCGGAAGACGGCCGAATCGCAGTAAGAAGAACATATATATGA
CAGGTGAGCAGGTGGAAAAAAGCCAAGTCTGGATCACACGACAGGTTGGTAAAAACGGGGGTGGCCCTTGGGAAGGTGGA
GGGAGGCAAAGAGACAAATGGCTGGTGCTAGTGGTCTGTCTTTTAGCGATATGATAGTATGGATGGGGGGGCAAGCACGT
ATTGATATGGCAACAAGGATAGCCGTGACACGCCCTGCTTGGAAGTTGGGATGTGGATGTGGGAAGACGAGAGCTCGAGG
TGAAGAAGGAAGAGATGAGATCTTGGAAAGAAGACGAGAAGACCAGCTGAGCAGTCTTGAGATATGGGGTCTGCGGCCTG
AATAAAGAGAAACAGGTCTGGTTAAAAGAAGAAGGCACCCCCGTGTGAGCTCAGCGCCTGCCAGACGATCCTGTTATGGC
CACTGCCTCTAACGCATCGTCTCTACATTAGCACAACCACCAGAGGGTACAAAAGGGTACAAGGCGCAGTGGACGGGAAA
AGGTGGGGGGGCTTAGAGGGGAAAGGGGGGGTGTAGAGGGCGGAGGGGGGGTGTGATATGAAAGGGGAGATAGAAGGGTT
GAGTGGAGAGAGTCTGAGCGGACGATTTAGGTGTGGGCATGGTGATGGTGTCGTTATTGCTGCTGTGGTGGATGGGGACA
ACGTGACGGGGCCCTTTGCTCCTGTCGGCTCTGTTTTTCTTTCTTTTTCATGCTCCGTGCATCGCTCCTGCCATGTTGTG
GTCAGGCAGCGCGACCGAATGCGACAAAGCAGGACATCCCCCAAAACGAGAAGGATCGAGCGAGAGGACAAGAAGGGACC
AGAGGGCAGGAGCAACGCAGGCGGTGTACGAATGCTCGTACATGGTAGCTTGCGAGCAAGAGCAGACGCAGCTAGACAGG
CCGTCTGGCAATAGCCTCTGGAGAGGGAAGCAGGAGCATCCCACCGGCGCCGAGGCCGTTGTATCTTACAAGGGCACCCG
GTTGTGGCTGGGCTCTCCTCGGTGATCGGCAGAGGGGAGTAGAGAGTCGAGGAAGGAGGGGCGGCGGCTGCAGCTCAGAG
AGGGCAGGCCAGGCGGCCAGAGAGGGAAAGCGCGATGGGGCGAAGGAGCAGGGAAGGAGGGATTAGCGTCATTGGGGCCT
GGCTGCGACCGACCGACACGGACAACGGACACGATACGATGCGTGGAGAGAGGAGCAGGCACCACATACGAGCAGCATCT
CCCGCCCCTTGTCTCTTCGTATTTCTCCCTTCGTCTCATCGTCTCCGCGCCTCTATTGGCACAAGAGAGGTCTGCCGCGG
GAAGCCTGCTATGTAACGGCCACCCGGCAGCAGGGGAGGCCCGCAGTCGTTCTTTTTTCCTGCTTTCTCTCTTTTTTCCA
TTTTGCTGCTCACTCTTAAATTTAGACAAACACCCGTCTCGCCGGCCCTGGCCTTCTCAGCTCGACGGACATGCCGTCAT
GTCATGATGCTACCAAGAATGCCACCGCGGCTGTGTCGAGTCCCGGAAAAAAAGAAAGCACAGAAGCTTAAGTATTCACC
GAGCAAAAATCGCCTCCTCCTGCACGGTGGCGGCCGACTCCGTGTCTAGGGCAAAAGACGGCCCCAAGGCAAGGCCGGAA
GCCTGTCGATGCAGTTTCTCCCTCAACACGAGCAAAGCTGACGCTCGCGCCTGAGCGCTGCTGGCATTGCCCCTGAGTAC
GGAGTATTCTGTACGATACTCTCGTAACTACGAAAGTAATCGAGAGGTGGGGGTACAGCTGGCGTCCTCGCTCCTCGCTA
TCCGTGCTTTGTACTTTCAACTTGCCTGCTTCTCCTCCCTCACCGCGATGCATGGCGGGGCACGCAAAGCTGGCTAGTGT
TCGTTACGAGCTTAATATTCAGACCATGTCGCAGATGGCCGTCTGCAAGAGCAGCGGCAGAAGCGGGCATCGGTCTAGCG
ACGGCTTTGCAGCAGGATCGCCCTTTTGGAAATTTTACTACATACGCATCGGCTTACGGTGGCTGTGCCTGTCTCTCTCT
TCCCTTCTCGGCGACTTCCACGCAGGCTTCCATCGGTCTTCCATTGCTGTGATTAGACGCCACTAGAAAGAAGCTGTTGA
ATATAGCCAGCAGCCCATCTGCAGTTATCTGCAGCCATCTGCAGCCATCTGGGCCCATCTCTGGCCGCTAAGGGCCAAGT
TTCGACCCCCCCACGTCTGTGATTCGAAGCCGGCCACCAATGCATCACTATGCCTGCTTTGGGCTAAGCTCCCCGCCGAT
GCCCAATCTTGTTCCTATCGGCCAACTCCGAGTGGTGAGACGCGGTGCTGAAAGATGTGTGTACAGGTAAGATACGTTGC
TGTTGGCGAACATACGTAGCAGCGCATCTGTGCAGACGAACATGAGGGGGGGATGAAACAGAGGGGACAGAGGAGGCGCT
GTCTGTCGAGAAGGAACAGCAGCGGATCAATCGCTTTAATCACTCAGGGCCGCCTGGACGCCAATTGACACGCATGAGGA
TGCAATTCGAGGCAGCCGGGCGCTGCTCGTATTGCACCTCGTAAGATAATAATACCGTCTGTCTGTGCACGGCCCCCGGC
AGACCCGGGGAAGAGGACAAGAGGAGTAAGAGGGAAAAAACAACAAGTAATAAATAATAGAAAGAGGAGAAAGAGGAGGA
AGCGAGAGAAGAGGAATAATACAGATGTGGTGAGAGCCCGAGGCATTGTGGAAAGAGTCCGGTGGCCTTTGTTTTTCCAG
TTGCAAAAGGCTAGGGACTCAGAGTAGTGCCAGAGCCACTGAAGCGAGAGAGTCCTAGCGGGGAGGCCTGGTTTCTTTTC
CTTGCGTGAACAGAGAGTCGGGGCGCGTTCTAGGCGTCGAGCGCGGGCCCGTACTCTTTCGGGTTGTCCTCGGAGCTCTT
CGCTCAAAATCGCACGGCTCATCGTACGTTGGGAATGATAATTGTGTCAGAGAAATCGAAGGCTCTCGGGTGCGCGGCGA
CTCTCGGAGATCTGTCCGTCCTGTTGCAGCGTCTGCAATTTTCGCAATGATTGCAATTTTCGCAATAATTGCAATAATCG
CAATAATCGCAATAATCGCAATAATCGCGATGCATTGCAATATTCCGCGTTTTCACATGCAAATGCTAGCCGCCTTCTAA
TATTACGAGTAGTCAACTTGTGTCTTGTAGAGCACCGACCTCTTCGTGCACCACAGTCGACTGCTCTGCCCCTCTTCCTC
TGGACTTTCCTTCCTCTTTCTGCAGACGGCGCCCCACCTACAGGCTCCCCCTTGGTTTGTGTGTTACCTGTAATCATGAA
AACGTACTATGGGGTACTTCTGCCGCCCTTCAACCGCGCCTCTCCTTCTCCTGTCCTTCCTCTTTTCTTTTTTTCTTCTT
TTCTCTACCGTGAAGAAGGGATGCTAGGCTGTTTGGGTGTTAGCGAGCAGCCGGTCTGTAGTAATGACTTCTATCATCCT
TCTCGTCTGTTTCCTCTTTCATTCTTGGGACGCACGCAATTAGCTCCGGACCCCAGCTATAGAGGGTGCGGGTAAAATAG
ACAAGGGCGCAGAAGAAAAGAACACACAAAAAAAAATAAGAGAAAGGGGAAAAAACCATTGGGCCCTTGCTAGCACGTAT
AGCTCACAAACTAAACTACGTCCAAACTATGTACAGACTACTGCACTGCGACACACTACACCCAAGGACCTATCTCCCTC
TCTCCTTCCTTTCTGTCTTCTGCACAGGCGGTGACGGGCGAGCTACAGCAGCTAGAGCGCGGTTGGTGCGCCAGCCAACG
GTGTTCTGTCCTGCTTCGAATCTGCTTCTACAGAGTGGAGTTTCCTGCCTCTTCGGGCCGTGCTATCCCTCTTTTGTTGT
CCCGTCGTCTGTCCTCGTCCTCGTCTTCGTTCTTGGCGGCCTCCTTATCTTATCATGGGCACCCACGTCGACCTCGTGTT
CTGTCCGGCTTCGATCGCAGCTGCAGTTATTAGCTGTTTCTTATCTACGAGGGCCCCCGTACACCGAAGAGGCAAAGTAG
AAGTACTCGTGCTCACACGCCGGATGTGGTGGCATGCAAATAAGCTTTGGGGATTTTCCCTTCCCCACCTCCACGGAGGA
GTTAAACCCGGACGATCATGCAACAACTACAGTATTGGATGCCAACTTGCCAGCGGAACAGCCTGGGATCATTTAAATTG
CAGTCGTGAAGCGGCGGCTGCTAGCTCGTGGCTCAAACTTAAACAAGCAGGTCGTCGAATGTGGAACTTGGCCGAGGTAT
CGTCATACACGCCAGAGGCCATTCGGCTGCCTGTCCTCCAATGGGCCGAGCCCGTTTGCAAGTACTGTTGATCAGTGCCG
ATCCTGTCTTGCCGAAGGATCTCCCGACCTCGCCTCAGCTCCAATCAGTCTGGGGTGTTACCTGAGCTGTCTGACCTGCT
GGTCTGCCTGCTGGCCTTGCCGTCCTTCTTTCCCATCTGCTCTCAAATGTGTAGAAAGAGCGGAGAAGAAGCAGGGAATC
AAACGACCCCGAAAAAGCGTACAGGACCCTGCTAGCCTACTGCAGAGTATGTACGGAGAATGGTCCGGGCGCCCTCCTCA
CTCCCTTATATTGCGCGCCTTATTGTTTTCGGCTGATGCTGCGCCAGTGCGTGTTGTGACGACGGTTGACGCAAGAAGCG
CGTGGGTACCTTAAGGTACAAGTACCGACTACGTATTCCTACATACATAGCTTGTACGACTACTGGCCGCCTGCGCTATC
TTTGTCGGCCGAAAAAGAGCCTATTAGCTACAGCGCTAACGGCTCAGGTCCTTCTGCTGCGCGCTAGAAGACCTGCAGAA
GCCTGCATAGAAGCTCTTTGCCCGCTGTTATCCTCTGCTTTCCGCCACCGGAAATCTCCTTTGCCTAAGCCGCATGCATG
TCTTTCGCTTTTGTTTTTGCCTCGTCCCTTTCCTCACCTCTCCGTTTCACTTCGCTCTCCCTCGGTGATCTCCCCTCCTA
AGCTCGGCCTCATCGAACTTGCCGCCCTCTCCTGTATTTCATGTGACCGTCGGCAAGTGGAGGGTCTGCCGCCTGTTCTG
AGGATGCGCTTCTCTTCTCATTGGCTATACAAATTCCAGTTTTATTTTCTTCTCCCCCCCCCCCCCCTTTTCTCCACCGT
TACGGATACCCCTCCCCCTCTTCTGCTCCCCTTTTCCTACTACATAGTATGTACGGGCTCCACTTGGCAAGGGTCTAGAA
GAGGTGGAATACGACGTCCAAAACAAGCCTCGGACGCAAGTCATTGGAGGAAGGTCGTGAGCGGAGGGGATCGACAGCGA
TGCAGCTCCGTAGACAAAGTGACAAAGCCCCCCTTGTCTCGTATTCTCAACCAGCGAATAAAGTACGCTACGAGGAACGA
GTACTCCGTACTCCGTACGGCATCATTCTGGTGGGCCCTTTCGCCTGCTTTATGGTTCTCACCGTCGATGGCCATCTGGT
CGTACGAATAGCATCGCGGGTATTGCCTTCTCAGCTGCGGAACCATACGCGAGAGCATCTTTGAGATACGCAGTCCGGCA
CAATCTCCGCCCTCTGTCCCCACGTCTTTCGCGCAGGGACTGTCTCGTTTGCCGGGCCATTGATCGGCATAATGCGGAAG
AAGACGATATCCGGCTGTGCAGACCGGGAAAGTTGTATTTCACCCGAGGTCTCTCTGTCTGTTCGCCGACCAGGGCCTTT
CTGCCCGTTGGCAATCCCATGTTTGCCTTTGCCATGTCTGCCAGCTCTCCCATATCGGTCAACACGGCCGCTTCGCTCTT
CTCGGACAGACCGTGGTGAGTGAGGCTCCATTCTTCGCAGTCAGCCCAAGCCATCACATCGTATCTCGATATACGGAGTC
GTATCGCCTGCCGTATCACCTGCTGCAACCGATGGGTCTGTCGCCTTCGGATGGCAGCAAGCCCAGGATGCCACTCTCTC
GCCTACGCGCCAGATGGCCTGTTCCTGCTGTTCTGTCCAGGGCCCCCTTACATAGTACGAATACAAATGCGTAGCCACCG
GCTTATCGGCCATGCGTGTGCGCAGCACGTATCACATACATATGATGACAGTACAACTGCCTATTGCTCGTTATCGGACG
CAGCAGATTATGTGATTTATTAATCGGTCGATACATAGCTCGCTGCCAGACCAACCGTTCGACATTGTTGTACGGAGTAC
ATTGCATGAAACGTTACAACAGGCTCCACCACTCACTGCTTTTTATTACACTTAGTCTTGGGTGGCCCACCATCCAAAAA
GTCGACTGTCGGGAGAAGTCCGCTCTTGGTTCCGACCTCTGCTCCTATCCCGTGCGCCTCTCCCGCGAGCGAGAGCTTGT
CTACGACGTACTCCGTACGGGTTAATCAGCTAAGCGTCGCCCCAGTCCAAATCCTTCCCCTGTCGCTGTCTTCCCTCGCC
AAGCGCTCGCTGCAACGGCGGAATGAATATAGGCCCCGTCTTTCCTGCCGCTGCAATGTCCCTGGCTGCCAGCCATTGGC
TCCTTCGTTTCCTATCCTGCGCCCACTTGTCCTCCCTGCCGTCGTATTGCTCGGGCCAAACGTCCCTCCTCGTCCGTCAT
AGTTTGTAGTTCTTGGAAGCCGGGGTGGCACGTCTGCCCACACGACAGCGGCCGGCTCGCACTCTTTGTAAGATATGTCA
TTCTGTATCCATCAGCATTGTTTACAGATGTCGGCGCATGGAATCATGAGCCGCCGTTCCACCGTTGCGCACTGTCTGGT
TTTGTGCTCGCCACGCCGAACAGATGACGCCCTACCAGCATGGCGCGCATACCTTACGCCCCGCGCCTTCAAGCACCCTG
GACCGGGAAGGCATGACAGAATGGGGGGGGCCATTTTCACGGCCAAGGGGGGTGTGCTAAGCTGTACTATGTATGTATCT
TACTCCGTAGGGGCCGGCAGAAAAGTAAAACGAGCCCTACGATGCCACTGTGACCCTATGGAGTGCATGGTAGATAGCAT
AGCTTCGACTTCCGCTTACTGTTTAGAAGCGATGCTAGCCGGTTTTGGCAGGCGAGAGGGAAGCTTATCGAGACGTTGGA
GAGAGCCGGTGGACACGAGACGACCAGAGATCTGGCCGAATAACCGAGCAGAACAGGACACGAGGCAACGGGACAGCTCT
TCCTCCCTTCTTCTCTGCCTCTGTCTCTGAGCTGGCTCGCTCGCTCGTATCTACGTTCTCTTACCGCTGTTGACTTAGCG
AGCTGCTCATCCTCTAGTCCCTGGTCAGATACATTGGTTGAGCGTAGAAATTATGGCTTGGTTCTGATGAGGCTCTCCGA
TGTCTGCGATCGTCTAGACATGTCGATCTCAGCCCCTTTCTACTTCCTAGTCATCGATTCCATCGTGCACTCTCATGTGA
TCAGCCCAGCTACTTTCTCTACTGTCGTGATGATCCAAGACTGCTTTGGATGATGCGTGACGCCTCGTGCGCAGCTTTCG
CGGTCGCAATGCTAGCTGGGCCAGAAAGTACTGAAAACAGTATTTCCCCATCCTGTCTCCGTGGACATGTAACAAGCACA
CCACGTTACATGATTGTTCCTTTTTCTAGTCCACCTTCAGCTGCATGGTCGTAGGCACCTCCCGTAGAGTAGCAGTCTCC
AGAAACCCTTTGCATAGCCGCATCTTGTCGGTTCTTTCCAAAGATCTTTTCAACCTTAATAGTGGAGGCCTGGCTAATGG
ATGCTTGGATCGCCTCAGCGAGGCGGTTTGCTGCTTTGGGATACGATCTCTAGGACAGCATACAGATGAGGAAGGCGGAT
TTGATATTGACCCAGCATACATCCTATTTGGGATGCTCTACGATGGGCATTCGTAGCCTGTTTAATGGGGGCTTTTTTAT
GGATATCCAATCCATCATCGACCCTGTCCCTGAAACATCATGGCCAAAAAGGAAGCTGTGTTCGAAGCGAACGTATCCTG
TATATCCGGTTAGGGTCTGACCGCCATCTCAGAGAATTCTATAAAGTGTATTTTGGGCCAAGCATTCCCAAGATTACCTC
GCTCATCGCTAATTGTTCTCAAAGGGTGCGTGTCTTTTGGTCTCTTTCTCATGACCCGTCAAAAGACCCCTAGAACGAGC
GGATGAAATGACGAAACCCCCTTAGCATATGTGTAACATCACTCATGTCTTTCAGATCTTGAAGTTGGGTCATCGCCACA
GGGAAATCCCAAGGCAGTGTAGACGTCCTCCTATAGTTGCTTTGAATGGATTTTGGAAAGTATCAAGTGATCCACGATCT
GAACAGGACTTCATCCTTTGGCCATAGTGTAACGGCAGGTTGTAAGTTATCTATCAAACACCCCAACAAATGTACTTGAA
GTGGTCTCCGTCAAGTCAGCCGCACCGTCACTTGCCTCCCAAGCCTCAATACCAGAAAAATGCCATGGTGTGGTGCGATC
GTGGTCGCATATTCCATACCATTCAAAGACTTCAAAGACGAGTGTACGAGTACAAGAGGGAGACAACTTTTGTCTACGTG
GCTCTGAACCAGATTTGGCATCCCTTTCTATATGCCCAGCGCCTAAGATTTGTCACGGCTGAGGAAACTCTGTATCAACT
ACTATTTCTTGTTGCAGAGGTGCAAATAGAGGTGGTGGCATCGTGCCACGAGCATGGGTTTCCATCAGAGCAGATGCCTT
CCGTTTTTCTATTTTGGAGGGCGTAGTTTGGGTGTGTGTGGTTGCAATACAGACTGCAGTCACACGCAGTCTAGTGGAGA
TCGAGGCCCATATCACGAGCCTTCTGCCATGTTAAAATGGGACCGAGATTCTCACTGCAGTAGAAATCCTGTATGCCGAA
ACTAACAAAGATATTGAACTCATTGGGACGAGATATCCATGCAGAGGTAGCATGGTAAAGCAAAGCACAGTATAAAAACC
GGTCTAAGCTGTTTAGGAACAAATGTGCAAAAAGATGCGAAAAATGGAGGCAAGTGACTAACATGCAGAGTGAGGTGAAT
TCCTGGGAAAGAGAACAATTAGGAAACAACCGTCATATGCATCCGCTTCTACGGGAGCTAACGCTTTTCAATGCGGTCTG
ACTGGACACCATGTCAGCGGTGATATCTCTTGGTAGGTTCAGACGGACTCACATAAGGCTAAGTGACGTTATAGATGTAG
TCGTACATACGACAATTATCACGGGGAGAAGCAGTGACATGCACCTTTGTTGATGGGCGAAGCAGACGCAACTATTCGAA
TCTCATTTCGCCCCAAGCAGCCAGAAGGTGAAGTTATGGTTTCATATTTTCAATTGCTACCGAAAAATGGGGGAATAAAA
AAACAATCTAATTAACCTCACAACCTCCCCTTCTCAATTCCATCCGCATCCTCATCGGGGGCGGAGGATAGTCATGAAGC
CGGGGCCTTCTTCTCGAGGGTCTCGACAATGGTCTTCTCGAGCGACTCGGGCTTGGTGGTGCTGGCCCAACGCTCGACGA
TAAGACCGTCGCGGCCGATCAGGAACTTCTCAAAGTTCCACTTGATGCGCTTGAGGCCGAGCAGACCAGGCTTCTGCTCC
TTGAGCCACTCGTAGACGGGAGTGGCCTGGTCACCGTTGACGTCGACCTTGCTGAGAATGGGGAAGGAGACGCCGTAGTT
GATCTGGCAGAACTCCTGGATGTCATCGTTGGAGCCGGGCTCCTGAGAGCCGAACTGGTTGGAGGGGAAGCCGAGGATCT
CAAAGTCCTCGCCGTACTTTTCGCGCAGGTCCTTGTAGATCTTCTCGAGGCCGGCGTACTGGGGCGTGAAGCCGCACTTG
GATGCAGTGTTGACGACGAGGACTACCTTGCCCTTGAACTGGGAAAGGGGGAACTCATTGCCCTTCTCTGGGGTGTTGTT
AGCATTATTGGGGTCTGGAGGGGAAAAACATTGATATGGGATGGGGATTGGAGGATTGAGGGGTATTGATATGGTAACGA
TTGCAGCACATACTGTCGAGGGGAGTAAAGTCGTAAAAGGTCTTGGCCGACATTGTGCTTTGGTTGACAGTCGTCTGGAC
AAACTGCTGACACTGGGTGGGGGATAAATGTTGTTGAAGGAGGGGATGAGAAAATTGCGACGTTTTGAAACGGGCGACAG
CCGGACCTTTTATTCAAGGCAAGGACAGACCTGAGCTTTGGGCGGACACTAACGGCTGTCTGAACACTCGTAAGATACCA
TTGTGCAGTAGGCCGTGGTCATGACATAGCAGACAGGCGGGACTAGCATGGAATCATCAAAATGCGTGCTTTGCAGGAAT
AGTAAGGCGGCCGAACTCGTTGACGATCGGGGATGCCAAGGCGTGGGAAATGTGGGACCCCTCGTACCAGGCAGCTTCCC
GGAATAGCAGCGAGGTCGAGCTACAGCGAGGGCAATCGATTACATAATACATACAAAGACCCGCGGAAGGCACGGGTTGG
TGACGTGATCCATCCGACAATGCAGGAAACCATGCTTCTTTCCACGCCACGGCTTTTGCTTGCCGAGTGCGGGCTAACAG
CCCAGAAGCAGCTCGAAGGCGCGCGCGGCTAATGGTAGCCAAGTTGCTCCGGACGCCGCACGGGGCAAATGGAAAAAGAT
TAGAGCACAAAGACACGGCGAGCGCAGTGGAGACTTCAGCCCCCCCAGCAGATAATATTTGGAATCTTCTTTACAGCTGT
CCCGCCCGCGGCTTCCCCGCCAGAATCTGTGTACCGGAGTACAAGCACTAGGCGACTTCGTCACCCCACTTCAGAGGCCT
TTGTCGCTGTTTGCTGTCTTTCAATCGCCGGCAGACAGCGCCGAAAGCCCGGCTTCCCGAAACCCGTTGTTTTCTCAATG
GCTGCAGACGCTGTGGGCCAGGACCGCCATATCGTCATCGTTGGTGAGAGCAGCTGTGGCGCAACACGACCGATCCCCTT
GTCCTTCTGCGCTGACGACCGGGGCCATCATCACATAGGCGGCGGCGTCATCGGGGCCACGACGGCCTACTTCCTGACCC
GACATCCCAGGTACGACCGCAGGCGACATCGCGTCACGCTCCTGGAAGCGAGCACGATCGCGGCGGGCGCCTCCGGCAAG
GCGGGCGGGCTGCTGGCGCTCTGGGCGTATCCGGACGAGCTGGTTGGCCTCTCGTATCGACTGCACCGCGAGCTGGCTGA
GGAACACGATGGCGCCCGACGCTGGGGCTACCGCCGTGTGGGATGCGGATCCGTGCGGGCGACCGTGTCCCATGCCGACC
TGAAGCGGCGTGCTGCCGAGGTCGAGGCGATACGGCAGGACGGGCAGACAGACAGACAAGCACCCGACAGCGCGCCACGG
CCACACGATCCGCCGCAGAAGCCGTGGGAGAAGCTGCCGAAGCAGGACGAGCACGCGGCCGGGCTGCTGTCGGAACCGTC
GGCGCAGCTGCCGCCCGACCTCGACTATATCGATGCGGCCGTGGTCGAGCACTACCAGCAGATGGGCCAGCCCGAGACGG
CCGAGACGGCTCAGGTGCATCCGCTGCACTTCACGACGACCCTGGTTTCGTTGGCCGAAGAGCGTGGCGTGAACGTACGG
CTGGGGGCGCAGGTACTGCGCATCGTCGAGCGAGAGGCCGGCGTCGAGACTGTCGAGTACCTCGATCGCAACACCCAGAC
CGAGGTACGGCTGGATCACGTGACCGACGTCATCGTGGCAGCTGGGCCCTGGACCGGCGTCGTGTTGCCACGCACAAAGG
TCACGGGCCTGCGGGCACACAGTGTCGTCTGGCAGGCCGACGTGGCGCCGTATGCCATCTTCACGGACGTGGCACTGCCG
GCCGACTACGTGCCGGAACATCGGGTGCAGGCCGGCCAGCGACGACGACGCCACACCGGCCGGGTCGACCCCGAGATCTA
CGCCCGGCCCTTTGGCGAGGTCTATGCCTGTGGTGAACCTGACGTGGCCGTTTCGCTGCCGGCTACGGCTGATCTCGTCG
CTGTCGACGCTATCCAGTGTGCTGATCTCGTCGCCTATGCTGGCACCGCCAGCTCGGTCCTTGCTGCGGCACCCGTCACC
GTTCGCCAGGCCTGCTACCTCCCGCGCCACATCCGCTTTGGCGACGAACATGGCCCACTCATTGGCCGTACGCGCACGCC
CGGTCTCTGGGTGGCCTCGGGCCACACCTGCTGGGGCATCCAGAACGGACCGGCCACGGGCTGCCTGATGGCCGAGCTGC
TGCTGGACGGCCGCGCCTCGAGCGCCAACATCGACCGGCTGGATCCCCGCAAGTTCAAGGTCTGATGTATACGGATCTAT
TCGTCGCAGTCTGGGGCCCAAATGACCCCATCGTCTAAGACGGCCTAAACGGGGAGGAAGAGCACAGGGCAGAGAGCCAC
CCTGGACCCACCCTCCCTCTATCTGATAGAGAGATAATAGAACCCGACATGTAAATGCAAATAGAGGGGCGTTAACCGCT
TGCTTTTTCGCGGCTGCTACAGCGCCAGCTCAATGGCCATGACCTCGGCGATGCCGTCGGCAATGGCGGCCACGTTGGCA
GCAGGCAGACGGGGAAGCGGGCGACGCGGGAAACCGCCGTAGCCGTAGTAGGTTTGGATGGCCTGCTTGGTGCCGGCAAT
GGCGGCCTTTGTAAGGAACCAGTCGCCGCGCGCGAGCGTTTTCTGCAGGGCGACGGCCTCGTCGGTCTTGCCCTCGACAA
AGAGGTTCCAGACACGGACGCAGACCTTGGGCATGACGTTGGCGCCGCCGGCGATGATGCCGCTGCCGCCGCTGACGAGT
GTCTGGACGGTGAAGTCGCACATGCCGCCAAAGGCCATGTAGCCGGAACCGGTGGCAGCGGGCGTCTTGGCCTCGGTGGC
GAGGGCGACGCGAGTCAGCTTGCCGGTGTTGCCGCATGTGAACTTGGTGCCGACGATGTTGGGGTGGCGGGCCAGCCGGA
TGAGCGCGTCTGAGTCGAGGTCGATGCCGGACACGGCGCCGGGATAGTTGTAGATGATGACGGGCAGCGGTGATCGCTCG
GCCACCTCGACAAAGTACGCCTCGATCGCGCTCTCGACCATCTGCGCACGATAGTATGACGGCGGCAGCAGGAGCGTGTA
GTCGGCACCGGCCTCGCGTGCTAGCCCGATCAGCTCGAGCGTGCCGCGGACGCTGCCCTCGGTCGCACCCACGACTACCG
GCGTGCTCGTGAAGCCGGCCGCATCCAGTGCCTCGCGTGTTGCGCGCGTCACCGCCAGCTTCTCCTCGCGCGAGCAATGT
ACCGCCTCGCCGTTGGAGCCCATGGCCACCAGCCCGGCCAGACCAGCGCGCGCCAGACGCTCGGCGTGCTTCTTGATGGT
CGGGATATCGAGCTCCTCGGTGTCGGCGTGGAAGAAGGTCATGGTGGGGGCATAGATGCCGCACGGCAACGGCGTCCGTG
GTGCTGGCCGAGAGGTCCCGTTAGATGGCATTGTGGAAGAAGAGGAGAATGTAGGAGAGGGAGGGAATATAAGAGAGGAG
GAGAGAGAGAAGAGAGGAGAGAGAGAAGAGAGAAGAGAGAGAGAAGAATAGGGGATAAGAGAAGAAACGAGAAGAGATGA
GGAGAGAATAGACAGAAAACAAGAGAGAAGGAAGGAAGGCACAATGTGAAATCACTGTTGAGGCTAGAACAGCTACCACT
CACTTTATGTACCCGAGACTCAACACTCAGGCTGAATATTAAGCCCCTTACCCGGTGGGCCGCCATATGTTGGAGCGAAC
ACGAGCACTCATGCCTTCTGCTGACGTCTGTCTTGTGAGGCATGCATGTTTTCCTTGCCGGAGCACCGGCGCCTGTTCGG
CGGCCGAGCCCGGAGACACCTGCTGTCTTTGTTCCTTCAGAACCGTGGCTGCGGGTAGGTGGAGTGGGCCCGTCGATCTG
CAGGTGTTTCTTCTGTTCTTCAGGTGTGTGATGCCAATGATTGTCGACTGTCGTTAGGAAATGCCCTCCAACATCGCTGC
CCACCAACAACACCACTACCGCTAGTGACGGAGAATTTAAGCCGGCCAATTTTCCTCCAATCAAGACGCCAGCCCGGAAC
AGCACCTCATCAGCACCCCACGTTCCGCTAATGAGTAGTGCATACGGAGTACTCGTACTCGCAACAGGCCGATTTGGCCA
TGTTGGACGCTGTCTCTGCTTCGCTTGGTTGTGTCGCTTCGCGTAAGCCATGCCCGGTTCTGCTCGAATGGCGGGGAGCC
CTGCTGGCTGGACCTGGGAGAGTACGGAGTACAAACGGTATATGGCATATATGACGCCAATGCGTGGGGGTGGGGCTCTT
TCTGTTCTGGGGCGCCATTCCCCACCGTCCAGGAATAGGGAAGGAACAGGCGGCCACTGTATTTGGTTTGTAATAGATCG
TGATATCCTCGCAACGAGCTAGATGACATTCTGTCTGGCCTGACAATCCACAAAAAGGCACATCTCACACAACAATAGCA
GCTGCCAGCCATTGACGGACCTCTTTAATCCGAGAGTCACCTGCTACCCCGCTGTCTCCACCGCAGCGCTGTATTTTTCC
GGACACTACAGAGTGCTCTCTAGCTTCTTGCTCCGATAGCTCTGTCAAGACAACGCGATGTAGGCCTGGTTTTGTCGGAT
ACGTCCCATTGATTTCAAACTTCAAACCTGTCTGAATGAGCCACGATACCACTGGCCTCTTTCTCGCTTACCGACTCTTC
CTCTTCTTATTACTCTCGCCAAGATGGCACCCTTGAATATGCTGATGGTAGGTGTCAGATCCCCATGGTCGTAAGTTGCA
GTTGCTGACGTCTTTCTCTGCTCAGGTCGGCACCGGCGAGTATACCACCGGCTTTGTGGCCGGCGGTGCTTCCGGGTCGG
ACAAGAAGGTGGGCGTCGTTGGTCTGAGCCTGTTTGATCTGCGACGGCGAGGAAAGGTCGGCAACCTGTCGATGGTGGGC
GCAAGCGGATCCAAGTTCCCGGCCATCCGTAAGTAGCGGAAGCGTGGCAGCCTGCTCAGATACTCTGTTGCTGACAGCGG
CTGATGCTAGGGGAACATCTGCACAAGAACATCGGCCAAGTGTACAACGGCCTCGACACGTCCTTTACGTCGTATCCGGC
GGACGGCGTGAGAGACACTGAGGCCTACAAGACGGCCATTGACGCGCTGAAGCCTGGCGACGCCATCACGGTCTTCACGC
CCGACCCGACGCACTTCCCGATTGCGCTGTACGCCATCGAGCGGCGCATCCATGTGCTGATCACCAAGCCGGCCGTGATG
ACGCTGGCACACCACACGGCGCTGATCGAGGCGGCACGGAAGCACGGCGTGTACGTGTACATTGAGCACCACAAGCGATA
CGACCCGGCGTACGCCGACGCCCGATTTCGCGCGCAGAAGCTGGGCGAGTTCAACTATTTCTACAGCTATATGTCGCAGC
CCAAGTTCCAGCTCGAGACGTTCAAGGCCTGGGCCGGCGTCGACTCGGACATCTCCTACTATCTCAACAGCCACCACATC
GACGTCTGCGACTCCATGGTAACACCGCTGGGCTACGTGCCCGTGGTCGTGACCGGTGCCGCTTCGACTGGCGTGGCCAC
GCAGCTCGGCTGTGCACCGCAGACCGAGGACACCATCACGCTGCTGGTCCGCTGGCAGCACCGCGACGATGCGACCAAGC
AGGGCACGGCCGTGTACACGGCCTCGTGGACGGCGCCACAGCGTGCCGGCGTGCACTCCAACCAGTACTTCCACTACCTC
GCGCGCGATGGCGAGGTGCACGTCGACCAGGCCAAGCGTGGCTACGACGTGGCCGAAGACAGCGCTGGCCAGCTGGTCTG
GTACAACCCATTTTACATGCGCTATGCGCCCGACGAGGACGGCAACTTTGCCGGCCAGACCGGCTACGGCTACATCTCCT
TTGAGAAGTTTGTCGACGGATGCCGCGCCGTCAACGACGGCACCGTCAAGCCGGCCGATCTCGACGCCAAGGGCCTGCCC
ACGCTGGCCAACACTATTGCCACCACGGCCATCCTCGAGGCCGGCCGACGGAGCATTGACGAGAAGCGGGAAGTGCGGAT
CGAGTCGGACGGTGGTGTCTGGAAGTTGGTGTAGAGGGGCGTTTGGTGTAGTGCAATTAGACGAATTGATGACTTTGTAC
GGAGTAGCTGTGCGATGACTAAGCAAACCATTTCTAGCGTATGGTGACTGCAAAGTGGAGACACTGTGGGGACGCGTCTA
CTGCAAATACGGCAAATCGAGGACATCGTGACGGCGTCTGGCTTCCGTCTCCTACCACTTGCCCACGATGGAGAGCTACC
TGCACGACTGGCGCCAGGACGCCCTCAACAAGGCGCAGTACGAGTCGGCCATCTTTGTTGGGGACAAGCTGCTGGCGCTC
ACAGGTGAGAAGCGCCTTTCCTCGTCTGCCTTGCTTCTCTGTTCTGTACTGACCGAGCAGGTGACGACAAGGATGCCTTC
TGGCTCGCACAGGTGCACTTTGCCATGGGCAACTACACACGTGCCCAGGCCCTGCTGTCCAAGTCCAATCTGATTGCGCG
CAACGCGTCGTGCCGGTATCTGGCAGCCCACTGCCTGATCAAGCAGTCCCGTTTCGACGATGCCCTAGCTGTGCTGGGCG
AGCGCAACCCGACCCATCTGATCCCTTCCTCGGCCAACAAGCGCAAGGCGACGGGAAGTGGACCAGCCGGTGGAGTTGCA
GTCAGCATGGGCGGGCGGAGTGGCAGCGTCCTGAACGGCCGAAAGACGGGGCTTGCCGGCAGCAAAGTGACCGCGACCAC
GTCAGCGTTCGCTACAGCATCTACAAAAGGCAGCAGCCAGGGCGGGAGGAAGGCGAGCGGAGCAACAACATCAGCAGCGG
CGGCAGCAGCAGCAGCAGCAGCGGCAGCAGAAGCAAGCGTCAGCAATGCAGAGGCCGAGGCAGCAGCAGCAGAGGCATCG
AACCGACGATACGAAGCCGGGATGTGCTACCTCCGGGGAATCTGCTATGCGAAGCAGAACGTATTCGACCGGGCCAAGGA
GTGCTACAAGGACGCGGTGCGCATCGACGTGCAGTGTTTCGAGGCGTTTCAGCAGCTGACCAAGAACGCTCTGATGGCAC
CGGACGAGGAGTGGGAGTTTCTGCAGTCGCTCAACTTTGACAGCATCGCCGTGAGCACGGGCTCGGGCAGCGAGGCGGAC
GGCAACAGCGATATGGACGCGGCGCAGGAGGCTGCGGACTTCACGCGGATGCTGTACAGCACGCGGCTGTCCAAGTACCG
GAACCCGGAGGGCTTTGCGACGGCGGTAGAGTGTCTGACATCGCACTACCGGCTGGGCGGCAACGCGGACCTGCTGCTGG
CACGTGCAGACCTGGCGTATACGCAGTGCCGGTACGAGGACGCGCTGGCCCTGACGAGCTCGGTACTGGAGGAGGACCGG
TACAACTTTGGGGCGTACCCGCTGCATCTAGCCTGTCTGTTTGAGCTGCGGATGAAGAACGTGCTCTTCCTGGTGGCCCA
CGACCTGGCCGACCAGCACCCAGAGGAGCCGTGCTCATGGCTGGCAGTGGGCGTGTACTATTTTGCGACGGACCGGATTG
CCGAGGCGCGGCGCTACTTCAGCAAGGCCAGCATGATGGACGCACACTATGGGCCGGCCTGGATCGGGTTCGCGCACACG
TTTGCGGCCGAAGGCGAGCACGACCAGGCCATCTCGGCGTACTCGACGGCAGCGCGGCTCTTCACGGGCACACACCTGCC
GCAGGTTTTTCTTGGGATGCAGCACCACGCAATGAACAACATGGCAGTGGCGGAGGAGTTTCTCAAGACGGCCTACGGGC
TCTGCCGCGAGGATCCGCTGCTGCTCAACGAGATGGGCGTGGTGTGCTACCACCAGGACAGGCCGCGCGATGCGGCCACG
CTCTTCCGCAAGGCTCTCGAGGTGGCCGACGACATGGACTGCGATCCGCAGGCGTGGCTGAGCGCCCGCACCAATCTGGG
TCACGCATACCGCCGGATGCGGCTCTTTCGCGAAGCGCTCGACCAGTTCGACGAAGTCCTGCGGCTGGGCGGCAAGAATC
CGGCCGTCTTCTGCGCCAAGGGCCTGATCCACCTGGAGCGTGGCCGTCCGGACGAGGCGACCGTGGTGCTGCACGAAGCC
CTCGCCGTTCGTCCCCAAGACCCCATCGCGACCGAGCTGCTGAGCACGGCCTTGGCCGAGATGACGGCCAGCCGACACGT
GTTGCAGCTGCCGGGTGGCAATGCGAAGAGCCGTGGTGACCATGCGATGGGGGAGGTGGGCGACGGTGATGAGATGGACA
ACGAAGACGCCACTGAGGACGACGAAGACGACGAAGACGACGGGGTGGACGCAGAGACCATGGCCGGCTTCGAGCAGGAA
CTGCTGCAGCGACGCGACGAGGCACAGCAGCGACTGGCTGCAGCACTGCAGAACGGCGGCTCGTCAACCCGATCGCGGAG
GATGCAGACGTCTTCCCGGAGCAAGAGCAAGGGAAGGGGAAAGGGAAAGATGCGGAGTTCTGCAAGAGACGATAACGACG
AGGAAGACGAGGCTGAGCTCGAGGTTGGGGAAGCAGCACTGGCGACTAATGACGATCCGTTTGAGGACGACAGTGTGGCG
CGACACCGGCTGCGACGAACGGTGCGCAACCCTTACATGACGCAGCTGCAGCGTCAGATGCAGCAGCAACAGCAGCAGCT
CGGAGCTACAGCGACGACACCGGCGAGTGGCAGCAGAGGTAGAGGAGGCGGTGGCAGTGGCAGTGGCAGCAGCTGGAATG
GCCATCCGGGGGATGAGCGATAATAGCCACCTTTTCGTCTAGAATTACCCGGGCTGCTGCATGGGATGATTGGCGTTTTC
GGAAGGCAAAGCATACCTTATTACGGCGACACACGAGACACGACAGCGACAGCGAGATGAATATGGCAGCTGTGTAGTTC
GTAAGGTGACAAATGACGTCCGACTGATCGAAAGCACGTGCCGATAAGATAAGCGATACCAAAAAAATTAGTAGTGTTTT
CTCGCTTTTTTTTCTTTCCTTCCCTGGTGCAGACGAACAGCAGCTTGCACAACATCCACGACGACCTCTGGCAAGATGGG
CAGCAACATTCGGCAGAAGCGCAAAGCCCGCTCATCGCGGGCGGTGGTGCGGCAGTCCAACTCGCGCAAGCGGCCGCTGA
ACCCGACAGGCAACGCGATCGTGGCCCAGAACTGGTGAGTTAGACAAAGCCCTGATGTGCTGATGCTCTTCGGCCCAGCT
CTGACAATGGGACACAGGGACAAGAAGCAGACGTTGAGCCAGAACTACCGCCGTCTGGGCCTGATGAACCGGCTGCACAA
CCCGGCGGGCGGCGTGGAGCGGCTGGGCACGGACGTGGAAGCAGCGCGGAAGCAGGCGGCCGCGCTGGCGGCGGCCCAGC
AGACGGTCGACCTGCTGCGCATCAACGGCCAGGCGGGCCTGCTGCAGGGTGGTGCAGCGGCGGTGGCAGCCGCACGATCG
GCCACGTCCAAGGCGGCAGCGGCCGGCGGTGTGCGCGAGGTGCGCGTCGAGCGCGATGCCGACGGCAAGATTGTGCGAAT
TGTGCGAGACGAGGCCGAGATGAAGACGGGATCGGCTGTGCTGCGGCCTATCGACGACCTGCTCAGCGTGATGGAGAACC
AGGAGGAGTGGGCCGGGTTCGGGGACGAGACCGCTGTCGTCACGTCGTCTGCCACTACGCCCGTCGTGGCGGCTCTCGAA
GCCATGGCTCGCCAGCCGGTCGGACCGCATCATGTCCGCCACCAGAGCCAGGGCGAGCGGTCCTGGCTGCAGACGCTTGC
CGACCATTACGGCACTGCCGAGCCCGACGACAACACGCTGGCCGCCATGGCGCGCGACCGGCGACGCAATCCGATGCAGC
GCACGGCCGCAGATCTGGGCCGGCGGCTGGCCAACTTCCGGGCCAATGGCGGGAGCGTGACAGCGTGAGCGCGGAGACAA
GAGACAAAGAGGCAGGAGGCACACATCTGCATGTACACTTCATGGCGAAATGGCGTTTGGGAAGGCCTCCAACGGGATAC
AGAGGCCGACACCGATTATATCACTTTCTGCTGGCTTTTCAAGAGAGACGTAAAGAAGCCGCCGGACTGCCCGTTCGTTA
CCAATCTTCAACTTCATTCTTATGCAAGCAAAAACAAGCCCGCCCCCAGCAAGATGCAAAAGCCGTACATACATACACAC
GTGGGAAACTACCAATGATAAATAAGCCAGAATGTGCCACGAAACAGTCAACATGTGCTCTGAGAAATAGAACAGGCACG
TCTTGTCCCTTTCTGTAGCCCTGCCACAACAACGCCTTGCCCTGTCCCAGCAAAATGGGCGGTACGACCCGAAGGAGGTA
AAACGCACCTCCCAACACAGCCAACAAAGCCGCCAGCACTCAGTTGCGGTCGTAGTCGGCCTCGGGAAAGCGGACCGGCC
GGCCGTGGTCATCGTCGTAGGCGTCGTGTACCGTGGGCGACATGTAGCTAGACGGGGCGCCGACAGAACTGAGCGAGGCA
GCACTGGCCGCTGGTCGCAGGGCGCTCGTCGCCATGGTGCGGCCATCGTCAAAGGGGTCGCCGGTACTGACACCGCTGAT
GGAGCTGCCGCCAGCATACGGCCGCTGGATCGGGTCCAGGTAGCTGCCATATGTGTTGTCGGGGTTGCCATAGCTGGTGC
CCAGCTGGCTGCTGGCGCCGCCGTAGCTGGTGTCCAGCTGGCTACTGGCGCCGCCGTAGCCGCCGCCCAGATCGCTGCGG
TACTCCTCGTTGTCGTTGTCGTGGTCGTGGTCGTTGTCCATATCGTTGAGCCGGGCATACGGCTCCTCGCCCATGGGGGC
GGCCGAGAAGGCCGCCATGTCCGGGTCGATGTTCTGGACATTCTTGGGGCCGCCCAGGCGGTCGTAGCCGGGCAGCTGGC
CGTTCAACTGGTAGTACTTGAGCGTGTAGAGGCTGACAAACGTCGTGATGCCGAAGAGTAGGCTGGCAGGAGGTGAGCAG
AGGAGGGAAGAAAGCAAGACAAAGGAAAAGGAGACATACGTGTTGATCACACCGAGAGCAACAATGGCCTTGCTCAAACG
ACAGCCCTCACCACACTTGTCGGCCGTGTTGTAGGCCGCCTGAGCGGCAAAAGCCGACAGCCAGATGATGCAGAAGATGG
CGTCGACGGCCACCATGACGTGGGGCTCGGCAAAGCGGCGGGTGCGCGGGAAGCGCGGCGCCCCGATCAGGTAGAGCCAT
GCTGGTGCGGACAGGAAGCACTGTTCGCCAGGTTAGCAGCGGCAGCCGGCAGCTCTGCTCTGCTCCGGTAAAACGTACCA
CGCCGAAAGCCCAACCGCACTGGCCGTTCACGGTGGCATTCTTGGACCGGAAGACGGCAATCTCGAGACACCAGCAGACA
AACGAGAGGACCAGCTGGAGGATGTGCAGGACCAGCTTGTACAGAGGGATGTGTTCGGCATTGATCTCAAACTCAAACAT
GGTCGTCGGTTGCTGCGGAAACGAGCTCAGACGAGCAGCAAAAGGGAAGCCGGAGGCGTTTGGAAAGAGGCGACAGAGCA
GTCGATCGCAGTCGCTCAGACGTCGATGCAGGCCACGGGCGTGGTACTGACTGTGTAGAGGCCGTTCCGAGGCAGAGGCA
AGAGCGCAAGATTCCGTACACTGTGGCCGTTTGCGCAGAGAGGAGCCAAAAGATTTCTTACCCAATCAGGAAGACTGACC
GAATGGTCCGGACGATGGGAGGAAGACTGGAAGTGGGAGAGGACGAGCAGAAAAAACGAAAGGGGCGATCGTACTCGTGA
GGAGCATGAGACTGTCGGAAGAGTCAGGGTACGCGCGGCGGACTCGTTTCTCGTGTTTTTCTTCGTCTTATTTCGTCCAG
GACTGAAGGGCACCGAGCAACTCCGCCAAGGCGGGCTGTGCAGGCAAGCCGCTGGCAGCAGGTCAGTCGCTACAGTGATC
GCTTGCAACGGTTTGCCCCACCAGCCTCAGCCACAGGCGGACAAGGCAGAACCCGAGAGGGCGTGATGGAAGTAGCGTTT
GTTGCCGAGCCCATCAAATGCTTACTAATCGTCAGTTGATTGGACGAGCACTTCAATCGCGGCTTCCTCAGCGTCTTTGT
AGATATTCTCCTTTCTTCATTGGCTTCTTGTCCCGGTCGATTCACTCCCACACCCAGTTTCGACACCACCTACAATGGCA
GACGAGGGGCGTGCACGGCCGACGGACGAGAGGACGCCGCTGCTGGCCAAAGCGGCTGGCACAGACGCTGACGGCAGCGG
CCTGTCGTCGGGATCGAGCACTGTGGTCGGCATTGGATCGACAGCAGGAGAAGTGGCATACGGTCACGCATTGTCGCCGG
ACACGCTCGAGGATGCAGACGAGGCGGCCGACGACGAGCAGGACGAGGTGGCCGCAGCAACGGCGACATCGACGGGGCGG
ATCGTGCTGATCCTCGGCACCGCGTACGTGGGCGTGTTTGTGGGAGCGGCCGATGCGAGCGTGATCGCGACGCTGTCGGC
GCCGATTGCGAGTGCCTTCCAGTCGCTGAGCCTGCTGTCGTGGGTCGCAGCCGCCTACCTGGTGGCCAACGCGGCCTGCC
AGCCGGTGTCGGGACGTGTGACCGACGTCATCGGCCGCGGCCCTGGTCTCGTCTTCAGCAATCTGCTCTTTGCAGCCGGC
AATCTCATGTGTGGCCTCGCCGGTGATGCCGGCACACTGCTGGTTGGCCGTGCTGTCGCTGGCATCGGCGGTGGTGGGCT
CATGTCCATCTCCACCTTTCTCGCCTCGGACCTCGTGCCGCTGCGCCGTCGCGGCGTCGTTCAGGGCATCGGCAACATTG
CCTACTCGGCCGGCGCCATGCTCGGCGGTGTGCTCGGCGGCCTCTCCGAACAGGTCTGGACCGATCGATCCTATGGTGGC
TGGCGACTCGCCTTTTACGCTCAGGTGCCCGTCTCGCTCGTCTCGGCCGTGCTTGTCGCCGTGCTCGTCCGCGTTCCGCC
GCACAAATCAATCACCGAAAGTGCTGAGTCAGCGGATGAGTCATCCACTGCCGCGCTGCGCCGAATCGACTTTCCTGGCG
CCGGCCTGCTCGTCACCTTTCTCGTCCTGCTGCTGCTCGGCCTCAATGCCGGCGGAAACGTCGTTCCCTGGACCCATCTG
CTCGTTCTCGTCGCCCTGCCGCTCGCCCTCGCTGCCTTTGCCGGCTTCGTCGTCTGGGAGGCCCAGTACGCCCGCCACCC
GATCATTCCAGTGCGATTAGTCGTTCGGCGCACTGTGCTCTCCGCCTGTCTCGCCAACCTCGTCTGCACGGCCGCCATGA
TGATGGCCATCTTCTACGTGCCGCTGTACCTGCAGGTGCGTGGCTTCACGGCTGCCGATGCCGGCGTGCGTCTGCTCTTC
TCGTCGCTCGGCGTGGCCGTCTCGTCCGTCGGCAGTGGCCTCATCATGAAGCGCACCGGCCGTTATGTCGGGCTCGGCAT
CACATCTCTCAGTCTTTTTGTCGTCGGCTTCGTGATCGCCGCTTTTGGTGGTCTCGCTGCCGCCGACTCGCCCGCCTGGC
CCGCCTTTGTCGCCCTCTTCCTGATTGGCGGCAGCTACGGCGCCATGCTCACCATCACGCTGCTCGCCTGCATCGCTGCC
GTCTCCCAGTCGCGTCAGGCTGTCATCACTTCTGCCACCTACGCTTTCCGCTCTGTTGGTGCTACTCTCGGTCTCACTGT
CGCCTCTGCCGTCTACCAGAACATCTTGCGCGCCCGTCTTTGGCTGCGGCTTGGCCATCTGCCCGATGCCGCCGACGAAA
TCGCCCGCATCTGCGACGACCTCGCTGAGTTGCATCGTCTTCCTCCCGGCTGGCACGATCCCGTCATCCAGAGTTTCATG
GATGCCTTCCGCGGTGTCTGGCTCACCGGCCTCGTCCTCGCCCTCGTCGGCCTCGTCTGTGTCTCGCTCATGAAGCAGCA
CACCCTGCACGCCACTCTGGAACGGCCTTGAACGTTCTTCGGTGAAGGCACAAAGGCCGCTGCAATGTCGTAACTCGTTT
CTAGATGTAGAATGGCATACAGAACGTTGAATAATCACAACTTCTTACCAAATACCTACAAGCCAAAGCTTCAAAACCTG
AGAACGACGCACCTACTCTGAAGCGTATTTTTTGTCTTCCCGGCGTTTCTACCACAACTTCCCAGCCAGGCTAAACAACA
TGTCAACCTTTCGACACCTCCTGTAAGCGGAAAGACCCACTTCTGTCACCTAGTTCCCGCGACCTATAGGGTTTAGTCTT
GCTAATCACTCGAAAGACGTTGTGAATCCTGCCTTGCCAGCCCCCCTTCACATTGCGCATAGGCCAGGCGGGACATTATT
CCGTGGCTTTGCTTATTTTACCGTATCTTGCAAGGCTGCCTCTCTACGTAGTACTCTGCACATAGACACAGCATCCTTTG
CGATGGATGAAATTTACCGCTATCTCGGTCAGTCGCAACGGCTCTGGGACCTGACCATCTCGCCAACCTTTAGCACCAGC
GTTCCCTTGACCGAGATCTGGGTCAATCGCCAATGCACCGAGTCTGTTACGAGGCACCGCCAAGTGCCGGTGGCTGGCGA
GGCGTTCAGGAACAGGCTGTGCGACTACCAGTCGGACGACGATTCCTACTGCGTCCTGCGACTCGTGTACGTGCGTCTAG
ATGCTCCAGACGGCGTATCGGTAGCACTGCCGGAGTCAGAGTCGGCCTCGGCGTCTCCACTGTCGAGTGCTGACGTCCTG
AGTCGGGTTCTGGATGCTCTACAGCTTCGGGCTGCCTTTGACTTTTTTCCTAGCTGCTTCAACGGCGTCTCACGCGTGGT
TGCCTCCAAGTTAGAGACATCGTCTGCTGTCCGCTCTCTCTTCTCCCTTAGTTACCACCCGAAGCTGGCCGTTATCTGGG
GCTCTAACCGAAAGTCCCTTCCGAGAACCGTTGCCGTGTGCTTCGCCTACTCTGACGAGATGGACACCCTCAGGAACCTG
CTCGAGCGTCGCTGGCATCTCGACGGCCACCCCATGCTGCTGCCGTTTCTGTGCGCTCTGCTGCTGAGCTGCGGCGTCGA
CACGACCCACCAGCGCGTCAAGAAGGCTGTGCGCGAGACCGAAGTCCGCACCGGCCATCACCAGTTTGCTAACCGCAGCG
AGGCGCCGGCCGTACAGGAGCTGGGCGCGCTGTCAGCAAAGATGAACGGCTGGACCAGCAAGCTCGCGGCGCTCGTTCGC
AAGATGCGCATGATCGACACCCTCTGCGCCTTTATGCTGCAGCAGATGAAGCAGGCCAGTCAGACCAGGGACATAGACCA
GCATGCTATCCTTTGGAACCATATGGTCGTACTGCAGCACCGCACAGAGATGCAGCAGATCGATACAACCTATGTCCAGC
AGCGCGTCCAGACGCAGGCCAATGCTGTAAGCCCCCCAGAAGCTTCAGTCCCACGCGCGTGTTCCTTCTTGCTGACCTGC
AGCTCTTAAACATCATCGCCCAGAACGACAGCATCTTCTCTATAGGCATTGCCCGCGACAGCAAGCTCATCTCCGTCTCT
TCCCAGAACGATGCCTCCTCCATGAAGACCATTGCCATTGTCACCATGCTCTTCCTCCCTGGCAGCTTCGTTGCCTCCGT
CTTCTCTATGCCCGTCCTCGACTGGTCTAGCCACGACGCTCAGGGCATCGTTGGCACCCGCTTCGGGATTTTCTGGGCCA
TCACTATTGCGCTGACTACCCTTACCTTTGTCGTCTATGCCCTCTGGGTCCTGGCTAACAAGCGCTGGCGGGTGCAGGAG
ACCAGAAATATTGTTGCCCCCCTTATGGAGTTCAAGAACATGGAGGAATCTCGCCGGCTGTCCATGAAAAGAGAAGCTAT
CATCCCTTGACTGGCCAGACGATATGGCCGATTTGTTGCGCGAGACCACATACAAACTGTGGAAACTATGGGCAAGCTGA
AAGGAAATGCAATATCTGTGATTTCCCACTTTGTCAAAAGAAGTTTTGGCGCATGAAAGCGGTCTAACATCGCTGTACTA
AACCCACCACCTGTGATTGAGCTTCTGCGAGTCTTTTGAGTGTCAATAAAGCACCCGCTATTGGGTTGATAGATGGCGAC
CTAGGATCGAGCGTAGATTCTATCAAGTCGGATATGCAGACCGTTCTGAGAAGTGACAACATGGGGAGCAATTCTGTTGA
TCGATGATGCGGGCGTCTTATTGAAAGAAGAGCATTGCTCGATTGCCACTCAGCACCTCGTGTAGTATTTTTGACAGAGT
AGTCGACTTTAAGATCTAGCAGAATCGTGGAATATATTAGCTGTTGTATTATCGGAGTGGAAGCTGGGTGTCTTACACGC
TAAACAAAGATGAAGAAGACTGTCCACCAAAGCACCAAAGCACTCCGCTCTGGCCATTTTCGAGACATGGTTAAGGCAAA
AAGTTCAGGTAGTGATCTTTCGCTTAGGGGACAGGCAGATCGATGGGATGCACTGTATTTACTATTCACGGTATGGATGA
CGTTAAGTAAGCGGCTGCTTCCCTCCTTCCTTGCCCACGCATAGCTGTGCGACCGTTGCGGCCTTGTCCGTAGCTCCTTC
CTCGTTCTACTGTTCTATACCGTTGCCGCCTCGCTCAGTTCTTCCTTTAGAACTGCAGGCTAGAAAGCCTCCCCAAGATG
ATCACTGCTTTTTATGCGCAAAGTGCCGCAGCCTCTCAAACAACGCCTCCCGCAGTGGCAGCGCCTCGTGCGGCTGCGAT
GGTCGCAGCACATCCAGTGCCAGCCGCACGTCCACCTCGTTTTGCAGCTTGATGTCCGCCGCACTTCCGTTGCCCACACG
AGGACCAAGATGGTGAGACCCAGTCACATCGAAAACAACAGGACTTTGGGGCGGTCCGGGATCCCGTGGTGGACGAAGGG
CAAAGGGTAGCCCTGGCGACTCTACCAATGGCCACGGCCGCGCAGCAAGGTCGCCGGCTATTTGCTCAAACCTTCCATCT
TCGAGACCACGTCCTCGTGGTCCCAATTGTCCGCTTTGATCGTTACCACCTTGCAGGCGGGCTTGCGCATCATGCGGCCA
CCCTGCTGCTGGGAGGCTTGCTCGCGCGACGCGGCCGCCACTCTCGTTACCGCTTCCGACATCCGTTGCTTTTCGCTCCT
TACGCCGACGTGAGCGTCGTGCGTGCGCTTCACCAGACGCTGCAGCGAGTTGGCCGGCGGATGTGCTGCTGCCGACTTCT
TCTGCCGGGGACGCACCGTCTGCTGGGAAATCGTCGTGTCAGTATCAGAAGAAAGAGTTTGGACGGACGTCATTGACAGC
GTCGTCAGAGATGGTGCCGGCGACGACCGCAGCGACGACCGCGTCGACAGCATCGACATGCTCTCTCCATCGTCTTCCAC
CCTCGCCTTTTTCTGGGGAGACTCTCCCGGCGCCGAACTAGTCGCCTTTGTCTTTCTGCCTCGGCTCGTCACCACCTTGG
CTGGCCCCTTCGTCTTCGGCGTCGTCGTCTTGACGGGCGTCTGCTTCTTCTGCTTCTGCACTTCTCCCAACATCTTCGCC
TTGCGAGCACTGCTGGACCTTTCTGCCACTGCCCGCTTGGGTGTGGCCTTCTGGGGCGTCCTCGTCTTCATCTTCTTCGG
GCTGGACTTGGGGGTGGCCTTCTTGGGTGTTGCCTTCTTCCGGGGAGTGCTAATGGCCGTACCTTTTGGCTGTTTTCCGC
GCTTCTTGCGGCCTGTCGCGCTGTCCACGCCTCCATCACCAGACAGCCCGCCAACATCGGATCCGGTGCCTCTGTCGGCC
GCGTCGTCCTCGTCGCTCGACGACGCTACATCTCGTTCGGCCTCGAACTCGGCATCGCCGTCATCGTGGTCTTTTCCGTC
CGCGTCCTCGTCGCTCTGCGGTCCTCGCGCTTCTGCATCGACGCCGTCATCATAGCGAGGCGCTGCATACATCACCTTTG
TTCGCCGGCGGCCACCGCGGCCGAGCACCTCTTTATTGGCGGCTGCAATGCGTGCCGCCTCGGCCTCCCGTTCTCGGATG
ATGTTGTCCCAGACTCCCGCCATCGCTGCGTCGTTGCCGTTCGCATGGTCATCTTCGCTGTGGCCGGCTCGTTCGCCCAT
TTCAATGTCAGCATCGGCCAGGGAACCGGTTTCATAGGCCCAGACGCGCGCAAACGAGAACTGCGACTCGGTGCCTTCCG
CCTGATCTGTCTTCTTCTCATCGTCCATCTGCGCAGCGCGGTCCAGCAGCTGGTCCACGGCAGCGGAGTCGTAGACGATG
CGGTTCAGCTCGCTGTGCTCACTGAACAGCGACTCGGCACCATGCTTCAGAATGGACTCAAGGTCGTTGCCAGCGTCGTC
CTCGGCGTCCATCGACTCAATGAGGGCGTGATCGAGCGCCATCTTCTTGCGGCCGACCTGCATGATCTTCTCTTCGACAC
TGTCCTTGGTCACGAGCTGGAAGCAGAGCACGTGGTTCTTCTGCCCGATACGATGGGCCCGCGAGAAGGCCTGCATGTCC
TGGTGCGGGTTGAAGTCGGGGTCCATGACGATGACGGTGTCGGCCGTGGCCAGGTTGATGCCAACACCACCGGCACGCGT
GGACAGCAAAAAGGCAAACAGCGGCGAATCGGGGGCATTGAAGGCGTCGATGCGCTTCTGCTTCTCCATACTGGACATGC
TGCCGTCGAGACGGCCGTACGGCAGGCCGAGGATGGTGAGGAAGTCCTCGACAATGTCCAGCTGGTGCAGGAACTGGCTG
AAGAGCAGCACACGACGGCCCCGGGCCTTGAGCTTGGGCAGCATGATGCGCAGCAGCACGAGTTTAGACGAGGCTTCAAC
CAGATTCTGCACCATGGTGGCCTGGTCGACAGTCTTCTCCTCGATGGCATCGTTGTAGATGAAGGGGTGACACAGACATT
TGCGCAGCTGCATGAGGATATTGTTCAGGCTGCTGCGCTCGGCTACACGCAGCCGGGTCTTGGAGAAGATGGCACGGATC
AGATCCGGGTTCTTGGCCATGATGGACTTGCACAGCTTCTCCTGCAGCACCGTCATGCTGACAGGCACGATGATCTGGGC
CATGGGCGGCAGGAACTTGAGCACCTCGGCCTTTGTGCGGCGGAGAAAGTACGGCCGGATCAGCTTGTGCAGCTCGGGCA
GGTTCTCGGCCGTGATATCGCTGTAGCGCTCGTCCAGCTCGGCCGCGTCGTTGTTACTGTCGACAAATTGCAGCAGGTTG
AACAGCTCGCGCTTGTTGTTCTGCAGCGGCGTGCCGGTCAGCAGCAGCCGGAAGCCGATACGCATTGCCCGCAGGGCCAG
ATACAGCAAATTTTGATCGTTCTTCAGCCGCTGGCCCTCGTCAACAACCAGGCCGGCCCAGCTGACACCTTTGAAGCGCG
AGCGTGTCGTCTCGTCCTGCGCCGAGTCGTAGGACATGATGACGACGTGCGCGCGCATGTCACGTGACTTGTCAGGAAAC
AGCTCATATTCGTACGCGAGTCGCTGAGCCTCGCGGCCGCCGTGGTACGTGACGACACGCAGACCGGGAGCCCAGGTCTT
GATCTCGCGACGCCAGTTTCCGCACGTGGCATTGGGCACGACGACGAGAAAGGGCCAGCAGCGCGGCTCGCCAAGCACGA
CGGCCGCCAGCAGCGCAACTACCTGGACGGTCTTGCCTAGGCCCATCTCGTCGGCTAGCACGACGCTTTTGCTCTTGTAG
AAGTTGAGCAGGAGCCAGTTGAGACCCTCCATCTGATAGGGCATCAGGCTGCCGTTGGTTAGGCCGGCCGGCTGGGAGCG
AGCGACCTCGAAGCGCCGACGCTTGCGGAACTCTCGGATGCGATTGGCGATGACCGTGCTCGATTCGACATGAAAGTTGC
GGCCGCCGAGATACTCGTCATAGGCAGCCGCAAACGCATCCCACCGGCGGCCAGAATCGCGTGGCGGAGGCCCGTCCCAC
TCGGTGGCATCATAGCCGAGACCCTGGACCTTGATCCAGGCGGCGTCGATATTGTCAATGTCCTCATTGCGCGGGCGCTG
CTGCTTGTACCGTACCGCGAGGATCACGTCGGCCAGCAGATACTCCTCCGGAACGGCCTCCTTGCTATCGAACACAGGCG
GTGGACCGAGCTCGCCGCCGCGCTTGGCAAAAGCACTGCGCATGGCCGAATGTACCGCTCCCCAGATCCAGGCGCCCGGC
TTCCAGACACAGTGGGCATACGACATGCCATGCCACTTGACCAAGTACTCGCGCTCGTCCTCAGGACATTGGTCCATCGT
CTGGCCAGCTGCCTTCTCGCCGGCCATCGGACGCCAGGCGACGAGCGCATCGATCCTGGCGGGCATGTCCAGACACTCGC
GGCACTTCCAGTCGATGGAGTACTCGGCAAGACGGTCGGCATGCAGCCGGTCGATGGCAGACGGATCGGACACGACATCG
GCAGACGGCGGCGGCAGGTGCTGGAAGTGAAAGGCCAGACGGCAGTTGGAGCAGCGAAACAGCACGTTCTCCGGCCGGTT
GAGCAGGCCTGGGTCGACCGGGGTGATGGGGTCGATGCCGTCGTTTTCCTGACGCAGCTTCTCCTCCTGTTTGGCCGTCT
TCTTGTGCGAGAAGGCGGCACAGGCGACGCCAGACTGCCGACAGACACAGCAGCAGCTGAGATTGGGACTGTTGGCATCA
CGCGCCGCCACGACGCCGACGCAGAAGCGACACTGCAGCACGAAGCTGTCGGGGCCGACCTTGGTGGCCATGTGGTCGCG
CGCGCTGCGATAGCCGATGCAGTTGCGGTGGTACGACAACGAGCAGCCCTGGCAGTGCAGCAGGAGGCCCTTGTTGGCTG
CCCGCGCACCGCCGCCACAGCTGTCGCAGAGAGGCGAGTGCACGTCGGCAAAGGCGCCATCGTCGGTCAGCGGCTGGAAG
ACCTCCTTGACGTTGATGATTTTGGGCGTCGTCACAGCGGCAGACCGATCGCCGTCATCGGCGTACAGCATGTCGTCGTC
GTCTTCGTTGAAGCTGTCGACCATGCTGCGCATATTCTTGGCCGCTCTGCTCGGCCGCTGTCTCACCTCCATCTCGATCG
AGTCTTCGCGCATATAGCGGCGGCTTCCTCCTCCGCGCGGTCTCTTGTTCCAGCCCCGTCGTGGCCGCTGGTTCGGCCGG
ATGTCTGAGAGCACAACAAAATCGCCGTCGCCTGCAAGCTCGTCCATGTCGTCGTCGTCGTTCTTGGCCGACCGCTGCGG
TGGCAGAGACCTGCGCGACCGCAGCTGACGGCCGGACGTGCCGATCGTGGCTTCGTCGTCTTCTGTGCCCGTGGCCGTGG
CCGTGGCCGTGGATGTGAGTCGCGAGCTGTGGCGCGTGCCCGACTGCACCAGTTCGGTCAGCGACCGCAGGTGGCGGCGG
CGCAGACGTGGATCGTCGCCTCGGTCCTGTCTGTTGGTGCTCTTTGAGCCCGTCAGCTCGTTTCTGAGGCCGGTGTCGGA
GGCGTTCGAATCATCCAGCCGGCTGTTGTCCCGGTGGTCATCCGTATCCGTGCCGGTGTCCATGTCCATGTCGGATGGCA
AGATGTCGTCTTCGTCGTCTTGCTCGGAGAACTCGTCGCGGTAGTGGTGTATCTTGCGCCGTTTGGAGGATCCGCCGTTG
GGTGCGGAGAGACTGACTCGGCCTTCTTCTGTCTGTCTGAATCTCTGCAGAGATTTCTGGCCGTTGGGAAGAGTGAAGAG
CGAGCCAATGTGAACCTGCAAAATCAGCTTGGAACTGTTCGGGAGCAAGTGAGAGGTAGTCCAATGAAAGTGCGATGGTA
GGAGCCGAACGAAGCAGACAAAAGGGCAGGTTGGAGAGCCAACAGACAGCTGCATACCGCGGAGCATTCACCCTGCGATC
CGGGATCTATACGTCTGTTGCTGAGGGCCTCGTTGCCAAAGTGTATGACGGGCTTGCTTGCAGCACTTGACAGGTGGTAG
ACAAAAGGTATATTGAACGTCTGCACGTTGCCGATGGATGAAAGGGGAGAAGGTAGAAAAAAGCAGAGAGTATGAAGAGA
GAGGGGGAGGGAAAGAAGGAGATGGCAGCAGTCAAGCAGAAGATGAGACGCGAAGCTGGCATAAGTGACATGGAAGTAGG
CAGAACATGTGAACAAAAAGTCAGGGCGAAGTGAGAAGCACAGGTCAGATCGGTCTTACCTGTCGCCTTTCTCCGTCGTC
AAACTCAATTTCGAACCGGTCCTTGCCCCGGACTCTCCGCACGACGGTGGCGACGTAGTTGCTAGCCGGAAGCGTCTTGT
ACTCGGCGCGGCGGGAGGCAGGCAGCGGGCTGATGATGACCTGCATCTGGACGGTAGTGTCGCCATGCGATGGCTGGTGG
TCGTCCGAGCGAACGGCGGGCGAGCGATCTGGCACGTCGAGGATGGTCTCAGCCTGGGGGAGTTCGCAGGGTTCGACAGA
AAGCTGAGGGGATGGCTTTTCGGGAGTCTCTTGGTGAAGTTCGAGGACCATATCCTCCATGAGTGCATCTGCGTGCTGGC
TCGCTTCGTCTTCGGCCAGAGGAACGTGAGGTTGCAGTATTGGCTCTTGATCCAGTTCTGGCTCCAATTCTGGCTCCATT
TCTGGCTGCACTTCTTGCTCCAGTTCTGTCTGTGGTTCCAGCTGTGGCTCTGTCTGTACCTGAGACGGTGGGTCTGTCAG
CTGTTCGAGCTGCATCTGCAGCTCCAGTGCCAACTCCCATTCATGCCCTGCCTCGTCTGATAGCTGTGGCGCATCTGTGA
TGCTTCGCGGACTGCCAAAATCGACTTCGTCCATCCAGTCGCACCCTGCAGCGGCCGCTTCGTCTGTCGCTTCTGCTTCT
GCCTCGTCATAGAATGCCACCTGCTCGTTATTGGTTGGATCGTCGTCGTCGGCCATGATGCCGAAGAGTGGGTCGTCGTA
AATCATCGCAAACGCGCTGTTGCCGGCCACGCGGCCTTTAAAAGAGAGAAGAGGTCAGGATCGGCTGTTCCTTTGCCTCT
CGTCTGTTTTATGGTTGGGCCGCGAAAGTGCAGATCTGGCGAGGCAGAGAGGAGCGGGCCGGCAATCAGCAAATAGCGAA
GAGCGAAGAGCGAATAGCTCACCAGAAGACAATGGCATCCCATTCACTGCTCGTCTGGCTGGTGCTTAAGCTCTATGCCA
GAGAAACAGAGCCGGGAAGCACAGACGATGTCGGAGGCGGGAAGGCGCAAAGCTGGGGTTTGCTGCTGGCTGGTTGGCTG
GCACCTGCTGTCCAAATGCATATGTACCGTTGTTTCTTACGCGACCGCGATATAGTGGTTGAACAATAGGGCTGCCCCAC
TCTTCGGTAGCGAATTCGCGTGAAGCCTGGCAATCACGTGCAGATCGGAACGATCTATGTACAGTGTGGGAAGAATTGCA
CTGTGAGACCGCATGCATTTTTTCTTCCAGACTAAGACGCAAACAACTGCACCTCACCAACACAACGACAATGCAATGCG
GCCCTTTATGACCGCCAGCGGAGCGCCACAGGCGCTCACCACGCTGCCATTGCGGACGCTTGCGCTGGCCCGGCTACTGG
GCAGCAGCAGCAACCGTGGTACTGGCCTTGGTGCCATGGGTCACGTGCTCCGGTCACCGGCAGCCGGCAGCACCATTTTT
GGCCGGCCGTCATCGATGTCGGCCATTGTGCGAGGCGTGCGACGGACGTTTCGTGAGCCTGGAGGCGGTGGCAGCGGCAG
TGGCCGGACAGGGCGGCAGCGGCCACCGGGCTACGACAGTCAGGTGGCATCGCGGGTGAGCGAGCGGCGGCGGGAGCGCG
AAGCAGCGCCGCGGCCGACGTTCAAGATTCTGCGCGGTAAGAAGGACGTGACGGCCGATCCGGTGCCGGAGGCCAAGTCG
AGGCGGGCGCGCTTCTTCGACCCGGAGGACTCGTTTGGCAAGAAGAGCCTGGTGTACCGGCTCAAGACGGGCGAGCTGGA
GGCGGAGGTGCAGGCGCTGGCGAAAAAGGACGACATGGAAAGAGGGGACGACCAGGAAAGCAACGGCTGGAATGACGACC
GCAGACGCTGGCCAGAAAGGGGTGGGGGGAGGTCGGAGAACGAGAGAGGGCGGTTCGACCGGGGAAATGAAAGGAGAGAC
AGATCTGGGGGATTCGGATCGGAAAGGCGTGAAGGTCGGCCCAGAAGGTTCGACAGATTCGAACGACATGAAGGGCCCCA
ACGATTCGGTAGATCTGAACGGCGTGAAGGCCGGCCCCAGCGTTTCGACACGGAACGGCGTGAAAGCCAGTCCCAGCGAT
TCAACAGATCCGAAGGACGTGAAGACCGGCCCGAAAGGTTCGACAGATCTGATCGTGACAGATCTGGGTATGTCCGGCCT
GAAAGAGACGACGGGTTCGAGGACACGACAGAGAAACTTGAACTCGACAGGTCTGAAGACGACCGTCCTTCAAGACAGGA
CAGGTTTGAGAGATCCGAGAGGCCGAGATCCGACAGGCCAGACAGACCAGACCGAGACAGACGATTTGAGAGATCAGAGA
GATCAGAGAGATCAGAAAGACCAGACAGGCCGAGATTCGACAGACAAGACAGACAAGATGACACTCCGACCCTTCTCTCA
ATCCCCTACACCACAGCAGCATCACAGTTTCTGTACGGCCGGTCGGTCGTGGAGGCAGCTCTGCGCAGCGACCGACGACA
GCTATACCGACTGTATGTACACCGAGCGGCAGCCGAGTACGGCCGACACAGCCGTGGCCGACAGCAGGACGACGGGATCG
AGCGGCTGGCTGTAGCACGTGGGCTGTCCATCCAACACGTCGACGCGCGCGGACAGCGACTGATGGACAAGATGAGCAAA
GGCCGGCCGCACAACGGCTACGTGCTGGAGGCGTCACCGCTGCGACAGCCGCCGGTCGTGGCGCTGGGACGATGGCGCGA
GCACGGCTTTGACGTCGAGCTGGGCCACCAGTCGCGCGAAGATGCAGCCGTCAACGGGACCGACACGTTTGTGCAGATTG
CCAGACCAGGCTCAAACACAACGGCTGGCCGCCACCCTCTCGTCCTCCTGCTGGACCAGGTGCTCGACCCCGGCAATCTC
GGGGCGATCCTGCGGACGGCCAGCTTTTTGGGCGTCAGCGCCGTGGCTGTGTCGCAGCGCAGTTCGGCCGGCCTGACGTC
TGTGGCTCTGAAGGCATCGGCTGGCGCGGCCGAGGCCATGGCCCTGCTCTCGGTTGAGGACGCAGCATCATTTGTGACGC
GGTCGCGTGATGCCGGCTGGCGTGTCTATGCGGCCGTCATCCCGGGAAGCCGCACGGCCGATCTCGAAGACGTCGAGACC
GACGACCCGCTCGGCCGACAGGCCTGTCTCCTCGTCGTCGGCAGCGAAGGCGAGGGCCTGCCGCGGACTGTAAGACGCGC
TGCTGACGTCGAGGTCGCCATCGCCAATCGGTCCGGATCCGACGTGGTCGACAGCCTCAACGTCAGCGTCGCTGCTGGCC
TGCTCTGCGCCGCCTTTCTGCGCGGCGGGAATGCGAGCAAGGTGAAGTCGGTGAGCGAGGACAACATTGTCGACCACACC
GGCGACGCTCTGGATCAGCTGGCCAGCACAGTCTCAGACCCGCCAGTCAAGCACGGCGATTTGGGCATCTGGTAAGGTGT
TATGTACGATAGTGTAATCTCGTGTTTCAGGACAGACAAAAGTATATAGACCTGGCATCGAACACTCTATTCAGTATTCT
GTGGCATACTCTGTGGTCTCACACAAACCCATTTTGTCTTGTTCGACTGCGTGGGAATGCTACGGGCGTAGATGAAGTAC
ACAGTCAGAAGAATGCTTTGTCTTCGAGCGTCTGCTTTGACATTGCAACTGTTCATTTCCACTTCCCAGTATCGAATGCA
ATTTATTGTGATGCCCTCCCAATTGAACAATCTAAGTACTCGTACACAGCAGAACAAAGCCCGGTTTACTTGTTGGGCGG
ATTGTTGGGAGAATTGATGCCGTATACATAGCTGTGACGAAATTAGTACAAGACGAGGCAAAACTCCACGGGAGCACTGA
CAAAAGTAGACATCTACTCACTTGTTCCACCACCGTCCAATCATACCCGGCACCGGGCGTTGGTCATGCATACTCTTGCG
GCGAGCCAGGTTGGTCGGATCATCTTTCAGCTGCTGTAGAGAGGAGAACATGCCCGTCGAGGGCTGGAAACAGGATCAAA
CATTGTCAGCTCTGGGACTAATAAAGTGAGGTAGGAGGCACAATCTTACCCTTCTACCGGTGGATGAGGCAGCAGATGTC
GCCGAAGTGGTCGAATCGGACCTCTGCTCACGTGGGGTTGGAGTTGCCGAGGAACTCATGATAGCGGGCGTATAGGGTGG
AATCAGGAGAGTGATGTGTATTCTTGTTTAGATGGACAAGACAGAGAATCGAATAATGTCAGAAAAGAATAAGCTAGAAG
ACGAGGAGAGGGGTTACGGCTTTTATTGTAATGTGACCATACCTACCTAAAGCCATATACAGGTCTTTTACAAGCAAGCG
TAGGGTCTACGAATCACGTTATCACCCGGTGTAAGCAGGTCAGTAATAAAAAAGCACGACGTAACAAGAAGTACGACATG
TCTCTAGTCGAAGAGGGGCGAATGCTACGAGTTCTCGACAGGTCTTTCGTCGATCATAAACCCATGACGAACTGGATGTG
ATGCGATGGAGGGTGCCCCACAATTCTGTGTATCGACGAGCCAAAGAGGGATCGAGAAGTTAGCGTAGGCGAGAAGGCAC
TGCGTCTTTGTTTTATTGGCACCTGCTTCCGTGTGGCTGCACGAGGCATGCCGGTGAGCTATCTGACTTCAGGCTTCTCT
GATTGGGCGTGCTTAAAAGGCGGACGAACTTTGGCCGAATGAGCTGTGTTGGTGGCAGCATTGGCCTTTACCAGGTGTGG
CAGGATATTCATGACGATGGGTTGGTGGCTGGACAAGTGCTAATAGCAAGTATCTGTACAGATGGGAGGAGTGCACTGTT
AGTGTCTGCCGAACTATTGAAGACCGATGCAAACAAAGACAGTGCGAATACCACCGCCAATTATATGCACTCTACGCGTC
TACGCGACGACAACGCGCTTCTCTGCTCTTTCCCCTTCTTGCGCGCCGCTATTAAAACAGAACAGAAAGCGGTCACGACT
GTTGGAATCCTCCACATCTACATTGTCAATTCAGCATCTCAGCCCATCTCTTCCAGCCTCGAAAATGACAGTAGAGGACA
CTGCTGCACCCGCCGCTTCAACTCCCATTGTGCCCGTCGTCGCCTCACCGCCCACCTCGCCGCCGGCCAAGCGTGTTAAG
ACCATGTCTGCCGAGCCGAATGCAGCAACGATCGCGTTGATTGCGGATTCTCTTGATGCTCCGCCATATGTCCCAGCCGC
TCCCTCGCCCGACATCTCGCTGCAGATCCAGAAGCTGTCGCCCGAGGCTCGCCTGCCGACACGCGGCTCCGCATTTGCCG
CCGGCTACGACCTGTACGCCGCCCGGGCGATCACGATTCCGCATCTAGGCAAAGCCCTCGTCGACACAGATCTGGCCATT
GCCGTCCCTCCTGGGACGTATGGCCGCATCGCTCCGCGCTCCGGACTCGCTGCTAAACACTTTATCGACACCGGCGCCGG
CGTCATCGATGCCGATTACCGCGGTCACGTGCGTGTGCTGCTCTTCAACCATGACCCCGTCAACGACTTTGCCATCGCTG
CTGGCGACCGTGTCGCCCAGCTCGTGCTGGAACGCATTGTCACCCCCGACATCGTCGAGGTCGCCCAACTGGACGCCAGC
GTGCGCGGTGCCGGTGGCTTCGGCAGCACCGGCGGCTTTGGCAGCGGTGCCACCGCTCCCCAGGCATCTGCTTAGACGGC
TGCTCCTGGTATCCCGCACTCAGTAGAGGAATTGCGATCCTACACCCGCGAGATCTTTTACACCGTGGTTTACTGCTTCA
GAGCCGGTGGCTAGCGTCCAACGGAAGTGCTTTCCAGTTCATCAGGAGCTTCTGCCATCTCTTCGTCCGACGCAGCATCC
ATCGAGGCACCAGCTAGGGAGCGACCAGCTCTCCCAACACCAAGTCCCGATACATAAACTCAAAAGCAGATTGCAATTAG
CCGCATATATAGATACCGCCCTGAACATCAGCTTTCGAGACACCATAGAATAACGGCACCGAGAGCACGGTGGAACGGCA
ATATTTGCTTACATAAATACTGTCTGCGAATACAATATGATGATACCATGTACAAATCTACACACTACTCCGTAGGCTTG
TAGCACTCTGTGCCCGACTTTTCGCCTGGTGTCCTGAATTCTATCGGATCTATATGCGGACAAACTTGGCCATGATCCTG
TTTCCCGTTTTCATCTATAAGCAATTGACAGCTGTCTCGTGTCCCGTCTGTTGTTTTGATTAAAAAGGCACCGCTCGGAA
CTCAATTTTGGGATATTTGAGGGAGTTCACGTTTCGGGGCAACCGCAGCTCAGCAGACCCAGACCGGAGCAGATGGAATG
CTTTTGCTCGCTCCTCATCTCCGGTGATCCCCATGCGGTCCAGCTTCTCACCTGCCTGCTTCATCTCTGCGTCCAGGCCC
TCACACGTTTTGGCCAGCACCTCGTGCATGCTCGCCAGAACCTTCTCGGCAGCTCGCGCCAGCGGCAGGTCCACGGCGGC
TACAGAGTCGTCACTGAGCCACGAGTCTCGGTGGAGCAGGTCTGGTGCTGATCTCGTAATGGCCTCACGCATGCGCACCA
CCATCAGCGCGCCAAACATGTCGCCTGTGCCGCTGAAGTAGCAGTCGATGGCCGGAAACACGATCTTGAACAGCCGTGCC
TGGCCTGTCGACGTCATCGACGAGCCGACGACCGATAGCGACGACATCGGGTGGTCGGGATGCTCTAGAGAGACCGACGT
GATTATGATGTGTGGGACCTTGTAGCGCTCATGCATCGCCTGGATGGCCGCCTGCAAAGAGTTCATGCTTTCAATCTTGA
CGTCGGACAGGAGTCTGCATCTGATTAGTGGCTTCCACGGCACAAGGATGTAAGATCTGCATACTCTGCTTCAAATTGAT
TGGGTAGAATCAAATCGGCATGGCTGAGCTGCTTCTTATAGGCAGGCAGGACGTCTGGTGCTACATAGAGCCTGCCGTTG
TCACCCATCACCGGGTCCAGCACCCAGAAAAAGCTGCCAGGGTTTCCGGCCGCTTTATGTCGCAGCTCCTCGGCAATGCG
TCCTACCGACTCCACGGCCGCGGCCCCAGGCAGGTATCCAGACAGCATCATGTCAAACTCGTTGAGGTACGACTGTCTTA
ATCCTTCGTAGAGCTCCCACAGCTCATCACCAGTTATGCGCGTGCCTTTCCATTGTCTGTATCCTGTGTGGTTGCCTGTT
TCAGAGGCGCGAGCACTTGTCAGATAGGTGTGGCCGGGCACACAGTCAGGTTGTATAACAAGGGGAACGAACTGAATTGC
ACCGTATTCAGTGCTGCTACGTCACATCCAAGTGACTGCATGGCAAACACGGCAATCTTGTTTCCCACATGGCTAAGGAA
CGGTTAGCAACCTGATCGAGTGTCGTTGCCTTGCTAGCTGGCTGCAAATAAGATGATCGCAACCTGGTCTTTGAAGGCTT
ACCCGGACACGACCTAGAGCTGCGATTAGCATTGACACTATACGACTGATCTGGCACAGACAATGTATATACGTACATGG
CTAGCTATAGCCAGCACCCGTGTTTCCGGGACAGGATGTTCAGTGGGCATTGTCTATGGCCTGGAGCAAAGCTACAAGCA
AGGCCTTGATGCAATCGATTGTTATGAGCTATGCTCACTTTCCCCCCCTTTTCAAGCAAAAATGGCCAGAATGGACGGAG
AAAGCTGAGCGGTTAAAGAATGGCTGTCATATATCAGCAGTACGAACAAGTTGATTAATATGTGGGGCTGAGCCGATATG
CAAAAAGTAGCCGATAGAATGGGGCGAGAATCAGTATGAGGCGGATCAATGTGAGGCTGGACGATGCTTATAGGGCGAAG
ATGCATGTATTTGCAGCGAGTGTGAGCAAGGAAGGCTGTGGGCCGCAGCCGACGGTGCTTTCGTTGGTGAGAAAATGTCG
CCGATGTAGCCGAGATGCCGGGCAGATAGGAAAAGAGCTGTATGGCCAAGCGAGAAGTAAGAGTGAATTAACGCCGATAG
CACTATGAAAAGGGAAAGTCTCGCCCGTAATATTCTATGACTCAAAAGGGAAACAAGCGAATCGTCCAGCAGAGGCAGAA
AAGCCGCCTATTGCCGCATGTAAGCCTCAGTAGGTCGTCGCTCTATTTCTGTCGAGCAGTGAATCGAGATGGTAGTTGCA
GCCAGCCAACTTCCCCATCGGGACTTGACTGCCCCTCGATTTTCTAGTTCCTTTTTTGGCCAGCGACGAGGTGTTTACCC
CGCGCTTTTTTAACCATGACGGCAATTAAAATCTTCTTAAGATCAACTTTGTCTCAATGATTTTGTTCCCTTTGTGCTTG
TACGGTACAGACAGCTGTAACTCGACCTGTGCAGCCGCCCGTCAAACGTAGCCTCAATGGGGGATAGCTTCTCGTCGTGC
AAACATCGCAAATGCTCAATTACCAATAACTCTTGACTCTTGACTCAATTCATACATGCATTGGCACAGCCTCTCGTTTT
TCTGACGTGGCACGCTTGGATTTTATTTTCCCAGCCTGTCTCAGCCGCCCGTGAATCGTATCTACCGCCCCTAACCAGTA
TGAAGAAAAAAGCAGGTCGATTGTCGCTTCGAAAGATCCCGTTGCGCCCGTATTACTCATCGTCACCAATCTGCCACAGG
TTAGCAAGAAGACGAAGATGGGGAGAAATAAGCCAAAGGGTCTCACCTTGGGCGCCAGGTAGAAGCGCAGATAGCTGCTG
CCCGAGACGATGTACTCGACCAGCAGGGGCACTTCGTTGGACAGGCAGATCTTGACGGACGTGGACAGGCTGGAGGCCTT
GCAGAAGTTGACGAGGTACTTGAGCGAGAAGGTCAGGGCGACGGTCTCGCTCAGCTCAATGTCAATGTTCTCGTTCGGCT
TCTCGACATTGGTGTGGCTGCGCAGGGTGACGGAGCCGCTGCCAATGTCGCCATTGCTGGCAAAGCGGATGCCGTCCTTG
GTGGCCTCGATGGTGACGGACTCGGACATGGCCATGAGGTCGGTGCAGATGCGGCGGAACTCGGAGCTCGGCATGGAGAT
GGTGGCCGCATACTCGGTCTCGGGGATGCCGAGGTGCTCTTGGTCAATGTCCATGAGCTTGAGGTCGTACTCGCTGACCC
GGTCGCTGTCGCGGCTCTCAAACATCATGTTGAGCGAGTCGGGCGCGTCCTCGGCCTTGAGCGTCAGTATGTCCTCGTTC
TGCGCCGCGCGCAGCACCTTGGTCAGCGACGTCAGGTTCACGCCCAGCGCCACGTTGCGGTCACAGCGGAACGGCTCAAA
GGCGTCCGCCTTGAGCAGCATTGACACCAGCGCCACGTGGCTGTTGTCCATGGCCTGCAGCGCGATGCCCGAGTCGTTGC
AGTCAAAGTTGCAGTCCTGCACCAGGTCCTTGATGGCTTCCACCACCTTTGCGCGAGGTCAGCTGTCTGTGCGGGCACGA
GGGAGCGAGAGCATAGTCACCTTCTTCAACACCGACGCTTGTTCCAACCGTGCCTCCAACATCTTGATCTGCTTGTGGGG
TTGGGCGAGGGGGTAGAGGAGGACAGAAGAGTCTGAAATGGAGGCTCGAAAGAAGGTGATGAAAAACAGGCAATTGCGGT
GTGGCAGAGGCCGTCGGCGTCGATATTCGTGCGTGGAGGCAGAACGAGATTGGGCAAGAAGATGAGAAGAACGAGAAGAA
AGGGCTAAAGTCCAGCACACGACACGCTTTATTTTCGCGTTGGCGAGACGCGTCGACGGAGACCGGCTTTTAATTGAACC
AGACGCGCGGGGCATTTCCACATGAACGCCAGGCAGCATTGGCGATCCACTTTAAGCACAAGACTACGTATGGGCAACTG
GTATTATACAAATTTGGTCATAACATTGTACAGTTTTCATTATAGATACAAATACAGATGCAGGGACAAAGTGAAACTAG
TTGGAATCAAGGAGCGCGAAGATGAGCACGGCAGGAAACGAAACAGAAAAGGGACAAAAAAAAAAGGACCTCTCGGTCGG
TTTCTTGCGTGCAAGCGCTTCGCAATGGGAAAGCTGTTCCCTGCTCTGTCTATAGATGAACATATGATAAACCATGGACT
GTCGTGGAACGCCAAGTAGTGTCGCCGATGCGACTCCGCGCACAGAAGAAGAAAGCAGATAGGACAAAAGAAAGCAAAAA
TGGCAAGGATATGCAAAAAGCAAGCAGAAAAGCAGATGAAAGCAGAAAAACAGAAAAGGCAGAAAAGCAGGTAAAAACAG
AAAGGCTCGAATTAATGAGATCGTTGCTGTCGTGGACGATCACTCCCACAACAGTGCGAGAATGTGTCTGAAAGGCCAGA
TTATGCCGAGGCAGAGCGGTCGTCGAAGAGCTCGACAACAGGTTCGTGGGCGATTATGTTGATGGGCACGTTGATCGACA
GTCTGGACGGCTCGCCCGCGAGCTCATCGGCGGCAGGCTCATCGATGGCAGGCGCATCGACACGGCCAAGCTTGGGCCGC
AGGTTGATGACCATCTCCAGCTCCCGCAGCATGCCCCGACTGGCATCGGCCTGCTCACGGGCTTCGGCTCGCCGCTCGCG
GTCCTCCTTCATCCTGCTGAGACGCTCTCCCCGCGACAGGAGCGACCTGGACCGCATCGGTGGCAGCGAGACGGCCTCAA
AGACCACCTCCTCCTCTGGGTCGCCGACAGTGCTGCCGCCGAGCGGTGAGCCGCCGTTCAGCGCGTGCAGGGCGTCTTCG
GCCGTGCCTCCACGGCTCGGGCTGCTGTCTCCGACGGCGGTCAGGCCGCTGAGCGAAAAAGTCGGTGACATCAGCATGCC
GATCGACGACAGTCGCTTCTCATTGCGGTTGATACCCGACGCCAGCGCTGACTTGCCCTCTTCCCACGCCTGGATCAGCA
GCTTGAGGTCCTGTCCGATCGAGTCGTACTGGGCCATCAAGTTGGGGCCCAGATGCGAGATGTCCTTGGCCTCATTCAGC
GTCCGGTCCGACTCCTCGCGCAGCAGCGCCAGTTTCGCCTGCAGGCCGCGGATGCCGGTCGACAGCGAGTTGAGCTTGCC
CAGCTGTGACCGCCACCTCTCACGCCCTGGCGACAGGGGAGCCTTCAACGGCGCGTCTTGTGAGAACATCTCGACCTCGC
CGAGGATCGTTTGCAGGCGGCCGTAGCAGGTATTGGTCGACTCGTTGAGGGTGCGCAAGCCTTCAGCTGCCGTTGACCAG
CGCAGAAAGTCGGACTCGTCATCGTTGGCTTCCAGCGCCAGTAGTGCACACAGAAACATCCGGCGGACAGTGTGAAAGCG
GGCAGCCACAACGGTCAGCGTTCGCAGCGAGTCGGCGTCGGCAAACTCGGATTCCAAGCCCTGCATTGCATCGGACACGT
CAAAGTCGGTGATATCGTAGACGTGGTAGTACATCTCCAGGTCGACCTGTTCCGAAAGGCACTGCACCACCGTTGTGGCC
TGCTTATAGGCCGGCAGAGCATCGGAGAAACACCCGCGGACGGCTTTGCGCAGCCGCATACACCGTCTCGTCTGGCTGCG
GTCGTCCATGCGGCTGATCGGAGGCAGAGGCGCGCTTCTATGGTGAGTTAGTACACGAGCACAAGAGTACACAAGCTGTT
ACACCAACACAACGTACAATCTGTAGCCGCGCGAGACGAGCTCGACCTCTTTGATAAAGGAGATGGCCGCGCTCGCCGCG
CTGTCAAAGTCGTGTGACCGCGTCACAAAGGTCCGGGCTTCCGTTAGTGCCGATTGCCGGACGTGGCGCAGCCACTGTTG
CCGGAAGAAGGCATGGCCAAAGACAGCCGTCACCGTCAGCAGGACCAGCCCAACAGCGACCCGCCTCTTCGAGAGGTGAA
CAAAGCCGCCGGAGCACACCCACTGGACCGTCCATGCGACGACAAAGGCACTGGCCACGGCAACGACGACGCCCGGAACG
CTCGGAAGCTCCGCATCGGCATTGATATTCTGTGGCGATCCGTTGCCGGGCTGTGGCATGTGGCGCTGGCCCACGGCAGA
GGGCCCGAGGAGGTGGGAGGTGATGACGGTGTAGCGAAACTGCTCGAGAAACTGCGTGTTGTCGGCACCGCTGATGGTCG
ACACTACTGCTCTCTGGAACTGGTCAGCCTCTTTCTCATCACCGGAAGCTGCATAGGGGGCGAGCAGTCATTTACCGAAT
ATCGGTTGTTTGAGAGCGATGTGCGCCGGCCTCCGACTCGGAGCGGATTCGGGATCTTGTTCCGAAAACGTTTCCTCACC
AGCGGCCGGCCCATGGGTGCGAACGAGGGCGACGGCGGACTCGGCGGTGGCGTGTCTACTCCATTTTCGGGTCGCAGCTT
CGGCCTCTTCTGTTGCTGTAGATCTGGCGTGACAGGCGAGCCGAAAGTAGGGGGCGCCTCGGCCGAAACCCAGTCATCTT
GCTCCTCCTCGCCTTCGTCTAGAGTGGGAGCGACTCGGTTAGGACGTGCGCCTCGGGGAAACATGGCGCTGAAAGTGAGG
CTAGGAGAGGAATGTGGTGTACCTCTGAGATAGGCAGCGAGAGGAGTCTCGTCAAAAATTACTGTTTCCATAGGTTCAGA
AGCGAGGACACTACATCCATCGAGGAGACCAGCGTCGCGAGAAGCTGTCAGGAGAGCGACAGACGTCAACAAGACGACAG
AAGGCGGTAGGGGAGGTTCGGGACAATGCTGAAGAGCCGTAGGCGGTGAGAGGGGTGCAGAGAACGAAGCAGGAAAGAAG
AAAGAACGGATGCACGTCAGAAGTGGCGAACAAGGTAAGGAATGCAGAGGCCGAGAGCGGCAAGGGGAATGTGTCTAGAC
TGCCGGCGATGCCATGTGATGTCTCTGGTTCAATGGCCAGCTGGCGGTGGGAAAGACAGATTGACCTGCTGCTTTTCCTA
TCCTTTGCTGTCCTGTGCTGTCCTGCTCTTCCGTGCTTTTGCTTCCTCTTTCCTTCGGTGTAGATGGATCGTGGAAAGAA
GCAAGCTGTGCCGTCGTCTGCTGAAGGAGAGCGTCGTGGGTCCCTGGTGTTGATTATTTACCGACGTTGCGTTGCTGGAA
ATGAGCAATGAACAAGCCACAGGGAAAGGGTAAAAAAAAAAGGTAATTAAGATACATGGTGACAGCGAGCAGGGTTGCAG
GGGGTTCAGGGATGCGCCTGCGCCCACCGAAGATTAACGTCATGGCCAAGGCCTCCCTTACAGCGCCGCTTAGGTGAGAC
ACAAATCTCGTCGCTAAAGCGGTCGGTGGGTCGCGCCCTCCGGATTTGGGATGAGATCCGACCAATCACACGCTAGCGCC
TCATGCACCCTCACACGCCCGTGGTAAGATACACGTTTCTAGACTTCTGCAGATTTGCATCGAAGCTATCTTCAACGTCG
ACGCATCCGGCAGCAGCTGCAACAGACAACGACCGCTCCGCTTCCGCTGGCACGCCGCAAACGCACACACACGCACCATG
TCGACCGAACGGGAGCTCCAGATCGCGCCGCTCGTGCAGGAGTCCATCATGCACAACTCCCGGGTAAGAAGACTGCTCCG
AGCGGGTGAACGGGAGATTTATGAGACGAAGGAGGCTGAAGCAGTGGAGGTGACCTGTCACGCATGCTGACCCGTTCGCG
CACGCGCACACACACACGCAGACCCTGTCCAACCTACAGACCCTCATGGCCTCCCTCTTCGGCATCGGCGCCGGCATTCT
GGGCCTCGAGTCCTACAGCGGCTTTCTCTTCTATGTCGCCTTCTCCCTGCTGACGACCGGGCTCTTCTTTGCCTTCCGCG
TCGTCACCGCCTCCCTCGCCCTGCGCAGCGCCGGCAAGCCCGTCGCCCTGCTCGACACCAGCGCCTACTTCCGCAGCCCG
TGGGAGTTCTGGACCGGTGGCCTCTCCAACGGCCTGGCCGGCTACATCCTGACCTGGACTCTCTTCTACGGCCTCGTCAG
GGCATGAAACGGCAGAATGTCTGAGAACACGAGGGCAACGAAAAAATAGAAAAGAAAGATGGCGGAAACCTCCGAGGATG
GATAGAGCGCATGGGGCACCTTGCACGGTTTTGGGGCGCATTGTTTGGGAACGGCATATTTATGACGGAAGCTTGTCTAT
TCCGAGAGTCCGGCTCCTCCCTGTAGCTGACCCCATCACCTCGAATCTACATCATATACCCAATTTCTACGCACCAGTTC
TTTCCTTCTTCTCAGTCGGCAATCTCGACAACCTTGCCGATAAACCCGTCCAACAGAAAAGCTTCTTTGCTGGCGCCCTC
TAGAATCACAATCTGTGACCCCAGCTCGATCCACTCCCGCCGGTTGAGAAGCTCCAGCCGGACATTGTAGCCGTGCACGG
CCGTGGTCGCCGCCCCGTCCTGCCTGCTGTCGGCCTCGGCAGTATCGTGCAGCCTGAAGACGCTACCGGGAAGTAGTCCA
TCTTCTGGCGCCCCGTCAGCCTCCGCACTGATGCCGAACGAGTCTCCGAGAGATCCGCTCCAGATCTTGGCAATCCTTGC
CTGTGCCCGCACGCTGGCCACATAAAACGTGACGGCCGTGCCAGTGGCGAGCGATTCGATCGTCGCGTCCGCGAAGAATG
CCGTCAGTCCGCTGGCTGCCTGCAGCTGCAGCCCACTGTCCACCATGTGCTTGCTGGGAATGGCAAGCACCATACCTCTG
CGGGGTTTGAGGTCAGGGGGTGCTGCCGGCTCAAACACGTCATCGCCTGCAGTTTCAGGCGGCAGGGCGATGAGTCCGAT
CGTGCCGACTTGGTCAGTGGCGAGCGTTTCTACTGGCAGGCGTAGATTGCGAATGCTGATGACTCGTGCATTGTGCCACT
TTCCGTTCAGAGCAGATGCAGAGATGGCCTTCCTGGCGGCAATTCGCGAGAGCTCAGAGTTGGACGGGTGAGACGACGAT
AGGACAGTGTGACTGCTGGGCGACGCCGTCCGCTCGTCTTCCAGAGAAAGACCACCAACTTCACCCTCCGACTGAAACGG
ACCAACCACCACAAGGTCTCCCACAGAGATGCTGCCGAATCGCAGGTAACCCGACACCACATAGCCAGGATCTGCCAGCT
CGCCGAGATTGCTGGAGGTGTATGATGCTGGGCGGTTGTACTGACCCTCAATGTGGAAGAGCGACTCGGGTTCTTCCGGA
TTCAGCGCCATGCCGACATAGTCTTGGGCAGTCGGCTCAGGCGGAAGGGGTAGTGAGCGGAGCAGGGCATGCACCATGCC
GATGCCGTCGCCGCTCACTGTGCTGGACAGGATTACGGGGACGACAGCGCGGAAGTTGCTTGTTGCTTGGGCATGTGAGA
GGGCCGACTCGATTGCCAGGGCATCTGTAGCTGGGATTTGTCGGATGTTCTCGGAAGACTTTTGCTTCGACTGCAGGAGC
TGCGGTGTTCTGCCAGCATTCTTCACGGCCGTCCAGATCGGGACGAGAGTCCGCTTGAGCGACTCCTTATTCAGCAGGTC
TGACTTGGTGATGATGATAGCGAGAGGCAGGTTCAGCTTGAGACAGAGGTCGAGATGTGCCTTTGCAAGAGCCGCACTGC
CTGCGGCCGTGTCGGAAGCAGCAGCAAGGCACAGAATGGTCCAATGAGGAGCCCATCCGATGAGGCCTCGAAGTGTAGTG
CGGCGGAAGCGCGGATGGCCGGCAGAATCCGACACAAAGACGAGACGGCCATCCTTGGTGTAGTCATGGATGCCGATCCA
GGACTCGATATTCTGATTTGCATAATTGACTATACGGTCCTCTGAGTAGCCCAAGAGCTCCTGCGTCACGGTGCTTGTCA
GCCCAGAGGCCAATTCGTGCAGGTGCTTGAGCGAGTTGAGACGGCTCTTCCCATGTCCGTCATCCAGCGTGCCGGTCGAG
AGGGTTCCTAGCAGGGTCGACTTTCCCGAGCCCGTTGGCCCAGTCAGAGTGACCCGAAGCTGATCGGTTGTGGCCGAGCC
AAGAGTAGTCAGTGTTTGCTTGTGGTTGGAGCCGGATGAGCCGTAAGACTTCATGTGTGGTCGGACAAACACCTCTGCGA
CCCAGAGGTTCTCTCGGCCTTTCGGAGGAGCAGTCTCAGGGCCTATAGATGGCGCCTCATCCGCCGTCCACTCGCACTCC
CCGACAGCCACCATGCGCTGGACTTCTGCCGTGCAGCCCAAGCTTGCTGCCATCCAACGCAGTGTTGCCACGCTCTGGTC
CATCTCGTCCTTGGCTATGCCGATGAGGGTGCCGTCGTCGGCGACGCCAATCTCGTACAGAGCACCTCGCGACTCCTCCA
AGCCGGGCGCAAGTCTCCCCAGCGCAACAGGGAGCGAGGAAAGCTCGACGCCATCCGGCAGCACTGGCACGTCGATGTCC
TGGCTGGCCACCGACGCATGGTATGGAGAGGACTGGCGCAGTCTCCAGAGCAGCTGGGTGGTGAGATGCTGGCACCGGTC
TTGTCGTGTCTGGCCGGCGGTCGAAGAGCCTACAACACGGGTCTTTTGCAGATATTTCGGATCCGTAGCAATCTTGGCCT
GCAGCGAGGCTGAGAAGTAGGAGAGTGGCTTGTATGCCCGTCGTGGGCGCAGGAGGAGGTGGAGCTTATATTCCACCGGA
CCGTCCTCGGGCTCAGGAGGGAGCCTGGTCACCCCATAGTCCGACAGCAAGCTGTGTGCAACAGTGCCATTGGGCTGAAG
GCCCTGGTCTTCCAACTTTGCCGGCAGCAGCCAGAGAGAAGACACCCGGGGTGGATTTGGGTCGAATGTGAAGACGGACA
TGGGAACGTGTCTGTGGGCCGCTCACAAGGAAGCAGATCGGATTCACACAGCTACTTGTAAGGACCAGCCAGCTGTTGGT
AACATTGGACGATGTGAAGATGCCAGCAGTAAAGACAGTCGAGACATTCGAGTCAGCATTTTGGTTCGATCAACGGTTGT
CCGGACTACTAGAAGATCGGAACTGGTGTTTTCGGCAGGCGCAATCACAGGGTCGAGATGTTATTAGATCACCATATCAT
CTGGACGGAGAACAGGCATTGTCAGGGATCGAGAAAAGACGGCAACTATCTTAGGTGTACGAGATTACGCAGAGCCGTGG
GTCGTTTACTCCGTATTGACTACCGATTAAAGTGGGTCTGTACGAGCCGGTGACTCTTTGACGATGACTGCCAGAAGCGG
AAAGAGGCAAGGCAGAAGACCCAGAGGGTGCTTATACTATGTAAGGTACGTCGTATCTTGCATAGTAGAGAGACGACTTG
ACTGCACGGACCTCTCACCAGAAAACGGCCATTTCGACGAGGGAATTGACGAAGCAAAAGCTTAATTAGAATGGGAGGCG
GTAAAGAAGTGCTCGTACTCCGTACTCCGTACATACTTCGTAGATAAAAATAGCCCAATGCACGACCTGGTTTTAGCGTG
GCTGCTGGAGGATTGTAGGCAGACACTTGTAGCGTGCAAGACAGTAAACAGTGAGCTTTTAAGCCCCGTAACACAGCGGG
GCTGAGCTTTGAGCCCCGCCTCAGCACCACTCCGTAGGCAGTCTCGAAACCCAACTGTCGTGGCGAAACGCAGGTCTGAC
AGGTCCGATTCTCCTTTTCCTTCTCTCTTCCCCTGAATATATCACCACTTTCATTTCTTTCCGCCACGACGACAAAGCGA
ACACGCTCGCAAACACACTCGTCACCAGGCATTTTTCGACTCTCAATTCGCGACTCTCCATCTCCAGTGTCCATTGAACG
TCCGATCAATCTCTCTCGCCTCATTTTCCGTCAACAGCAATGCCTCGATTCGGCTTCCTCAAAGACGACGACGATGGCAG
CAGCAGCAAGAGCAGTCTCTTCAGCCGCAAGAAGGACAGCCGTCAAGATGCCAACCCCTACGCGCAGCAGGGCCAACAGG
ACCCGTACATGGCGTCGCGAGGAGGACGTGCCGGTCTGCCCAGCGGGCCTGGTCCTCGGGGCCCGGCTCCTGCTTCCGTT
CCTCCTTCACGTGCGAGTGCCAACGAGCCTCCGCCGGCATACGGGAGCCAGGCACCGGCTGGCGGCCCAGCGAACGGGGG
CTACAGTGCTGGTGGCTACGGAGCAGCAGGCGGCTACGGCAGCAATCGCTACGACAGCAACAGCAGCGGTATGGGTCCTG
GTCGGCCACCCTCCTATAGAAGCACGGCTGACAGTGTAGCAGGGAACGGTGGTGGCGGGTCCTACGACAGCAACACGCGG
CTGAGCGCACGGCGTGGCGGATACGGCGGCATGGGTGGCGGTCGCGAGGAGGCCAACGATCCGAACCGGCAGGCGCTGTT
CGGAGCGGCGCCGGAGAAGTTTGCGCAGCAGCAGGCAGCACCAGGAGGGCCAGCGGCGGCGGGCGGAGCTGGTGGTGGCT
ATGGGGCGGCGCCAGCGGCAGGCGGTGGTGGCGGCGGCGGCTACGGCGAGGCACAGGAACTGACGGAGGAGGAGCAGGAG
GACGCAGACGTCAAGCGGATGAACGAGGAGACGCGGTACCTGCGGAACGAGACGGACCAGAGCCTGGACCGGTCGCTGAT
GATTGCCAACCAGACGATCGAGACGGCACGGTCGACGATGGCGCGGATGCACAACCAGCGAGACCGGCTCTACAACGTGG
AGCAGAACCTGGACCAGGCGGCGAACCACAACAAGATTGCCGAGCACCGCACAGCCGAGCTGAAGCACTACAACCGCAGC
ATGTTTGCCGTCAAGGTCAGCAACCCGTTCATGTCGAAGCAGCGGGCGGCCGAGCGGGCGCAGGCAGCGCTGGACGAACA
CCGGACGGAGCGGCAGATTCGCGAGGAGACGCGCCGCGCGGCCTATCTGAGCAACCGCAACGCCGACGACGAGTTCTCGC
AGCTGGACAAGACCATCGACTCGTCGCGCCGCCTGGGCCAGAACCGCAAGGGCGTCTCCAGCAAGTTCACGCTCGAGGAC
GACGACGAGGAAGACATTGCCATGGAGCAGCGCATCGACAACAAGCTCGGCCTCCTGTCCGGTGCTGTCGGCACGCTCAA
CGAGGCCGCCGTGGCCATGGGCAAGGGCGTGGAAGAGGACCTGGTGCATCTCGACCGGATCATGGCAAAGGTGCGTTTGT
CTTTCTTCTCTCTTCTTTCTTTTCGCCCTCTCTTTTCCTTTCCTCCCCTCACACTAACGCCTCCAGAGCGACAATGTGGA
CGACGGCGTCCGCGCCAACAGATACAGACTGGAGCGAATCGAGAAGAAGGGTTAATGGACGGCGGCCGTGGTGTGTCTGC
GTCTGGTTGGAAGCTGGCTTTTCGTTCTTCGTTATCTTGTTGGCGGTTCCTTGTATTGTTTCTCAGGCATTTTTTGAGCA
GCAGAATACATTGCTCCGAATAATATTGCTCTCACCTGTTTATGCAAATGTTGGTTGAAGAGCTGCTTAATTTCGTGAAT
AATATTAATTATAATTCCTATAACTTAAAACCCAAAAAGCATAAGTAGATCTCCGTGTCGAAGAAGATGCCCAACACCCG
CTGCGCCCTGTAATGATGCCATGTTTTCATTCCCTATTTTGTCTACTGCTCCTCCTGTATGCCGTCCTAAGCCGTCTGCA
ACTCATTTGACCAAGAAGACGCCACCACCGAGGAGAGAAAAGGCAACAGCCGTGGTCAGAAAGCCAGCCGCGACACGGCT
AGCGGTGGTGATAGGCGCCAGCACATCAGTGGCAGCCGGGGACGTCTGGGTACCGGCGCTGGGATTGCCCTTGGACGTGC
CGCCGGTCGAGGCGGTGACCGGTGCGGCGACCTCTTCCTGGACGAGCGAGTACATGATGGCAGACAGGGCATTCATCTGC
TCGCCGACGCCGACGGTGCCATCAAAACTGCCGGTGTACCATTTGAAGCCGCAGGCGGTGCCAGCAAGTCCCTTGAAGCC
GGTGGCCGGCGAGCCGGAGCAGGCAGCAGCCGCAGCCGCCGCATTGGCCTGCAGCAGCGGCACGATCTCGGTGGACGTGT
AGGGAGCCATCTGGGCGGTGCCGGCCATCCAGCGGGCCAGGTAGCCCTTGAAGCTCTGCTCGTCATTGTCACACAGGTTG
ACCGTCTCGCAAGCCTGCTCAACCATGATGCTGTTGTTGAAAAAGGTGTCGCGGGTCTCGTTCCAAAGCCCGTCCACGCG
TGTCTTCCACAGCTCCGTGCCGTTGGTGCCGTTGTACATGACGGCGGCACCGTGCAGAAAGATGCCAGCGTTGTACGACC
ACTGGATCGTGTCCTTGGTGCTGCAGTTGTCGGTGCCCGAGACCGACGCGCCGTCGTACACCTTGTAGTCGGACGTGATG
AAGCCGACGCCTGTCTCCCAGTCCCACACCTTAGTAGCCCAGTCGGCATACGTCTGGTTTCCCGTGAAACGCCACAACCG
CGTCGCCAGGTTGAAGAAGCAGCCGTTGGAGATGGAGTTCTTGTAGTTGTACCCGTTGTTGAACGTGAAGATCTGCCAGC
GCATCCCGCCGTTGCACGAGGCCGTGTCCCAGCGCGTCGTATACTCGTTGAACACCGCCTGCGCCAAAGCCAACCATTGC
GGCTCGCCGTCTGCCGGGTTCGGAAAATTGTTCTCAGCCGCCGACATGGCCGCCATCGCCCAGAAGCCCTGGTCGTCGTT
GCCCTCTGTGCTCGTCTGATTCGCCGGCATGAAGTCGTTGTTGTTGCCTGCCTGGTGTACCAATGCCTGCAGCGTCTCGT
TGTTGTACGTGTCATCGCCCGTCATGAACCAGTAGTCCACGAGCGTGCCGAACATGGCTCCGGCCTCCCACCCTGCCTCT
TGTGTCAGTGCCTGCCTGTCTGCTCGTCTTTGAATCCTTTCTCGGCGGCCGACTTACAGAAGTACGGGTCAGGCAGGTTG
CCCGCCACATCGCCCGTGTTATTGCCCGTGTAGTACTTTAGCAGGCCATATGCCACCGTACTTGCGGCTGCCTTGACAGA
TGCTGCACCCCCAGAAGTTAGCATTGGCTACCGCCTCAGACTAGACCCTACCACAGGACGTACTGGAGTCAGTAGCATTG
ATCACAATGGCATTGGCTCCCTGTGCCAGTAGCCAGGCGATGCCTGCAGTCTGTATAGATAGCTTCATGGCGAGAAAAGA
GTATCACAATATATCAAACAAGGTGGAATTAAATGAATGGATCCGCCGAATCTCCAGGATTTGGCAAAGTATGAATCGAA
AATGAGACGCAACTGATAAAAGGAAGCAAGTGAAAGTCCAGCTGGCACAGCCAGATCCGCCAGGGTGACGAAGAGAAGCA
GAAAAAAGGAATGGAGAACGGAACGAAGCAAGAAAGGCCAAAGTATGACCGTGAATCCAGGCTTGGAGAAGAAGAGAAAG
AAACGAATACCGAAAACGGAAGGGAGAAAGGAAGAAACGACACAGCATACAGGCCCGCGAGGCCGTGTTGCACCAGAGCT
GCGCATGAAACAAGTTGGATGTCGATTACGACCCCTGAGGCCCCGGAATTGGACAGCCCGTGCGGTCCTTCTCCATTCTG
AAATAGCCCTTGCAGGGTACAAAGAATAGGACTCGGGCCTCCACTCAAATCATAGGCCTGCTATTATTGTGTCAAAGCTG
CAATAGCGACAATGACTTTCAGGCACCAAAAAGCCCATTCAGGTACTGACCAATGAGAGATCATAGCGCCGGCCCAACAT
TCGCGCCCATGCACAGCACGTGACGCATCCCTTAATTTCAGCCGCAGTGGCGATATGCGTGCCACAAGCCGTGTAAGAGA
AACGACAGCTAGTGAGCTGCATTACGACGTAGATGTTGACAGGTGCTGAAATTTGATTGAGTTGCACAACGAGGTTCTTC
AGATTAGGTGTGGTCCTTGTCGACTATCCAAAAGTCCATAAACTGGTTTGACTAGGCGGGGATCCAAAGCTGACATATTT
TTGAGTAGATGCGACTGCTTGCCAATGGATCAGTAATGCCTGGTACATTTAGATGCATTTGTGTGTGCGTAGGGGTTCAC
GAACGAATACATTGGAACCCTGCCAGCGCAAATGCAAGTTTGGTTTTATCAGACCCTGCGTATTCAGGCATTGACTCTGA
AATCGGCTATATAACTACGATTGCAGACCCTTGTTTGCAGACCCTTGTTCATTAGTCAGACCAACTGGCATTTACAAAAC
TCAGAGCTCGTTGACGATAGAAATCGGGGGGGTTTACAAGAGTATTCCCTTTTCACAATCTAAGATAAATAGCTGCTGGG
GTTTTGTGGAATTCGCCAAGCGATAGCCCCTGAAATACACGAATGCTTTATTGAACTTAGGCTCATCTTCTGAGATTGAT
ATTAGTCGAACAACCTCTGCAAGATCGAGAGCCGCACCCGATCGCGTTACTTCGTACTGCCTTCGGTGTGGAGTTAAGAT
AGAAAGGGCCCGTAGGCTCCACCCGCAAACTGATGTTCGACCCTCAGACATGAGCCCACGAAGAATCAGTCTTCCCAAAT
TCACGGTCCGAGTTTCGTGGCTGAACACCACTGGGGACTCGATAGTCGGAGATGCCATGCAAAGGATTGATCAGGGCACG
GCAGCAATCTAAAGTCCAGAGGTACATTTTGATTCCTCTTCTTTTAGCTTCCCATCGGGACCTAATCTCCTTCCACCTTC
ACTGTTGCCGCTAATGCGTCAGGGTCGCCCTGCAGTACAACCTTGTGGTTGGGACCTCTTCAATCTCACAAATATATGCT
TAGATCTTGACGATCTTGTGCTGTATTGAATACCATGATACAAGTAGCGAGGGTGGTGGGCCCGTCTACCCGCCCTCTAG
TCCGAGTCTAAGCCTTACGTGCCCAACAGATTGCGTGGGGTGTTGGGCAGCGATGCGTCGAGCCAAGACCTGCTGCCGTG
ATATCCTGTACTCCATCTAAATGGCAGTGGGGTACCCATTCGCTGACGGCAGGCATATGGACTACTAATCTTAGCCGCAA
CTACGACGCTCAAAGTCAAGGGCTTACATATTACGTCGTACTCAAACAAAACGATACGACTTTTGGTGGTCCCTCAGGTC
GTCGTCGGTTTACCCGAGCCCTAAGCCAAAAACCTGGTTCTTGTGGGGGTCTCACGCAGCCGTCATCTCCTGACCGGAAG
CATGTCTGTGGTGGTAGTAGCGACTACTCCGTAAAGTCATGGTTTCTTCTTATCATTTCGGCTCATGAATGAGCGGGTAA
TATCCATCAGATGCATGAGATTGTGTGATAAGATTGTGCAACCTACTGCTATCTACCATCAATGCAGAACACAAAGTAAT
ACCGGGCTTGAGAGCGTTCAGCCATATTTACAGCGAGATCTTGTAGACAAATCTGAGACGAATAAGCTACATTAAGGGAC
GTGCATGTATAGCTAAACCGTTCAGATGACCGAAGCTATCTTTTCCTCGTACCCAATTCTATAATCAACAATTCAAGCCC
AAGTAACCATTTTTAGATAAAAGAAGCCTGTAACGCCAAGTATGCTCCGTCATAGCTTGTTGCCAAGGGTATAAGCAGCG
GCTTTGCCCCCTGCCCACCCACATCACATGATATATAATATAGTCGTAAGCAGAAAGCGACCTTGCAGGGCGAGATCACA
TTATCTCGTCCCCGCCAGCAAGAACAGCCAGCGGGACGGCTGTCTCAAAGGCCACCACGGGCGCCGCCGCATCGGCTTCT
CCCATGTTCTCGTCCAGATCGTCGTAAAACTTGCGCACCGCCTCGTCGCCACTGTCGACATCTTCGTCCTCGTCGCTGCC
ATCGGCGCCATCCGCAACCATCAATGCCCAGGCAGCTTTCTTGCTCGCCGCATCTGCGCTCACGTCCGCCTCGATCTTGC
TGTTGATCTCGTCCCAGGCCTTGCGCCGGTAGTCAATTGACCGTGCCTGTGTCTTGCTGCGCTGCACCTTCTGCGCGGTC
CGCTCCCCCACGGCCGCTGCTCGATCCAGTCCCTTCTCTTGGCGTCGCCGCGCTCGCGTGCTAGGCACCGACTTGCGGCC
CTGCTTGGTCTTCTTTGAGACACCCGCCGACTGGTGGATCCCCAGCACAGACGGCCGGTGGTCAGCCGTAGACTCAGGCG
GCTTGATATCTTTCAGCGACTTGTCGGTGTCGATGCCCGGCGAAGTTGCCCGGCGGGCAGCACGCGAATGCTTTGAGGGT
CCTGGAAGGTGTTAGCTTTCTCGGCTCATTTTCCTACCGAATTAAATGCTTCCATGAGAAGAACAAAAAGGTAAGATAAC
GCACCTTTCTTTGCCATTTTGAACCTGTGATGAATTGTTTGTTTCGTGACGTCTACCAAATTGTGGTTATTGACTTTGAA
CTTTTTTTGGCGGGGAACATTCTGCCCTCGTATACCGCTTTCTAAATAGAGCGGCATTGAGAAATGTGACTGTCTGCGCA
GCCACCACTGCCTATCTATCATTTCTACGTCACATGTGATCTGTTTCGCCTCCATTCCTCCCTCCATCCATCTTACGAAA
CGTTTCGCTTGCTTACGCGCCACCCATTCGATCTGGCAGCGCCGGGCGTTGCATAGGCAGTTGCATCTCGCAATTGCTAG
AAAGCACGACCTTCCTCTCCTTCCAACCTCGATCGATCACGGCTATTAGCGTTGCCGACAATCCTCGACTACCCTAGCCC
AAACAACGTATTTACTCCGTTCCTTCTTGTACGGGTACTTTTACGTCGAGCATCCAACGGCTCCTCTAGCAACCAACCTG
TCGCTGTTGCTTATTCTCGGCCGACTTTCCATCGGCCCAGGATGAGCTCCCACGATGCTTGGCAGATCATGACCGGCAAG
CCAAAACTGCGGACCTTTTATGAAACTACCTACTGGGATCGACTGGCTGAACACAGCTTTATTGTTCCATTCATTGTCCT
TCTGGTCACTATTGCTTTTACCACCAACATAATTGAGCCCGTCCGCTATCTTCTGCCATCCGCGACTGGCGAGCGACTTT
GGGACCTGCTCGTCTCAGCCACGCCCTCTTCTGTTCTCTTTGCTGTCGACGACTGGCTGAATCCTTTTCCGACTCTCCGA
CCGCCTGTCGATCGTGCCTCTAAAGCCGCTCTGAAAGAGGCCAAAAGCAGTGCCTTGGGTCGCTTGCTGAGGAAAGACAA
GGCCGGTAGCATTATCGCATCCGTGTCTTACGCTGGCAGAAGCGGCCTCTCGCGACTCATGCCAAAGGGTGGAGTCGACC
GGCCGGCAGGCCTCGGGAACATCAGCAACTCCTGCTACCAGAACAGCATCCTTCAGGCCCTGAGCGCGCTTGCCCCCCTT
CGCGATTATCTGTCATGGATAGCTGAGGAGGAAGAGACCGGAGGCCTGCCGCACGTTCAAACAGCCCATACCCTCGCACT
GTTTAGTGCGCGATCTCTTTTGGACATGCTGTGAATGGAGAGACGCTTTGGACACCACCGGTTCTTAAGAGGATGAGCAC
TTTTCAGCAACAGGACGCACAGGAATATTTTTTGCAAGCTATTGAACTAAGTGCAGGAAGAAGTTGAGAAGGCACTGAAG
GATGTTCAGACTCACCCAGGCTTCGAAACTGACTTGGGCGCCGCCATACGGGGAACCTAGGAGCAGCAGTCCCGAGCAGC
GAGGACAGTGGCTACTTAAGCGCATCGTCCACCTCGAAACAGGCCGCCGCTGCAGCTTCCTTGTTTCCGCATCCCACGCC
AAGGCCTTATGGCCCATCGAATAGTATGCCGGGCCTGTGGTTATTCATCGGGGCTGACCATGAACCCATTTTTACTGTCT
GACCCTGTCTCTCGGCTACGGAAACTCCGAATACCGCTTGGAGGAGACCCTGGACAGCTTTAGCGCTGTCGAGAACATCG
AAGGTGTCCAATGCGCCAGCTGCACTCTCTTGACGTTTCGCAAAAGGATACGGGTTATCATCGGTCGCTTAGAGGCCGAA
AGCAGCTCCTCGTATTGTGCAAAGAGCAATCAGCCTCTCATTTACGAGAGATTAGAGGCTATCGAGGCGGCATTGGAAGA
GGAAGACTTTGAAGAGAAAACGCTTTCAGATACTTGCAAAATCCCCAACAAACAACGTGTGGAGTCTACGAAATCCCCGG
AAGTGGGTATCGCCCGAGCACCGCCAAGCATTGCCTTCCACATCAACCGCTCCAGGTTCGACGAGTCGACCGGCTATACG
TTCAAAAATCCTGCTGCAATTCAGTTTCCTTCACAACTAGATCTTGGTCCGTGGTGTTTAGGTAGTGCGGCCTCACGTTC
CTATGAAATCAGTGTAGAGCATGAATCCGGTCTCAAAGAACCAGATGTCGACAAGAAGGACAACCGGATCCACCAGCAGC
GGTCGGATCAAGAGCAATATTCGCCTTCATTCTCATCTGTACCTTCGTTGATGACCGACAATTCCTCGACCTTAGAGGAT
GAAGAACAGTGGCAATTACCTCCCCAGTTGCCCATGGTTTCTGGAACACAGTACCCGTCCAAAATCACTGGCCCGCTCTA
CGAACTTCGAGCTGTCATCACGCACTATGGCCAGCACGAAAACGGACATTATGTTTGCTACCGAAAGCATCCTGCTCCCC
ACCGCCCTTCCGACGAGGAAGTAGAACCTGAGAAGGGACGGGACAGGAAGACGCCGGGATTTGCGTCTGAGGCGGATGCC
GTCGTAGACGGGACTTCTGATGAAGCGACTGATGAGCCAAGTACTACGGAGAAGCTCGAACCCCTTGAAGATGATCACAA
TACTAGCGAATCTCAATGGTGGCGCCTCAGCGATCAAAACGTGACCCTCTCTGACGAAACCACAGTCTTGTCTCAGGGTG
GGGTCTTCATGCTTTTCTATGACAGAATTGACAATCGCTCTAATTTTACGTCATCCGCTGCACATTCTACCCGAAGCAGT
GAAGACTTTTCAGTGGCCGACGCCGACATTGACAGGGCGCCGATCTTGTCAACTGACGGGGAGAAAGAAAACGCAGGAGA
CGACACCTGTGATATTGCACCACACCAGGTTGCCGGCTATATCGCTGAGGAAAGGGAGACGAAAAGTATCAACTACGACC
TGCCGGAAGCAAAGCTGGCGGAGGCGCCGGCAGCGTTTGTTCATGCCAGCCTTGAAGGATAGGCATATTATGAGGGCAGG
TTATCCCTGACAGCTGTACGTTTCGGTCTTGATTTTGCGAAAGCAGAAGAGCAGTAATTATTTCGCGTATTCATAAGCAA
CAGGCATGTTTCTATACATATATCCAGCATAGCAGAGGCGTCCATGGAGGATTCGGCGGGCTAACATAGCACTCTGGGGA
GGAAAGACATAAATGCATTATTAAATAATGTAGGATATTTTCCTGTGTCCAACGTACACCTGGCGACGAATGCTGCAAAG
ACTGTTGTCTATCGGAGAGAAGATACATTAGAGCGCGGTCGAGAAGAAGAAAAAAAGCATGGCAGAAACACACACTTAGC
TTGGGCGGTCGAGATTTTCCTTTGCTCCAGTCATTCTCGCACGGACCAGCGCACACCGCCTGCGAAATTTTCTGGGTCTG
CATCTATAAAAAGGCTGGCTCGCCCCCGTCCATTCTAGGATTTCTTTTCTCTTTTTTTTCTTCATGACGACAATACTTCA
GAGAATCATTTCTATAGTTTTTGTCCTCTTCACTGTTCTCTAAAACAGAAGCAGTACCCACCCGGGTTGATGACTTATAT
CCTCAACTTGCCCACGTTTGTGAAACGAACAAAGCTTTGCTTTTGACCCTCGCACTGCCTGAAAAGGTGGCGGTTCAGGA
ATTTTCCAGGACTGTATTAGAGGGTGGTGATGAGCTATACCCCAGATTTGGGTTTCTCCTAGTGAGAACTCTGCTGGGGT
GGGTGTTGATGGACGTCTGACCGGCCTTTTTTTCCTCTTTTTTTCATTGCGCTCCTGAGCTAGTCCCGGGACGTGAAGAA
GAAAACATTTGCTGTTGCTTTAATGTATGAGTCGGATCTCACACATTGAATTAAACTTGGTGCATCACCAAATGCCGTAC
AGAATATAATTCGATAGTTAGAAAGGGTGCAGAGTACGGAGTATCCGTACAGAAATATTATCTTAACTAGATGCGGGGCG
CTCATTGGCGAACCGGTAGGCAAAAGACTTGCTATAGTCTCGTATTTTCCGTAAGAAATATGTATCACGAGTTACTCCGT
ACCTCTGTAGGCACAATCCATTCCACGAGCAAAGCAGCAACTGCAAGCAGGATTGATACATAGTGGCTGATAATCGCGCA
GTCACCTTTGATAAGCAACTTCAGCGTAACTCATGGCAGGCAGTGGCAACCAATTGGTGCCTGCCACAAAAATGTTTGGA
GGCAGCATGCTCGCACGGACCAACAAGGAAACTCCTCCCACGCCTATTTAAGAACTGGCCACCTCCCGAAACCATCAGCC
CTTGGCTCCCCTTTTTTTTCTCCTTTCTTCCCTATCCTAGTGCAAGGGCAGTACGCATTCAGTGAGGATTCGTCCGAGAG
TGTGTTTTTGCTGGTTGAAAACTATTCCTTGACCACTCCTATTGGGCCACTGGCTCGGTAGGGAATTTTTGGCAAAAACA
CTCTGAATCTTTTCATTACCATCGTTCTACGGCGCGAGGTGAAGAAGGGAATAGAAGCAAATCTGGGGATTGACGACTGG
GCTGTCGTTTGCCGTCACAAGCTGCTGTCACTCCGTATTTATCGCGCTTTTAGCAAGACGATATCGAGCATGATAATTAA
CAACAAGCAATGGGCTCTATATGTCAAATGTCGGTGTATCCCTTCAATCAAGGGGACCGTATGTTTTTCCAGCTTCCTTT
TCGGTATCTGCTATGTACGGCTATTCCGTTGCAGAAGCTGTCGGCGGTTTGAAGAGAGTTTTATTCTACTTATCCCAGCT
TGTTGGCCACCTGAAGTTTGAGCTGGTTCCAGTTTGTATATTTCCTTTGCTTTGTCTATGGCTACTAGGTTTAGAAACGG
CAGATTGTTGGCAGATTGACGTGAGTGACGCGTGAAGCTACGATATAGGTTATAGGGCACAGAATGGGGAAATGTATCTT
GCTGTCATTCCCGCTCTGCTTGACGCTGTGCCGATTTATCACATCATGAATGTGGTCTCCTATTTTGATGCGTTTTAGGT
TCTTAGTGTGCATTTTACAGCGATGGCAATATACGACGTACTATCAACAGGCTTGGCGCCAGAGAAACAAAGAAACCGAG
AGAGCCATACGTCTCGCCTTTTCCCCATGAACTTTTGGGAGGCTTGTGAGGTGAATCGTCGTTGTCAGCTAACTACACAT
ATGCATTAAAAACCTAGGTTGTAAATGATAGAGATTAAGAATCAAAGCAGCTGTTATGCCTCAATCACTCAGCTTCTGCA
AAAAAGACCCATAAAAAAGACGAGACCCATATATGTCCTTTCCGATTGGGTTAAGCCGAGGTGAGAAAAAGTACAGTATC
TCTTGCACAGTACTTACTGTAAGAGTACTTGTAATTGCCTGCAGAGTATGTGAAACTAGAAGTCGTCTCCCTCCAATGCG
GCACGGGATTCCATACAGTACATTCTGTTCACTCCCAGTTCTTGGGCCTAACTCCCCACGCCCCCTTCCCTCTTTCTCTT
ACCTGTCTCGCGCTCAGTCCCGCCCAGTTGTTTCCCGTCATTCTCACCCGAAGGGCGAGACTTAATCATCGGACCTCATC
TCCCCTACCTGTTTCCGCCGCTCTTTCTCCCTCTCATATTCCCGTCAAAACTACTCACCCTGCCATCAATCGGCAACCAC
GACACTCGGCGCCGGACTTTCTCTCAATTTCGCTCATATTCTACCCCGGCCGATTCCGACGACTCTTTTTTTTCATACTT
CTCACACTTGGCAGTCGCCGTTCCAGTCGTCCAGAATCGCCCCCAAAATATTCGGTCGGTCGATGAAGTTCATCGACAAA
AGAGTCTCGCGGCCTCTCCCCGAACACCGCTCCTTCTTTTAAAACAGCAATAACCAAAAGGGACGTGCGAACGTGCGACG
AAATCGACCCACTGAACAGCCGCCCTCTATTCCAGGCTCTTCACGGAAGAATTTTCGATACCCGTCAATTTCTGCGCAAT
CCAGCGGCCGAAACATCTCTGTTTAGTCCTCCTTGGCGCAATATCCTCTGTCAGCCGCTCGCCGGAGAGGCGCGGCGATC
GTGCGATCGCTAGGCATCCTCTTTTGATCGTCGTCCTCCGTTGCTTGCGTTATTATTCGCTCTCTTTTTCTGTCGACTGC
TCTACCGATTTTCGACATCAGAGCACGCCGCTGCCATCCTCTCCTTTTTTTTTTTGCTCGCAGCTCTCTTCGCCTGCATC
CTGGTCGACAATCTGACGTAATTCGTCTCTCACGATACGGCTTTCAAGACCAGCCATGTCCTTCCATCCTCAGACTCCAC
AGAGTCCCTCTCAGTTTTCCCCGATGATGACCGACCCTCAGTCTGCATCATCCTCATCGGTCGCCAATACGATCAATACC
AACGGGGCCTCTTTCGCCTCCACTGCCACGGCATCAACTTTACCGACTCCTGCTCATAGCGTAAACGGTTGCAACTTCGG
TGCGGTCGACGTCGCACACGACATGTCTACAGATGATTCTCCGCAAAAACGGAAGCGCGCGTTCGCTGATTCTGGGAGCC
AACACCCGAAGAAAGTCCACATGGAGGGTCAGCAGAGGCTAGACTTTGAAGCCTTGCATCAAGATGTGGGCGAGAAGTAT
CTCGTGGGCAAAAAGGGTAAGACTCGTCCACCATTCCCCGTCATGGTGCTACCACGCCTCTACTTGCATACATTATAGCA
ACCTGTGTTTCCCTACCTTCACCTCGCTACTTCACTCCTCCTCTGCATACGTGTTGCCCTGTCTATGCTATGTAAGAACG
ACTTGTGTTAACACCCAGCTCTTCTTTTTTTCTTGCTACTCGTCACAGCTCATACACCATCTTTTCCACCATTATCGGAG
GATCTATTTTCGATGTTCGGCTTGTCAGGGATCGCTGCAGAAGTAGCTAGGACTTTACCGAATGGCGAAAAGAACGCGAT
GCGGAAAACGTACAAGGGTTATATGAAGAAGCTAGGCGTGTCGGGCCACTTCGAGCCGGTGAAGAGGGAAGACGGTGACG
AGAGCGACTTCTTGCGAATGCTCAGCGAAGCTGAAGACTCATGGCAAGCCCGCCAGGTCAAGACGAAGGAGATCCAATAC
GGCTTTGCCGACGATGTCACAGCGGATTTGCGGCTGGCTTTCACTATGAACAAAGGTCCCATGCCGAAAGCAATTTGGGA
CAGTTCCGTTTTGGGCGATCTGGCTCCAGATAAACTTGCATCCATTGGCACGAGACCGTCATCTGTCCGGGGCACAACCC
CGAGCACGCCCCTCCACCCAGCCGTTGCGCGGTCTAAGACCCAGCAGCCATCATTTCAGCAAATGGGCCCGGGAGGCCCA
GATGCTTCGCGACCTCGTCGGGTTAGCAAGAAGCGGAGCTATGGCGATAATAGCTTTGAGGGTTATGGCGAGGGATTTCC
TGATGACGATCTTGTAGATGGATACTCGACTGGCGACGGCGACGGCCCAAGCCACAAACGACGGAAAAAGGTGCTTATCG
GCGCTTCTTGCCGCGAAGAGCCTTTTGCTAACCCTCTTTTCCTGCAGGCCGCTACGTCTACATCACAATACCCACCTGCC
CCTGTCCGCCAACAAAGTTATGGTCCTGGCATGGTTGGTGCGTAGAATGTACGTACCCGTGCTGGAGTGAAGCGGTTAGC
TGCCCTTCAGAAGAAAACAGGACCCATTTGAAAGGCCTGGCCAGAAAAGATGTTGCTTTTTGTTGCTCTGCAGCAGCAGG
ATATCACCCAAGCACTGTTGAGGAAACGGGTATAATACCCAAGATGACGAAGAGGGCCGAATAGGGCGCGGCCTTCAAGC
AGCACGTTTTTCCCCACTCTGTTCAAGGTTGGACACAGAGGCTGCGGATGATGCCCATGTTTTGCATTTGCATATAATTT
GGAGAGTTTTGTCGATGCTGCCGTTGGCAGTATTCATTCCTTTTATGGATTTCTAGCATGGCGTTGGGGCACAATGGTTG
TCTTCCCTGTCCTTTTTCAGCTTTGTTTGTTATTTTTATTACCCTTATTTTAAAACCAGTCATGATGGTCATGAAGGGGT
CGGCTGGGAGATAGGAGAAGACGGAAGAGTGAGAGGGTTTCAAAAGCCCAAACGCACAAGAAAAAAAAAGCAAAAGCAGT
GGGATTCGAGAGAGCACGATAACAAATACCAATACACATAAGCTTTTAAAAAGCAGTAAGGTAAGGCCAGCCGAGAAGCG
AGGGGGAAAGACAACGAGCAGACACACAAACAAACACAGCTGAAGTCAAAAAGAGCTGGAAAGCTGGCTGGTGGGAGCGA
GAGCCTTTATATGGGGAGCTTCGAAGCACGAAGGGTGGAATACTTGAAGTTTCGGCAGCGGGCTCGGGAGGTCGGGATGA
TGTCAGAAAGGTTACTGTAGACGGAGTGCGTCGAGGCTTGTCTGTCTGAGTTTGCTGATTTTATGAACTCTTGATTATGT
TATTTTTGTCATAAGCCAACACATTAAACAAGTTTTTCATGCTTTGTTGGTGCAGACAATAGACGTTTCGAGTTCGACTC
GGCACGCATCTTACGTGTGAGATAATGCTCTGGTAATACAGTTTAATGTGCCATAAACTTCCGACCTCCCGTACGGAGTA
CTACGTAAGATACATGCAATTATCTTGTGCTTGTGGCTGTGTCGGTCACATTAATGAACTTACATATTTGTTTCGGCCTG
TTCCGTAAAGTAGTCCGCACTCCCACACGACCTACTTTACTGACTGCACCCACCCAGTATCGATGAGGGCCCGACTAGTA
CAGCTGCGTATACTGAGTAGAGCCGGCATAGAGAGCCACACTTCATATGGAGTACAAAGCAAACACTGACGTAGAACGCT
TACTACACACAGAAAAAAAACCTTGGTTCGTAAAGCTGTATGCCGACCTTTTGGATGTTTGGATAGATTTGCAGATAACA
ATATAACTTACCAAGCATATGCTTCGTGTTCCGTATACTCATTCAATTATGTACTTCGTACTCCGTAGATAAGCCTGCTT
TTCTTTGCAAGAGGTCAGTGCTTATTAGACGCCGACTTACTCTCCGTATACGAAACCGTATTTTTAGGACGGGGGTTTAT
CTGCCAAAATGGCAACTGCTTTGGACTTGAAACACCTATGATAGCAAATCTCCTTTTACAACGCTTTCCTTTGTCACGTA
CGGAGTACTCCGGACTCGTAAGATAGGTCTTTGATTACAAAATCCTTTAGCTGCAGAAGTCGTCCGCATGAGCAGAGATT
GTTTTGGGCATATGTTATTATGCATCTAAACAGTCAAGGTGCAGGGAGCCAGAGTTGGTTGCTGGAATGCAAGATCATTT
CTTTTGTGCAACACGCAGCATTCAATTATGACAATTTCTCAGCGTTTTGGCAGGGCTTGGCCTTCCGGGATCTCGAATGG
GGAATGACCGACCAGCGGTTCGTACGAAAATAATCTGGCTTTGCTTGGGACGGCATAAAAAGGGTTTGCCAAGTGGCTGA
CGCGCGTCGCGGCCCCCTCATTACATAGTACGTACGGAGTATTTGGGTATTATTTGCTGCAGGCTTGAGTGAGTGTGCTG
AGCACCGCAGCGGGTGTCTTGTATGAACTGTTCAGCCCAGCATGGGCCGCGGACAAGGCGAGAGGCGAGACGACGGAAGA
GAGAGAAATAACATACAGGCGCATGCCATTTCGGGGCGTCTGAGTCAAATGGCATTTCTGCGCCCTAGGTGTGGGAATTG
TCGATCCTGCTCGTGCGCCTGCAGGAATCGGCTTCCTGCCATGCGACATTGTTTGTGGTGTCGCCTTGAAAGACTCGTCC
GATGTTCTGTCGGCGGAGTCGCTACTCATTTGTCGCCCTGTTGCACGATATCTTACGTGGCGGCAATTCTGCAGCTTCTG
GACTGTGCGCTTTCAGTGTATGTACGGAGTAAGATACATGCATAGTAATTCTGGTGGGGTCCCACGTACTCGGTAGATTT
GCAGGTCTTATTGGCTGGCAAGCCCCTAAAGAAGAGAAGTCGGTATTTACTTCCATTCCAGTCAAGCGAAATTGGACCAT
TGGTTCACCAGCTAGGAGCTGCGCGTATGCGTGTAATTGGCCGTCAGGGCCAAATCGTCCCGTGCTAGGTAGCATGTACC
CACAGCACTAGGCCCCTTTCCGTGCCTGGCTACAACGTCGCAGCATGGCCCGCGCTGAATATCAAATTTCCTTTTCCTTC
TTCTCTGCCCCCCGAGTGGGCCACAGAAACAGGTCCAGAGTGTATTTTTATTACGGCAGGACCTAGCGCGCAAAACAACA
CCGGCAGGAGAGACGGACGGGACCTTGCGCGTACATCGCCTGGCTATCGTCTTTGCTGCCCTTTCGCGTGTTGCGAATGC
CCGTTTTCCTTTTTACTTTTGCTCTTGCCTACCACGAGTACTCGCGGTGGCTCGCCCTTTCCCATCGAGCTCCATAGGTC
CCACCCCAGCATCGCCTGGCGACTCCTCTGTTGACGAGGAGCTGGTAAAGGTCGAAGACGACAAAGCAAAAAGTCAAAAG
GACTGCGACCGGTGCAAAAGGGATCGACATTGATACACGCGCACGCCCGCTCCCAGCTTGACATCACGACCACTTGAGGC
ACTGCGTGCACTCCCTCACGCTCTCTACCATCCGCCTTCATCTCCGAGATGAAGGAGTTGACGACGCCGACGAGAATCAC
CATCACGACGAGCATGGATTGCGCCAGCCAAGCCATCATTTCTTCCGTTGTGACCACCAGGTAGAGCTGCCTCTCTTCGG
ACTCGACACGCCGACCCTCCCTCGCTCATCACCCTCTGGAGGGCATTCGGACGGATAGAAGACGACAGCCTCTAGTCCGA
TAAATGCACCTTTGACGACTTGTTCGTCCACGTACCCAAGCCAAGGGAAACTCTATCCCGCACTCGATAAAAAAACAAAT
CACGCTCGTTTCTTGCAACCGTTCGCTTCGCATACGTTCCTTGATCTTATATATCTTACAATCACATTCCTTTGTCATTT
TTTCAACATCGTCCAGGCCGGCTGAGTCTCCCTTGCTTCGCCACATTATGACCAGCTACGTCCACAAGCCTTCACTCCTT
CAGGCCGGCATGGCCCCAACTTCTGCAGAACCCTCCGCCGCCCCTCTTCAACATCGCCACCAACATCACGAATACGAGCA
CCGCCACACCCATCGCCGCATGCACGATCTTTACAGACACGGCCAAGATGCTACAGGCGGCAACATGGACGAGCCCAAAA
AGCACCTGTTTTCACAGGATATCATCGACGAAGACGCCGACCATGACGAGAACAGCCAGAACGACCTTCGTCGCCGTGTT
ACCGAAGTCGTCCAGACCGTTTCCGTGGTCCAGGTCATTGGCAGCGACGGTTCTGTGCTCGAAGTGAGCACTGCACCCTC
TTTGCCGGTGACCACACTGGCTTCCGACTCGGCCACCGCGTCCACTCCTGATGTGGCCGGTGTTTCTGGTGTCTCGTCTG
CGACCGCCGCATCTCCGGCATCGGCCCTGTCACTGTCGTCGTTGCTGCCATCGTCGTCGTCGTCGTCGTCGTCGTCGTTG
TCGCCGTCCTCATCGCCGTCTTCCTCGCTATCTTCCTCACTGTCCTCTTCACTGTCCTCATCGCTGCTTTCGTCCTCATC
TCCGTGTGCGTCTTCGTCTGTGTCTGCGTCAAATTCGCCGTCCTCTGCTTTGTCGGCAGCAGTAACAACGACAGCCTTTT
CCAACTCGACGATCAGCGGCACAAGCGGATCATCTCCCGCCACTATTTCCCCGCCTCTGACCACGGGATCTTCATCCGGC
ACACTGCTGCCAAACATAGGCAATTTCACCAACTCAGGTATGCTTACACCCCTCCGAAACTCTTCACCCCGCCTGTCTTC
GTAGCTAATGGAATAGTTGTTCCGGCCGTGCCTTATCCCAGCAACAGCACTGCTCATCGCACGTTCTTTGGCAGCTTGTC
CCACTCTTCATCCGCATACTCGTCCTCCTCGGTTCCGTACAGCTCTTCCACAACGTTTTCCAGCTCTTGGATTTCATCGA
GCTCTTCTTCTGCCGCGATCGCTTCCTCGTCTGCCGACGGTGTAGTGGTACAAGTCGCGTCCAGCGGATTGGGCTCTGCA
GTTGCCGGCACCACTGCCGCAGCCACTACTGCTGCGATCGCACCCGCTGCGTCTTCTACGGACACGAACTCTGACACAAC
GACCGGGACACCAACAGGCACGATCGTTGGAGGCGTGGTCGGCGGTGTAGCTGGGCTGGCGCTGGTGCTGCTTGCCGCTC
TTATGTTTTTGCGTTGGAAACGTCGGATGCAGCAGCACGGACACAAGCTGCTGGGCGAAGGCAGCAAAGATGCAAAACCA
GGCATGACCAGGACACTGATCGAGGCGGGCGAAGTTGCGGGCCCTGGCGCCGTGACTATCCCCGCCGTTGTTGTTGGTGG
TGGTGGTACAGGTGGCGGCAGCGGCATTGGTGATGGTGGTAGTCCTGGCGGCAGTCCTGTCGCCGCAGCTACGGGCGACG
CCATGACCGAGCGGCGGACAACGTTCCTGATGCCGTTTTCTTCGCATGCTGCCAAGCGAATGTCGAGGGGGACAGGTGGT
GCGGACAGCGATGGCGAGTCGGGGTTCTACCGCGTGTCTGGCAAGAAACTGCCGTCGGTTCTGATGTACGGCGGCGATGG
ATATCGCGATCCGCGTGACAGCGTGCAGAGCGGCTCATCCGTGGTCTTCCGGGACTCGCAGGGCTTCTTTGGCGGCGAGG
GTGGTCCGTCCACGATGCCGACATCGCAGTATGCAGTGGGCTCGCCAATGCGGCCGGTGAGCGGCGTGCCTGTGTTCCAT
ACAGGTCCCGGAAAGACAGCCATGGCCATGCGGGTTCCGTTGTCACGACACGGTTCTACTGTGTACGACAACAACGAGCC
GGTCAGCCCGAACGAGCTCGTGCCGCCATCTGCATATGACCCCATCGGGCGGTCTCTGTCGTCACAGGACGGCTCCCGGG
CATCTGGCTCCCGATTCACGGAGGAAATATTCTGATCTGTCTTCGGCAACAAATTCACACACAATCACGTCCTCTCCCAA
CACACACACGCTCTTTCTGTCTCTCATATGTACATCTGCGCTCAGACTTGAGCGCTTTGATATAATGTTTGCAACGCCTG
TCCCACGGGTCTGTCTGTTTTCTGGGCGGGACAATGACAAAAGAGCAAAGCATGGTCTGGCGTTTGAAACTTTTTCCTTT
TTGAGATATCTTCTGTGGGTCATTGGTATAACAGCCAGGAACTCTTTCTTTCTTGCGCACCTTGTTGCCGCAGCCTTTAT
ATTTGTTGTTCCTTTCTTCTTTTTGGCTTTCTTCATGGCTTTTGCTATATCCCCTCTTGTAGCTTCTGTTGTTGTACGTC
TCGCCTCGGTATGGACCGCAGGCTTTTTCTTCTTCTTCTTTGTGCATATTGGAAAGAGTTATTTTTTTCTAGATAGCTGG
CTAGTGAAGATGCTTGCTTGTGGCAGAAGCGAATAGTGAATGACATCGGCCTGCTGGTGCTTTGAGCGTGTTCCCGTGTT
GATGTTCAGTGCAGCGAGTGGGCCAATCAAGTCGAAGAGGCGGTAGGCGTAAGGTGCTGTCTACTCGGCTGGTTGGTTGC
CTCCGTATCGGATGGCAACTTAGCACAAGACTGGCGGCTGTAAAAAAAAAAGTCCGGAGCCATGTTACATGGAGTATCCG
TGCAGGAATGCGAGGGCAGATCTTGCGTTTCAGTCAGGGCTCGTCATCACAGGGTAGCGTTCTTCTGGCCGATGACGGCA
AGCCACCGGATGGCACCGCCGACAGGGCCGAGACGTTCGTGAAACACGCATAGCAGTCTGGCAGACGGTGGGATCGAGGC
GAAGAGGCAGAAGCATAAAGACGATTAGCGACTCGGCACGCGAAGCGCTTGGGCCCTAAGTTCATGACAAATGTGACCGA
TCGAGCGCAACAGGCTGAAACAGAAAAATAGCGCTGCCCCCTCGGCAGAATGGAAATTTAGGTTGTATAAAAACCACCTG
GTGCAGATGATCGGCTACGAGATTACAAGATCGTCGCTGGACATTGGACGTGAAGCATGATGCCAAGCTTCGTCCCGACT
GCTTCGATCTGGTTCTATCCCGGCGTACAATTACAAATACACTGGCGGTGCCTTCCGCTGCCGCCTGGCCGTAAATATCG
TACGGGGACTATGTGGGAGCATGCTGACGACAGCGTTGTTTGGCTGTCTGTGCGAGTATCTTTCATGCCTTCTCTGGCTG
ACCGCTCTAGAAGCGCTAGGCTGCAGCGATTTAGGGTTTTGGTACTTTGTACACGGTATCTTACATGACGTGTCCGAGGG
TGGTACGACGAGCAAGCTCGCCGAACGAGGCGCTGGCGCGAGTAGCTTTTTCTAGGCACCCTAAGATACAATGTGTATCT
TTATTGAGAGAAATCGCATCGTCAAGGAGGTGCTGCTCAGCCACAATCGTCCTCAAACACACCACCACAGAAGAGCTGTG
CAGGGTCGCCATGGCCCCCTCGACTAGCCGTTTTAAGGGCGTGGATGGGCCGCTAAAAAGCTGTAACGGCTTTGGGAAAG
GATGGCTAAACTCCGGGGAGCCGGCCTTAAACCCTTTCGTAGCGCATGCCTGTAGCGCCTTCCCGCACTATTGCTACTGT
ATAATCGTATTCCAACTCGCGACTCTCTCCCATCTGCACCCTGCATTTTCACGCCGGACGACGACGACGACGACGGGTTT
CTGCCGCATCCATCGACCTCGGGAAAAAGTGACTGACCACTGCTCGACATCTGACGGCTGCTGGTTCACCGTATTTGAGC
TCTCCTGGCTGCCGCCGAGGACGTTTCGGCTTTTCTGCCTCTAAGTGGGACGACTTTCCGGTGTGATTTTTCGCTGGAGA
AGACCTCGCACGCGCACCCTTTGCCTTCTCGCAACCACCAGGCCCGGCTGCCAAAGTGCTCGCCATGAACCGTCCGCGTC
CTGACGCGGGCTTCCCATTGCCTCCCATTGGCGCCCCGCCCATGATGAGTCGTCCGCCGCAGCAGCTCTTTGGTAACACG
TTTGACCGGCTGCCACCGATCCACTTGCCGGCCGACATGGCGGCTGCCCACATGTTTGGCAGCGACCCGAACGCCTACAT
GGACGATGCCAACGAGGCCAAGAGGCGGAGGATAGCAAGGGTAAGACAGGCCTTCTTCGCGCGCGGGCAGAGGCTGAACT
GACTCGATGCTCTATAGGCCTGTGACATGTGCCGCAAGAAGAAGATCAAGTGTGACGGCAAGATGCCGTCGTGCACACAT
TGCGTGAATTACAAGACCAAATGCGTCTTCACGCAGGTAGAGAAGAAGCGGAACCCGCCAAAGGGGTGCGTATGTTGGGC
GAGGAGCGAGAGACGGACAGGCAACAGGCGACAGGCAGGCTGACGTGAAGACACCATTTACAGCGCAAAGTACATTGAGG
GCCTCGAGAACCGTCTGGGCCGGATGGAGAGCCTCCTGCGACTGTCCGGCCTGCTGGGTGAGGACGACGGAGCGACGGAT
CTGGGCACTCTGGAACGGAAGCTGGCTGAAAAGCTGCGCGAATCGGGTAGGGGATCGCTGGCAGCGGCATCGAACGCGTC
CTCGCCATCACAGGCGACGTCGGCAAACGATGGTGATGAGTACACGCCACGCAGCTCGCTGACGTCGCCGGAACCGGGAA
AGGACGGCAAGGACGGAAAGGACGGCGAGACGGGAAGCGGAAGTCGAAGCGGCAGCGGCGGTGGCGAGAACAGGTCGACA
GCCACGCCGGACAAGAAGGGGGCCAAGAAGGAAGAGGAGGTGGAGGCGTTGTCGGAGATGATGTGTTCGCTGGTGACGAA
CAACTACGGCGAGACGCGGTATATAGGTGAGTGCAGAAGAGGCGGGACACAGCGGCAGGCGACATGAGATGACTGACAGG
ATAGGATCTTCGTCGGGATTCTCCATCTTCTCGCCCAAGGGAATGCAGTGGGTAAACGAGAAGACGGGCGACAACTCGTT
CCAGCAGATGATTTCCAACGTCTCGCTGGACGACAACAAGTGGACCAACTGGAAGCCGGAGATCTTTGCAGACCTGTTCA
GCCGGCCGGTATTTCGACCACTGCCGCCCAAAGCCGAGGCGTTGTCACTGCTCAAGGACTTTTTCGAGAACTTCAACTGC
ATGTTTCCGCTCTTCCACCACCCGACGTTCATGCACCTGGTGGAGCGGCAATACTCCAAAGATCCGTACCAGGGCTCGGG
CTGGTGGGCGAGTCTGAACGTGGCGCTGGCGATTGCGCACCGACTGCGGGTGATGAGCAACCTGGTACCCCAAGAGGAGG
ATGACAAGGCGTGGGCGTACCTGAAGAACGCGATGGCGGTGTTCTCGGAGCTGGCAATGCGAAACACGGATCTGCTGAGC
GTGCAGGCGCTGCTGGGGATGGCACTCTTCATGCAGGGCACGCCGAACCCGCAGCCGACGTTTCTGCTGATCGCAGCTGC
AATCAGGCTCTCGCACAGCATCGGGCTGCACAAGAAGGGCACGGGCTTCAACCTGAACCCGATCGAGATCGAGCAGCGCA
AGCGGGTCTTCTGGATCGGCTACATGCTGGACAAGGACCTGTGTCTGCGATCGGGACGGCCGCCAGCCCAGGACGACGAC
GACATGAACGTGGAGCTGCCCGACGCCGATCCGGCCGACAATATTGGCAATATCCCGTTGGCTGACGGCAAGGGCAAGAT
GAATCTCTTCCGGGTCATGTGCGAGTTTGCCACGATCGAGAGCCGGGTCTACAAGCGGCTGTACGCGACCAAGGCCACCA
AGCAGACCATTGGCGAGCTGCTCAACACGATCGGCGAGCTGGACCAGCAGCTTGAGGACTGGAAGGACCGCATTCCCATC
GACTTCCGGCCCGAGCACGAGATCAAGGCCTCGCACACGCCGCTGATCCTGCACGTCGTCATGCTGCATTTTACCTACTA
CAACTGCCTGACGACGATCCATCGCATGTGCGTCCACCACGGCTACTGGACCAGTCGCCTGTCCGACTACGCCATCCAGG
GGCTCAATGCCAAGCCGCTCAACCCGCGCATCTACTCGTCGGCCACCCTGTGCGTCTCGTCGGCCCGAGCCTCCATCTCG
CTGCTCAAGTACATTCCCCAGGGCGACTTTTCGTGTGTGTGGTGAGTTGTCTCCTATTTGTCCCCTTTTTATTCTCCATT
TTGTCTCCTTCTCCCACCCCGGCTAACCCCACAGGCTGATCCTCTACTTTCCCGTATCCTCTCTCGTCACGCTGTTTGGC
AACACGCTGCAGAACCCGCTCGACCCGCGAGCCCGGTCCGACACGCGTCTGATGAACCTAGTCGTCACCTTCCTGTCCAT
GTTGGGCCAGGAGGCCGAGAGCGGCGGCGTCCACCGGATGTTAGGCGTGTGCTCCGAGTTTGAGCGCATTGCCAACATTG
TCATCGACAAGGCCGAGAAGGAGCAGGCGAGCCGGCGAAAGCGGAAGAACCAGGACCCCCACGAGGTCGAAACGGCACAT
CGGCCTGCTCCTAGCATAACCAAGGCGGCCAAGACGCAAGGAGCCGTCGCAGCTGCTTCTTCTGCAGCTGCAGCCGCTTC
CGCTTCTCAGCCAACGTCGCGGGCACAGTCGCTGGCACCACAGCCACAGCCGACCCCAACTCCTCGGCCGGCCAGCTCTT
GCAGCACGACGACGACAGCCTACCACAACACACCGAGTGCCACGCCTGCAGAGGCTGCGGCTGCGGCCTTAACTGCGGCC
GAGATTGTCAACAGCCACCGGATGGGCAGCCAGAAGAGTCACGGCAGCAGAGTCAATCCCGCTGTCTCGTTGCCAATCGG
GAATGGGGGAGGCTCTTCTGCCGTCACAACGGCACCGTCTCCAAACATGGCGTCGGCCGACTGGGATTCCGTCTTTGCCG
GCGGCTTGGAGGACCACCAGCAACATCAGCAGCAACAAGCCGGCGCGGGGCCGACGCTCAGCGGCGATGCGGCCAACTTC
ATGTCATTTACCGACATCCCGGGCTTCGAGACGGTTCCCGGCAGCGGCTTGCCCGACGGTCTCGGCAACATGCAGTCGCC
TCCCGTCGCGGACCTGATGCCGAGCCAGCCCTTCCTGCCTCAGGACATCTTCAACCTGCCCATGACGCTCGACTGGGACT
GGGCCGAGATGAGCGGCGGCGCATACCCCAGTGTGGAGAACGGCAATTTTGATTTGATGGCGTGAAAATAATGAGCCGTA
TTTGTGATGATGTGGATGGATTACGTTTGGATGTCGAGATTCTCTCTGTATTAATCTTTCTTTGGGAGACAACGAAGCCA
CGGAGTTTGGTCGCAAAACGGAATTCCCCTTTTATTTTCTCCATCTTGTCTTGTACCCTTTGCATTTTATCACCTTTCTT
CGTTTCTTTCCATCCATATATATACGGCATCGATCAACACAACTCCGACGCGCATCACGTGCACTGAGAATATGTGGAGC
ACGAGTAGTGTAGTGTGGCGGGCCAAGTCCCGATTGCTAAGCATCCATTTTTTCCGTAAAGCCACAGACGCCGGCAGAAG
ACCATCTCGACGTCTTCCTCTCTCCTTCACCCCTCCAACGACCAGCGAGCCGGGCGAATCAACCGGACGGACCAAGCAGG
GCCCCTATTGCGACCAGGCGCGACGACACGAGGGAACGAGACGAAGAAAGCATTCTTCGGCTGCTAGTCCCCGCAGGAGC
TCGAGCTCTGCCACTTTTTCTTCCGTTTGCTCAGATCACGAGATCTGACGCTTCATTTTCGAGCTTCGACCTTGAACTCG
TCTGCTGCGACCACAACGAGGCTCTGGACGTTGTCTTGTCCCGGCTGCCTGCAGATTTCGAATCCGCCCCATCCGACTGC
AGCCTCTCGTCCTCTCGTTTGCTTTCTTCCACTCGATAACGGACAGCCATGTCGACGCTGGCCCACGTGCGCCTCATGTC
GGCAGCACCACTGCGGCTGCCGCGCCATGCGCTCTACCGGATGCACGCCTCCTCTCAGTTCTCCACTTCGGCCTCGTGCC
GCTCTCTGCGACCGTCCTCGCGATGGGGACGGCCCTCGACAGCGACAGCAGCAGCGGCCGCGCCGTTTCTGTCGTCGAGC
CTGGCGTCACGATGCTCGACTCCGCTGCTGGTGTCTGTGCCGGCGCTGTCATTAGCCCCACGAACGCTGCGGCTCTTTTC
GACTGAGCCGACGCCCCCGCCGACGCCACCACCACAACAGGGCCAATCGGCCGCCGAGCAAGAACCACTACCAGAGGGCT
GGGTGCGGCTGAACGAAGAGGAGCTGGAGATGCTGTCGCGCATCCTGGCGATCTCGCCGCCGACGCGGCGGCAGAGCATG
ATGGAGGTGATTGACGGTGTGCGGCGATACGGCGCGCCCAAGGAGATGCGCGAGCTCATCTCGAAGCAGAAGGAGGGCGG
TATCAGCCTGGCGGACGGCATGAAGGTGGTCAAGGTGGCCTTCAACCTGGCAAAGCAGATCTCCGACGGTGAGGCGCGCG
ACGCGGCCAAGCAGGAGGGACAGACACCGAAGGCCGGCAAGAACAGCCTGGACAAGAACATGTTCAGCCCGAACGAAGCG
CCGACAGACTTTGGCAACTTCCGGGTCAACAGCAAAAAGGAAGGCGAGGGCGAGGGCGAGAGGGCTGCCGGCGGCGACAA
AGAGGCCAAGGAGGGCAAGGAGGGCAAAGAGACGAAGGATGGCAAAGAAGGCGAGAGCGGCGACGGCAAGAAGGGCGGCA
ACGGACAGAAGCCACCAGGACCATTCTTCGAGGGCAACGACTGGTTGGGCTGGGTGCTGGGTGCAGCGATCTTCTACCCG
ATCTACTCGATGCTGTTCCCGGGCGGATCAACGACAGAGATCACATGGCAGGAGCTGCGGCGCAACTTCTTGGACAAGGG
CCTGGTGGACAAGCTGGTGGTAGCGGGCAACCGAGTGCGGGTAGAACTGAACCGAGAGGCAACAGCAGCGGCATACCCAG
ACTCGACGGCGGCGAGCCCGCTGCAGCAATACTACTTCTCAATCGGATCGGTGGATGCATTTGAGCGGCGGCTAGAGGAG
TCGCAGGACGAGCTGCAGATCCCGCCATCGGAGCGGATTCCGGTCAGCTACGCGACCGAGGGCATGATGGGCAACCTGCT
GGTAGCATTTGGGCCACCCGTACTCCTGGTCGGGCTGCTGTACTGGATGACGCGGCGAAGTGGTGGCGGCGGTATGGGCG
GATCGAGCGGGATCTTTGGGTACGGCAAGAGCAAAGCGAAGCGGTTCAACCACGAATCGGCGGTCAAGGTCAAGTTTGCA
GACGTGGCGGGCATGGACGAGGCCAAGCTGGAGATCATGGAGTTTGTCAGCTTCTTGAAGCAGCCGGAGCGGTTTCAGCG
GCTGGGGGCCAAGATTCCGCGCGGTGCCATTTTGGCCGGGCCTCCCGGCACGGGCAAGACGCTGCTGGCCAAGGCAACGG
CGGGCGAGTCGGGCGTGCCGTTCTTCAGCGTCAGCGGGTCTGAGTTTGTGGAGATGTTTGTGGGCGTGGGTGCGTCGCGG
GTGCGCGACCTGTTTGCGACGGCCCGCAAGAATGCGCCGTGCATTGTGTTCATCGACGAGATCGATGCCATCGGACGGTC
GCGTGGCGATGGTCGTCTCGGATCGGGCGGTAACGAGGAGCGTGAGGCCACGCTCAACCAGATCCTCACTGAGATGGATG
GCTTCAACACGTCCGAGCAAGTCGTCGTGCTGGCCGGCACCAACCGGCCCGACATCTTGGACAAGGCCCTGATGCGGCCC
GGTCGCTTCGATCGCCACATCACCATTGATCGGCCGACGATGAAGGGTCGCCAGGAGATTTTCCGCGTGTATCTGAACAA
GATCGTCACCAAGGAGGACATTGACTATCTGGTGGGCCGTCTGGCGGCGCTGACGCCAGGCTTTGCGGGCGCGGACATTG
CCAACGCGGTGAACGAGGCAGCATTAGTTGGTGAGTGAGGTGTGTGTTGCGATCTCATCGTCACGTGACTAACCATGACA
GCCGCCCGCGCAAACGCTCTCACCGTCGAGATGCTCCACTTCGAACAGGCCATCGAGCGGGTGGTCGGCGGGCTGGAGCG
CCGGTCGCTGGTGCTCAACCCACAGGAGAAGAAGACGGTGGCATACCACGAAGCAGGCCACGCGATCTGCGGCTGGTATT
TCCAGTACGCCGACCCGCTGCTCAAGGTGTCGATCATTCCGCGCGGCCAGGGCGCGCTGGGCTACGCGCAGTACCTGCCG
GTAGGCGACGCATACCTGATGAACGTGCGGCAGCTGATGGACCGCATGGCCATGACGCTGGGCGGCCGTGTTTCCGAGGA
GCTGCACTTTGACACGGTCACGACGGGTGCCAGCGACGACTTCAAAAAGGTCACGCGCATGGCCACGACCATGGTGACGG
AATGGGGCATGTCCGAGAAGCTCGGGCTGCTGCACTTCCGGCCGAGCGACGAGCAGAACCAGTTCCAGAAGCCGTTTGCC
GAGTCGACCGCCCAGCTGATCGACGCTGAGGTCCGCCGCATCGTCGACGACGCCTACAAGCAGTGCCGTGCCCTGCTGAC
AGCACGCAAGACTGAGATCGGCCTCGTGGCCGAGGAGCTGCTGCGCAAGGAAGTCCTCACCCGCGACGACCTCGTCCGCC
TGCTCGGCCAGCGCCCCTTCCCCGACCAGGACGAGTTCACCCGCTACTTCAACAACGACGGCGGCCATCACGGCACCACT
CCGCCGCTGCCGACCGAAAACACTGACGAGGACGTCCGCACGCCCGCACCTGACGGGCCCCAGGGCCCGGCTACTGCTCT
CTTCCGCCGCCGGTAGCATAGCATGGCCTGGCCGCCTGCTCTTTCGTGGCACACAACTCGCCTCCTCGCCGCTCGCGGCC
ATGGCGTCCCAACTCCACTCCCGTCTTCTACAGGTGCTCGGGGCCGGCGTCCGTTCTTATGGTTGTCCTAGTCACTTTTT
GATTTTCGTATCTGCGCATGTATGCCATAACTATACAGGAGACAAGGGAAGAAGAAAAAGATGAAGATGAAGACCTGAAA
ACAGCCAGAGGGCCTGTCTGGATGCGCTCCGGACAAAGAAAGCACTCAACTCAGCCGAGGGCAGCAGATGTGGAGGTGCT
GCGATGGACACGGCACATGGTGCTGACTGTTCCGTGCCTTTTCTCGGACAGACAATGTAAATATGTGAGAGCCTGTACAT
GCGACATGGCAATCAACAAACAAAAAAGTTCAAAAGATGCAGAGAGTCGTGTCGTCTGGTTCTCCGGGAACAGGATCCCT
ACGGCCAGGGGCTGGGTCTATGCGATGTGACACGGCGTCGCCTTTGTGGCACGGCAGCAAAGACATCAGACATGTCGCCT
GAGTCAGATGGAGGTAACCGTAGGATGACCAGGAGCCGAAGATCGGGGGCCAGACCCATGGGTGGCGGGTAATGCCAGCC
TGAGTCCCCGGTGACGGGGCATATTAGCTGAGGAAAGACGGGAGAGACGCCCGTATTCTGGGAAGAGTCTGGGGGTCGTC
TGGCTCAGAGGCTGGGACATGATTGGTCAGAAAGCGGGATACAGGCGCCAATGCCCACTTCCGGCCTGAGACCCCAGAAA
GGACTGTGCAAGAATTGCCGGTATACGGTTCATGTGGGTCTTTGTTCGTATAGATTCTTGGGCTGAACACAGGGGCGACG
GCGGCTTGGCTCGAGGTGGTCGTCTGTTCGAGTGTGAGGAAGGTCGAGAAATCTGTTGGGCTAGGAAGCTGACGGTCATG
GACAGTCGGCCGAGAGGAGGGTAGAGGAATGTGAGCGTGGAAATGTACTGTTCTCTCCAGGTTAGCTGTGCTTCTATCCA
GTCAGTTGAGAGGGGTTGGACATAGTATGGGAGTGGTATGAAAATGAACAAAGCAGGCGACGAGGCAGAGAGCGAACAAA
TTCAATTTTCAAGATGGTCAATTTGTAGCGAGTCTTTGACAATTTGCAAAAAGAAGACCGATGCCAGCCCGATGTCAAAT
AAGCACTTACTCACGTTCAAATGTGGCGAGAAAAACAAGTAAAATTGAAAGGACAAATTTCTGCCAGGAAGGAGCGACCA
CCATTCTTGAACATTTGTGGCTGTCTGTTTCATCCAGATAGTTACCGCCTCTGACTCTGGAACTCCCCGTCCTCCGACAT
ACGACATCGCTGCAGCATGCTGTACTACCACATCATAGAGCCTGTTCCGTCCTACGGTAGCCTACCTCCGAAGCACCCAA
CAGCCGAGGCTTTACGGAGGGCCATGGCCTTTCCGACTTCGTTCAATAAAACGGAAGCCCCCACATCTGGAAAGAGGAAA
AGGAGAAAAAGCAGACAACGGAACAGACTGCCAATCTCGTTTATTCCAGTGGTAGTCCGGACTCCTCGTATCGCACGGAA
AGCCGCAGCGGTGCTGGAACAGGAGACGGCGAAGCGAGAGGGAACTGGGAAACATGACGGGCAACAGAGCGAGTAAAACC
ACAGGAGGCACGGCCAAGCCGTTGTTGAACCGGACCCTGCTAGAGGTAAAAATGATATGTGAGCGGCGGTGAGGACTGGC
GGACGGAGCGAAGGGCTAAGAGAGCGACCATGCAGAGGACCGAGATGGAGAGTATCTGATCGGCCTGTCGTCGCCCACGA
CCGTTCCGGTTGGCCAGACCATCGCCTCACAGGATCGCCACAGCAGCGTCGCAAGGTGACCTGTAACATTTTCCCTTCCT
TTGCTCTCGGGGCATGCGCGCTGGTACGACGCCAAGCTTGTCGCACATACGGGCAGCACTTCGAGAGAGCGCGTGCTTGC
GCACGTGCTGGCTGGCTTCTGCCTGCAAGAACCTCTCTCTCTCGTGTGTATCGACTAACTGCCACACAAAGCCTGTGTGC
ATACAAGAATATCCGAGCGGCTACACCATCTGCCCTGCATGCATGTTGTCATTGTACCGGCTGCCCTGGCACAGCCCAAA
TATGGCCGCAGTGAGCGCAGGAGAGGCCATCGGATCGGACAGCAGAAGGGCCGGTTGTATGATAGAAACGGTCTGCAATG
GAGACGAAAACGGTGTCGGCGATGCAGAGGGCGTGTTCTACGGACGAAACACTCGTGCAGGTAAAGAAACAGTCGACGAG
CTTGTACAGGTCCTGAGATGGGGAAGACCGGAGAAAAGGTTGCATTTACTCCGTAATGGACCGAGGAAAGGAGAAAAATG
GACAAACATGCAACACGCAACACACAGCTAGACTGCCTGCTTCTTTGCTGGTGAAACTAGCATACAGGGAGAGGTGGGAG
TGATGTTCTTCCAGTCATGCTACAGGCCTCTTGATCTTTAAGACATGTATCGGTACTATGAGTAGAATGCGGGCTTGGAA
TTAGAGTTGAAACTGGTCGGAGAGAAAGATCCGTTGGAGGCCGTCAAGAAGAGTTGTGCAGATGTATGAGTGAGGATCCT
GCCACTGTTTGATATCTGACTCAAGGCGAGATGCAAGACAGACACGGAAGGACGCGAAGACGGCGATTGGCAACCGTTAC
GGCCAGGTTGTCTTTTTCACACATTTACTCGCCTGGATTGTTCACTCTGGCAACATGGCTATCGGCCTGAATCTCCTCTT
TCTGTCCTGCTGTTTATTCAGTTTCAGCATGGTCACATGTCAGAATGGAGGCGGGCGTCTGGCACCTCTATTTATATGCG
ATGTTTTGTACTTTCTATGGGCTCAGGGCTCAGGGCTCAGGGCTTCATGGCTGTTGTTGACAGAGAACGGCGGCCGTTTT
CTATTGGGATACACTGCCGTCCTTTCACGCGTCAGAAGAGGCTCTGACGAATGCAGGCAAGGGCTGGAGGGAAAACCAGA
CCGAAGACTACATGACAAGAACTAGATATCAGTGTTTCTTCTAGTCCATAGTAACGTTCGACTGAGACCTTTAATTTCGG
CGCATTAGGCTTTGCGAAATAGAATGACCTGGCAGCCACGTCCAGTGGAGTCTAGAGAGCTGGGATGCTGGCGAAAAAGC
CATGGAAGGCGGACATTGCAAGGGAGGAGAGTGTTCCAAGGCTTGATCTCAAACAAGACCGGACATCCTGTCTCTTTCCG
TCATGCCGGTCCGCTTTCGAAGCCGAGTGACACGGCGGCGCACACAGGAAAAGGACAGGCAAAGGTAGCCGAAGTAAAGG
TGGGAGAGCGACAGAGAGCTGGATGCAAGCCAGTCTTGCCAGCTTTTGAGCCAGAGCCAAACAGGGCAGGTCTCAAAAGA
TATCGGCTTTCAGGCCCACACGCCTATTTTTATCTATTTTGTCTTGTCAATCTCCAACGGCACTCGTGTTCGTTTTCTTC
AGGCTTCAATTGGCTTTTCTTCTGGACCAGGGGCGGGAAGAAGCAACGACCAAGTCGGGGACAACGGTGGCGTCTAGTAA
GGCCCGTCTCGCGACTTCGGACTTTCATGATGGGCTCATTTATGGCGACGCATGCTGCATGGCTGTGCACGGACAGGTAC
GTGTTTGCATATACGTAAAGAGAAGTGAGCGAGCGGTAGGGGCAGGAAGAGAGAAGAGGAGAGAAGAAGAGAGAAAAGAG
GGCAGACAAGGGTGCCAAAGTCCGGTGCAGGTATAAAGTGCGGCTGACAGAGCGCGCCGTTAACGCGTTGGGCCAGGCTG
CTGGGCAGATGGTCATATGCAGACAAGTCGGCCGGCTCCAGGCACCGGCTGCTCCCTTGATGGAGCCAGCTGGTTGGCCA
CTCGGAAGCTCGCGCTATTACTCGGATTTTTGCAGTAGGAAGCACTACTATGCATGCACTGTCCTGAATGTAGTAGATGC
AGAGGCAGGTGGAAAACAAACCGGAAAAAGAAAAAGGAAAAAGAAAAGAGAAAAAAAAAAGAACAGCCACAAAGCCACAG
AGCCACAAAGCCACAGCCCCCCCAACCAGCAGCGAGGCTAGAAACGTGTTGGATGAAACACGGCCGAAGAGCGCTGTGCA
GCCTTGAGGTCATGGCGGCGAGCGAGCGGCAGTACTTTCATCGCCTCTCTTGCAGACCTGTCTCTCAGGCCCTACCCACT
TTTCGCCCTGCATTTGCCTGCATCACGAAACGTGTCCGCAGATACGAGAACAAGATGGGAGCCTTTGTCCGATTCGTACG
AGCCTCTGTGCGTGTCCCCCCTGTTCCTTTTTGACGGACGAGGTCTGGATACCGGTCCTTTGCCGTAGTGTCTTTTCTTC
TCTTGTGTTGATACAAACATACTTAGTTGCTCACTCGTCAGGCTGTTGGACTGGCTTGGCTTAAGACATGCCGCCGTCGA
CCTCTATCTTGATTTGCCTTAGAGAGAGTGAGAGAGGGTATGTAGGATACGTCGTATGCTCAATTTGCATTTTGCCCTGC
TCTTTTCAGCTGCAACTCCCGTTCCACTCTCCACCCACCCATAATCAACCCCCCCCTGCCTAGATCGACAGAATGACGTG
CAATCAATGGCTCCAAGCTAGCCTGCATCGGTTGCACGACGGGCTGTCCGTGCTGTTTTCTTGTCTTTGTCGCCATCTGT
CGTACTCGTCTTGGTCCTCCTCGTCCCCACTCTTCCCCTACTATGTACAATGTTTGCGTTCTATTTTACTTTGTTGTGGA
CCTGTCTTCTTCCTGCTGTCCTGCCGTCCTGCTGTCCGGTATGGCACAGTATGGCACCTGTGCTGGAATGATATGGGACG
AGAGATCCACCCCCCTTAGACGATCCTTCTTAGCCAAAAGTGCCGGAAGGACCTGTCAATCGGTTGCCCCCCTTTTCTCA
TACATATAAACCATCCATCCTGCTTGCTCATCCTGCTGTCTAGTCCGTATGTTGCGGGACCAACGGCCGCCAGTCCTGGA
CAGGCTGCAGGCACAAGCGAGAGCGAGAGCGGGAGAGGGCAAGAAGGAGCTAAAAAAAAACGAGAGAACAAAGCCCACAG
TCCTGAAACGCCGCTGTCGCCGCCACTGCTCTCTGCTGTATTGCTGTGTTACTATGACAATGTCAACGGGCACTCGTAAT
GAGTGGAAGGGATCACTCGGATTTCCCTCCTTGGCAATGTGCATACGCACGTACGCATACAGGCTACTGTGACCCTGATC
ATGTCGATCAGATCTCTCCAAACACCGACCAATCCAGGATCGCCGGAGCGTTGCAGATATGGTCCGCATCGAGACCCTCT
TCTACACCCCCCCTCTCACTTTCTTTTCTTCTTTTTTCTTGGTCTACCTCCTCGGCCCTTGTGCAAATCATCTTGTGTCG
AGCGCATCGGCTCCGATCGTTCACGGACTCCCTCCTACCGTCTTTCAAGTATGAGCAAAGAGAACCTAGCCTTGCTTCAC
ACAATTCTGGCGCCTTATTCGCTTTTGTGGCCACCCGGTTTCCCTTCGTGGCCACGCTTGCAGTCAGCAATCTAATACCC
CTACTCCGTACTATGTACGAATCTGAGATGCAAGTGACTGTCAGCCCTCTTCTTACTTCACCCACCCCCACGGCATTTTC
AGTCTCTACCCCCTCCTGTAAGCCCCTGCCCCCCTGCAAGAAAAACCTGACTCCACAGCCCACGTCCTCAACGTACGGAT
ACGGAGTACTCTCCCAGGTCATAGCCGCATCGTCCAAGCTTTCTTCTTGCGTCCCATTGGTCGGCGAAGAAAGGCTTGCT
GTACGGAGAAGGTCATGTTTTCGTGCAGGACCTTTTTCACGGGTGCTGGCCACCTCAACAGACCAATCAGTACCTCCACC
AAGTTCTAGCCGAGACAGGAACCAGGCCCCCTTTCGGCCTTCCATTTACCGTCCAAATTGTTTCTCTTCCTCTTTTTACT
GCTCTTTCCTGCCGTCACACCTCTCCAAATCCGGGCACGTAGCTGCCCATCTTCCTTCTTCATCTCGCGTCGTAGTAGCT
ATGGAAGGCATCCTTCGCTCCGCTGCACTGCATCTGATTTCCGGCTGTAGATGATGCTGCCCTCACCTTTCGGTCACCTC
GTCATGTTTTGTCACGGTGCACGACAGGGTGGAGAACATATTCTATACGGGAGCTGCAGGCCGTGTAAGCGATGACCGTC
TTGGCCAGTCTCGTCTTGCCCCTGCTCTTTTGTTTATGGCTGTCGCGACCAGGCCGTTTCTGCAGCTCTTCCATTCGTAC
GGAGTCCGTTTCTCGTCTGCAGCTGAAGAAGGCCTACATCCGCCTGAGATGTCTGGCCAAGAGAAATTCTCCAGCCAATG
ACAACAGACATGAATTGGAGGAAAGAAAGTAAAAATGGAAACATAATCCAGAAAACAACAACATGTGCCCAAGGAAAGGT
GGGAAAAACAAACACAGCGCCTGCTTCTTGGCATCCCACACCCCTCTGTAGCACTTTGTTTTGCATAGGGGCTTTCTTGG
AAACGGTCGTCTGGCTGTGTGTTCTGAGTCTGGATCCCGGCTCGTGTCCTCTACACTCTGCCTGCATACTTTACATAATA
GTGCACATGTGTACACATGTGTGTGTAATGCACTTGCGTTGGCGTCCACACACACGCCCTGTGCTGCAACCAAATCCTGC
TCGACACAAATTCTCCGCACAGCGCCTCGGTATTGCTGCTCGCCGCCTGCGCTCCGCTGCACGTCGTCCAGAGTTGATGG
AGGGAGGCCAACAAGAAGATCAGTATTAGAAAAAGGCCCTAACGGAAATTGCGACTGCAGCCAATACCTGGGAATTCAGT
CCCGGTGCGGAAGGCACGGCCCTACGTCGTCTTGCCTCCTTCCCATTTGTCCCAAGAGGCGCAATTCGGCTGCCTTTGTC
TTATCAGTCTCCCCTAATCGCTGACATCTTCACAGTTGTACATTACTATGTGACGTTTCCTGGAAATCCCCGACAACTGA
TCGTCCACCCTTGACCGTTCCCCCCTCTACTTCTTCTCCCCCCCCCTTCTTTTTTCTGTCGTTTGTCCTCCCTCACTAGA
ACTAAGTTCAACTCCTACTTTCCATAGTATCATCCCCCGCAATCCCATACACATAGCGATTTTCATTGTTCCTCGGCTTC
AATCTATCCTGTCCATCAAGGAAGTGTTGGAATAATCATTGTCAGACTTGACATCCTGGTCGGGGCTAAAACACCTCGCC
CGAGTTTTTGCGTTGCGTTGCTAGATTGTTTTTTTAGCTCAAGGGTTGCAGCACAAAGCACACCGGAAACATTGTCTCTC
CGTTGTCTTTTGAATTTTGTTTTACCTCTGCCATACTCGGCACATAAGTTACGACACTGCTACTACTTTGCTGCTTCCAC
TAAACATCTACTAACTGCGGCAACATATCGAAGCATATCTATTCGGCTCCGTTTTATCGTCCCATACCGTCGCAGTTACG
GATCTGACCGTTAGACTGTTCTGGCCTGCATTTGATCTCTGGTCAGAGGTGTCGACGCATAATTCAAAAGCAGCATGACC
AGAGCGACAAGTCAGGTCTCCAGCTACATACATTGGAATCATACGACTAGTATTTTCTTCGTACCCCTTCACAATACCTA
CATACCCCCGGTTAGCTCCAATGACTTGCGAGGGGAATGAAGTTGCTTGAACAGGAGAACGGACAGAAATATCAAAGAAG
CACACACCAACAAGGTAGGAAATATAACGTCGGCACTAAGCACACCAACCACTTGCAGCAACCGGCAGATAACACAGGTC
GCCCCTCCTCGACGTTGTGCTCGGCTGTTTCTGACACACCAAGGTCTTGAGTCTGTCTTCCTCACAATCCTCGTCCTGTC
CTGTCGATTTGTAGTCTCCTCATCGATGTAGCCAATTCTCTCTACTCACTTGATCCTCCACGTTGCACATTTCCTTCCTT
TCTCACCTCAGGACTCCTTCTGCTTGCGGTACACCCAAGGTCTCTGCTTTCACTCCCTACCTATGAGACACAGCACATCT
TTCTCCATTAATGTACTCTCTTGTCGCCCCTCTTTTATTCACCCGTCCTCGTCTGACCAAAACGACCTGTCTCTTGTCAT
CTCCGGCGAATAGACAACGGCAGATAGGCGCGAGTACTCACGTCACAGCCACACCAATTTCAATGATCACTGCCAGAAGT
AGCGATACGCAGTCTCATTACCACACCAGTGAATACGACCAGAAGCCAGATGCTTCACAATCGTCATTTCCCAGCTCACG
CATGCCGACTACCGATTTTGAGACGCCGCTGTCAACAGCCACGGACTGGCAAGGCCAGTATTCGTTTCTGCCACCCGAGG
AGTCGGTATTTGCAACGCAGGCTTATGCCCACATGGGCAGTTCTGCGCATCACAACAGCGGCCCAAGCAGTACGTCCAAT
AGCAGCAAAACAAGCCCCAGTCAGCAGCAGCTCTACCAATTAGGACCAGGCAAGAGCTCTGGTAGTGATGGAAGCGGAAC
CGACTGCCCGAGCCTGAAGGTGGAAGCAAATTCGCCATTTGGGCTAAGCAGTCGGCGAAGCCTGGAGCACATGGGAGTGC
AGCATGCACAGACACATACGCCGTTTAACACAAGGTTGTCCATCACGATTGCAGATGCGAGCCAATCTACGACCTCAAGG
CGGACCGACAACGGACTTCCGCACGACACTGAAGTTCACGGACGAAAGCCGTGCGATTTGGCAGCGAGGAGCCACGAGGA
CAACCCGGTCTCATCGATCCTGCAGATTACCGACCTGGTGGAAGAGCCCATGGGAAGTGAAGCTTCTACGAAATGGACTG
GCGGGGTTCGCTCTGTTATCAAAGAAGAGGATGATGAGGACCTTATTGATGACGAAGACATGGGAGACGGAGGCGAGACC
GATGCGACTGAAAGGCCAGCCCAGACTGTGGCTGAGCGAAAAGCTCAGAGAAGAAAGTTGAAGCGCTTTCGGTGAGCTCG
CTGGCTGTTATAAATACGCCTTCCATTAACTATTTATCAAACTGACAAGTTAGGCTGACACACCAACAAACGCGCTTCCT
TATGAGCGAGTTCTCAAAGAAGCCACACCCTGATGCTGCACACAGGGAGTGCTTGTCTCGGGAGATTCCCGGTCTCAGTC
CCCGCCAGGTGCAAGTCTGGTTTCAAAACCGGTGCGTACAGGTCCCGATGATCGAGGGGGAATAAATTTGAGAAAGGGGT
GCTGATAGTTGAAGACGAGCCAAAATCAAGCGAATGGCCACTGATGACCGCGAGCGCATGCTCAGAATGCGCGCAGTTCC
AGATGGCTTTGACACTGTGCAGGCGTTGCACTCGCCGTATGGTGCTATGAACAACGTGGGGATGACCATGGCACCGGCGG
TGGACTTCAGCACCGCTCCTTATGCGAACCGGATGATGCGCCCGTTAATTGTTGATGTGCGGCAACCGGAGGGCGATTTC
AGTCTCTCACCAACAGGGTTGAGTCCAGAAATTGGAACCCTTGGCCTCAATTCGTCAGCAGCAGCCCCGAGCATGAACGG
CGCTGGCATCCTGTTACCACTCTCACCTACTTCGATCAGTGCTCATCACCAACGCCATAACAGCTACCCCAGCCATCACA
CTATTTCGGAGACCATGGCCACGCCGACCTCTTCCTCAGAATCAGAAGCCATGGTCCCTGTGAATATGGGTTTAGGTGGG
CCAGGAACATCTAACCCCTATGCGACAACACGGCACAGCAGCCTAGACAGTAATTGTGTTCCTGTGACGGAGCCGGGAAG
CGAAAGCACGGAAAGCGAACATAGCCCCCACGTCTCACATCACGTATACTCGCATCATCAGATAAGACCGCTGCAGCCAC
TCCAGCCACTGCAGCTGCGCGAAACTGTTTCCCGCTCGCGCTCCGACAGCATCCAGTCACCGCTGAGATCTGGCATATCG
TGGACGGGCAGCTCGTTCGACTACTCGAACTATCACAGACCCAATATTTACAGTCCAAAACAGAGTGGCGGCCTTTGTTC
TCAGCAACAGCAACAGCAGCGACAGCAGCACTACCAGTCTGAAGGTGCCGTCACTACATCGACACTCGGATACGATTCGA
ATGCGTACTCAGGTATGTCTTCTCGTGGTCAGGACTTGGCCGCCCATGTGACCCTGCTAGCCCATATGACTAACGATGTA
GACAGGCTTCGCCGTTCATACTCCGACACACATGGTTTACCACTCGAATTTTCCTTCTCCGAGTCTGCAGCCGCAAGCTG
GTTCAGAGGGCCGTGCCCCTACACGACTACGTAATGCTTCAACTTCGCTTCCTTCAAGTTTTTATTTTCGGACCTCTGCT
GCTGACCGTCCGATGTCTCCTACCCGTGACGCGCAATTTCGAAATGCTAGAGAGACTAGTTCCAATCTATCGTCTCTGAG
GGTGAATTCTACATCTGCACTGATGACGCCATCGCAGCAATTTGGAGGTCTCGGCGGCCTGTCTGGGCTTAGTGGACTCA
GTGACATTGGCACTGTTCCCTCTCCCGCCAGCTATACAACCGGGTTTCCCTCATCAGCATCTCTGATGGCATCCATCGAT
TTTGGCTTGTCGCCAAGGATAACCAGCGGCATCGGGAGTAGTCCCAACAGTATGGCCGGCAGCAGTATTAGGCACGGTAT
TACCGACTACTCCTTGCCACAACCGGGCGCGCTGACGGCACCGTCAAATGATCTTGCGCAGGCCTTTCAGCCCAGTATGA
CGCCTGTCAGCAGCATGATATCGACAGCACCTTCTGCTGCGACGTCCATCGCGGCCAATATCATTAACAACGGGACTACC
GTGCGCAACGCCTATAATGGGCTCGGTGGATTTGGCGGTTTCGGGAGTTTGGGAAATTACCATTTATCTGCGTCACTTAG
GAGTGGTACAGACAGCCTCGGACGTAAGCTTACGTATCCATTTGGTGGAGTAGGCAGCGGTAGATGAATCGACTAAGCGT
TTGAGCTTCAAGGGTGAACGGAGAATAAGTGGACGGAAGTCACACAACTTTGCTGCGGTCGGATTAAAAGCAGAGTTGGA
AAAATAGCATGAAGAATGGGACACAAATTGGAAGATATAGGAGTCTATATAGGCCACAGTGGATGACAGTGGCATTGTGA
CGGATATATGCCATACGTGATGAGGTTCTTGTCAACGGCAGTTAGTTACTATTGTGGATGTCTCGGCCTTTAAAGCAGAG
CATTTCACGTTTACTAGAATACGGGCCTCCGACACGAATGAACCGGTTCTGTTGCTACGAAAATCTAGGCCCATCCCATT
AATTTACTCAAGCAAATTGAACAGCTAGGACGTTGTTAAGGTATACTGCCCTGCCACCGGTACAACAATCAAAATGGTTG
TATTGTGTAGTTACTATATCAATGCAATAAGCACAGTGACAGTTTGACAGTATGCTGTGTTAGCTGTTCCAAGACTGTCC
CGTGTGGCTTCTACTACGAAGTGCACCATTATAACCACAGTTTCAAAAGGTAAAATGTGCACCGTCAGAGTGCGAAATAT
GCAAGTTTGTGTATACACTGTACAAGTGCAAGTCAAATTATCGTTACAAGCCGTAAGGCTGTTACTCCAGAGTACTAAGA
GATGCGTAAAGCGTACAAACAATAAAGAGCACTTCAATTCTCTGCGCGGGAAGACAAGGCATGATGCTCGCGCAGCGTAT
TAATGCTTCACGTGACACTACCTACTTTTCGGATTCCTTCTCACATCACTTACACAGACATGTAGCATACAAAGATGTAT
ATCTATCTATATATTCGCTAGGCCGGCTTACTCCGTTGCCCTATACGGGATTTTAAGGTGAGTCTGCATAAACTCTCTCT
CCCCCTTCCTCTTTTATATCGCTCGAGATTTCGCATCGATAATCATTGTCACCACCTCCTTTGCTCTGTATTCGATGTTT
CGAGACTAGAAAGGGCTCGTATCAAGTGGCGAAACGGTCCCTGGCGTCGCTCAGCTTGCCTTGCTGCGTAATGCAAGCGA
AGGAAAAGCTGACCAATTCTCCGCCGGCGTTCATATTTGGATGCCGATCGGCAGTTTCGCCCTAGGGGGCAAAGTGTGGG
CTCGACAATTCACGGTGACGGAAGATAGTAAAACACCGAGAAAATATATGATGTCTTGTCTTTCAACTTGAACACAGACC
TCTCTATTTTGTGAAATGTCTAGGTAATCTAAAGTAGTGGGAAGTCGCAGTTGTTTGATTATTTCTTGTTTTCGTAGAAA
GTATCTCTTTCCCCCCACAGGCCAACCTCGCTCATCCGTGACCGTTTCCCTTTTCTAGTTGAGACATGGCCGGTGTGGCC
TGTCTGTACGAGAATATGAAAGAGTCGAGGCCATGATGTTGGTGATAAGCTGCCAGAGTTCAAAGATAGAGGTGGATCGA
GAGGGCAGAGATAGGCTACATTGAGGGGTGGAGACAAGCGCCTAGGCTTTAGATGCCGGGGAGCTGGTTAGACGCCGGTG
GTAAAAGGGCACGAATTACGAGGCATAGATAAGGAAGGCGTATTGTTGGATGCTTGAGGCCGAGGCTTTGGAGCTCTGTT
ACTGCTTGAGTGTCCTTGTGAGAAGTACACTGTGAACTATGACAGACGACTTCTCCAGCTGTATGACATCACGTAGAGGG
TCATCCACAAGCTGTGTTTTACATTGCAGTCGTTGTGATTAAGTAGCGGACCGTGCACTTCTCAGCCAAGCACGGCAACC
AATTTCGGAAAGGCCGGTGAGGCCGGCTTTAATGGACCATCCATCTTCCGTCGGAAACAGGTAACATTGATAAGACCAAC
AAGAAAGCTGGTGTGGATCGGAGCTTAAAGCAAATAGCAACCAACGTCCAGACATTCTGACAATGTAGTCCACGCGAGAG
CCCCAGCTCGACAAGAGAGCAGACAAGAGCAAAAATGCGGACAGGAAGGCTTCTTTTTCTCGGACGGTTCGTAGTGGCAG
CAGCGGCGACGCAGCCATGGCTGGACGAATCACTAGACACGGAGCTGCGGCTGCAAATGTTTCTGGGCCAGCTCAACGAG
ACGCAGATCTTCGCCATGGTGCAGGGTGACACAGTGGTAAGTGAAGTGGACATGTGCCGGTGCTGTGGATCTGGACGATG
GCGCTGACGAGCAGCTCGACGACAACGGGACGGGTGTCAACGCCTGCATCGGGCACATCTCAGGCAACGAGACATTGGGA
ATGCCGGCAATCTGCATGGGAGACGGTCCTGCTGGTGTGGGCAACAGCATGAACAACGTGACGACGTTTCCGGCACCGGT
GACAGCAGCGGCAGCACGGAACACGACGCTGCAGTATGCGTACGGACAGGCGCTGGCGCAGGAGCACCTGGCCAAGGGCC
GCAACGTGGTTCTGTCGCCGACGATCAACATTGTGCGGTCGCCGTCGTGGGGACGAGCAGCCGAGTCCTTCTCGGAGGAC
GCCTGGCTGACGGCACGCATGGCCGTAGCACAGGTGCAGGGCATCCAGAGCCAGCATGCGCTCGCCTGTCCGAAGCACCT
GGCCGCATACAATCAGGAGACAAACCGGTTTGGCCTGGATCCTGGCTGGACGGCCGTCGATGCCGTCGTTGACCGTCGTG
CTCTTCACGAACTGTATCTGCCGGCCTTCAAGGCGACCGTGCAGGAGGCGGCTGCGGCGGCCGTCATGTGCAGCTACAAC
CGGCTCAACGGAGCGTACACGTGCGAGAACGAGTGACTGCTCAACTCCACGCTCAAGAACGACTGGGGCTTTGCCGGCTT
CGTCGTCGCCGATTGGTATTTTGCCCATCGCTCAACTGTTGCTGCGGCCAACAACGGGCTCGACCTCAGCATGCCGGGCG
GCTCGCTCGAGGACTCTTACGGCTTCCCGGCCTACTACGGCGACCTTCTCGTCGATGCCGTGCGCAATGGCTCTGTCGCC
TGGTCGCGCGTCCGTGATATGGCTGCCCGCATCTGGCGACCCATGTTTGCCGTCGGCGCTGTCGACCATCCCGTCACGGG
CAACGCCACCGCCGTTGCCCGCACGTCTGCGCACCTTCAGATTGCCCAGCAGATCGCCGAGGAGGGCATGGTGCTGCTCA
AGAACCGCGACAGCCTGCTGCCGCTGTCCGCCCGCAAGTATGGCCGCATCGCCGTCTTCGGCCGGGGACCGTCGACAGTC
ACGTGACCGAACTACACGGCGGCTTTGTCATCGACTCGACCCGCGTCACCGAGCCCCCTTACGACTATCTGGCACGTCAC
GGCGCCGCCGAGGGCATTGACTTCCGCTATGCCGAGGCCTTTCCGGGAACGGATGCCTATGAGACGGCACCGTCCAGCAT
GTTCCGCGAGCTCAACGCCACGTACTGGACCACGACGGACTTCTCCGGCCCTGCCAACCAGACGGTGGCCATCGACAACA
TCACCATCGCATCGTATCCGGCCGCCCTCTGGACTGCGTGGCCCGACGTCTTCTCGGAGCAGTACCGCGGCCTGTTCCTG
CCCAACACCACCGGCCTCTACCGCTTCTCGCTCTACGGTCAGGGCGACGCCAATCTGACGCTGGACGGCCAGCCCATCGT
CGCCATGACGAAGCAGAACTTTGGCAACCCTGTTCTGGGCAGTGTGCGTCTGACGGCCGGCCGGCCTGTTGATCTACGCC
TCGACTTCTCCATGGGCTACTCGCTATCGACCGGAAATTACGGCGTGACACTGGGCGTCGACATGGCCAATGCCACACGT
GAGAACGAGATCGACTCTGCCTCTCGTTGGGCCGATCTCAGCATCGTCGTCGTCAACGACGCCTAGTCCGAGGGCGCTAA
CAACAACCTAGACCTGACTCTGCCGGCTGGCCAGGACGATCTCGTGGCCCAGGTCGCGCGTGCCTCCGCCAAGACTCTCG
TGCTGCTGGGCTCCAACTCGGCCGTCCACATGCCCTGGCTGCATGCCGTCGATGGCCTGCTCGAGACCTGGTATCCGGGG
CAGCAGGTCGGCGCCGCTCTCGAACGCCTGCTGTACGGTGATGTCAGCCCCAGCGGCAAGCTACCCGTGACTTTTCCCGG
CATTGATGACGATGTTAGCATCAAGAACAGAAACGCTGTCTCTCTCCCCCAAATCCAAGCCGACCTGACCGCCAACTTCA
GCGAGAGCCTCCTGGTCGGCTACAAGTGGTTCGACCAGCACCGCGTCGAGCCGCTGTTCCCCTTCGGCTTCGGCCTCACC
TACTCCCAATTTGCGCTCCACGACTTCTCCGTCAGCGAAGCCGCCACTACCAACACCACCTTCCACTGCCACGCCACCCT
CGCCAACATCGGTAACGCAACCGCCAAGCAGGTCGTCCAGCTCTATGTTGCCTATCCGCCGCACGCCCGCGAGCCACCTA
AGCTGCTCAGGGGCTTTGCCAAGGTCGAGCTAGCCGCCGGCACCGCCAAGGCCGTCGCCATAGATGTCGCGAAAAGCGAC
TTGCAGATCTGGGACGACGTTGCCGAGGACTGGGCGCTGGTGCCGGGCGTGTACGAGTTTCTAGTCGGCTTCTCGTCGCG
AGACATTGTGGCCCGCCAGACCGTCTATATTGGGTAATGGGAAGCGGTGGACACTCAAGAAATTCTACCTTATGATGTCC
ACGTTGGGGTTATAAATCAGAGAATATTGTCGTTTTATGTATGCTTAGTAAGCGATTGTGTATAGTTGTGGTCTTCCTCA
TACGCCTTGCTGACTGTAATGATATTCAGTCTCCGACAACTGACGTGCAATTGATAGATAGAATAGTGTGTTAGGGCCAG
CTTTTGTTATAATAAGGTATCTTACTTTTGTTAAACAGGAATACAAGCAATTTTTATAGGTTTACCATGATTTATCTTAC
AAAAGTTCTAAACCGAAGAGTTCTGCCCTTTCCCCTGCCGCTCTTCAAGGAATGTCTTGAAGTCCTAAGAATCAGAGGTC
AGATCGTCTATACTTCCACACCAAATATGAATCGGCCTCTACTGCCTTTAATCCTAGCAAGCTTTCGTCGTCAAGAACTT
TGACGTAGACGGCCAAAGGCTTATATTCGTTGCCTTCAAAATCATCTATATGTCTTCGTTAGGCGAGTCTTAAGGTTGGC
AAATTAGCCGTCGACTATAGACTTGTCATCTTTGATCACGGCTGGATAGTTACACTCCTTTAATGCCATACGCTTAAATT
AGGATACTCTAGCAGGATGCATTAAGTCTAATACGCTTGTAACCTTTAAATAATCCTTGAATAAACCTAAGCTAGCAATG
GCTTTGTATGTAGAGTACTATAAAAAAAGACTAGGCAAAGTCTCTTTATAAAAGTGGCGTTTATTTTAGCGACTAATCGA
TTTTTTTAAGCTGTTATAACAATGTTGCTAGCGATAATATTAAAGAAATATAGTTGATATATATATTAAGAGCCTACCTT
ATATACTAGAAGTAATAAAGTTATTATATAAACTTAAATAGGCTAACCTAACTATAGTTACTTAGTTAAATGCTTGTTAG
CTATATTTAAGAGAATTTAACAAAGACCTTAAGGTAGAATAATACGTAAGATAATAAGTTGTGTAAAAACTAGAGTTAGG
TATTACTTTAGCTTAAGGAACAAAACTTCTTTTAGTATAAACAAGTAAGATGGTTATAGTCTAGCTTAATTATATTATTT
TGTTATAACTTTTACTTGCGCCCTTACTTTATTCTAACAATTACCTTTGCAACATAGCTGTATAAGTTAGTATTATTTAT
TAAATAAAAAGGTATTTTTATTAATAGTAAATATTTAGTAAAGTTTAAACCTATTTATAAAATTGCTTTTTATAGTGCTG
CCTTTATATAACGTAATAAAATTATATATTGCGTAGTATATTATTAGTACCTAGTACCTAGCTTAAATTTATAAATTAAT
AGCCTAGAGTTATTTTTAAAGATATATGCTAGTTTTATAAGAAAGTATTTAAGATTACCTTACCTATAAATATACTTATA
ATTATAATAAAGTAGTAGTGTTAAAGGTATACTTGGGTAGGCTAGGTAAGTTAGGCAGGCAAGGAGGTATCTTCTTAACA
GGGGGGAGCAGCCGTATATTCAATAGCTAATTCTTGCCTTCTGCACTCTAAGGCTAAGGGAGTGCGGGAGGCGCTCTTTA
TCGTAGGCGCACCTCTGGCGCACCAAGTGCGCAAGACAGGCGCGACCCCGTTTCTACTTGGCCCGTGCGCTAGCACATGC
TGTGGCCTGTGCGCAGACTGCGCCACGCAGCCTGCGCCACAAGCACCGCTTCTAGTTCACGATGTGCATCTAATACGCTG
TGCGCATACTGCGTACGGCTTGCGCGTAGCCTGCGTCGGTCCTCTTCCTAGGGCGGCGTTACACTTTCTTCTTTTTTAGC
TTAGTTTTTAACTAGTTTAATCTACCTAATAGCAACTTCTCTTATTAGGCTAGACTTTTACATTATACCTTTTTTCTTTT
TAGCTATTTAAATAAAACAAAGACTAAAGATTTAGTTTTTAAGGAATATACTTAGCCTAGCTTGTTAGTAAATGTTTAAA
AGCTAGTATAAAACTATAATATTTATTGTAAGGTAAAGGTTTAAAAAGAAGTAAAGTAAAGCTTATTAAACCCTTTACTT
ATTTTTAATTAGCCTTAGGCTAAATTATTTATTAACGTTATTATCAAACTACCTTCTTTTATTTCTAAAAGCATACTATA
TAAAAACCTCTTAATAATTATAGACTACCTTTTAAGGTGTATAATACTAACTCTAATAAGGAAAATCAAAACTATTAATA
TAGTAAAAGCTTTAGCCAAATCTATCTTTACTTACTATAGCTTTTTAAATTCAATTATTTTTAACTAAAGAACTTAGTTT
ATCTTTATACTATAAGAAAAGATTTATAAAAAGCTATTTATTATATATAAACTCTTAATAGCCTTTTACCTTTAAACTAA
TAGTGCTATAAAAAAAGCCAACTAAAAAGTAAAAGTATTCTTATATATTTATACTTCTTTCTTTTAAGATAACTAAGCCT
CTCTTTTGCTTAGCGCTGTAATAGCTTTAAATTCTTGCACCTCTTTAACTACTAAACTAACCTTTGTTTTCTTTATATAT
AACTACTAGCCTATTAAAGGTATACTTAAACAAAAGCGTTAAATATTTTATTAAAACTTATTACTTTATATAAAAAGGTG
CCTTTAAATAGCTTTAGCAATCTTAGCTTTAGTAATTATTTAAAATATAAAGATTCTAAGCTTAGCCTACTAGTTTAGGT
TAAAAGGTTTTGCTTATAAAGTTAAAAAAAAGTAGGCTAATAGTTTTTCTATCTTTGTATTATAAAAACGTATTATTATT
TTATTTACTTTGCGTAGTAAAAAGAGGTGCGTAGCTTTTATAAGCCTATAGCTATATTGTCTTACCTACTACTTAAAGCG
CTAAGCTAAGGTTTTAACTTTTAATATAGTATAGATTATACCTTACTAATAAGCTATACTTATGGCTTAAAGCGCCTATG
CTTAGTCTTTATATACTATTTTTTATAGCGGTAGCTATATTCTTACTTTTTTATTAGGCTTTTTCTTTTCTTTTTACTAC
TTATAGGTTATAAGTAGTAGAGTTGTATTTTGCGTTTTACCCTATATATTAAAAGCTAATAGCTAGTTTTTTAGTAAAGG
TTATTATAAAGGCTATGTTATAAAGTAAGCTAACTAGCTTATTTATTATTTCTTTTATCTCTTTTAGTAAGGTTAGGGTG
TTAGAAACTAGCTTAAAGAGAAAAGAGGTAAGCTTAAGGATATATTCTTTATTAGTATAGTACTAGCTAAAGCTATAGCA
GTTAAGAGGCAAGTAAGAGGTATTAATTATATACACTTATAGTTAGTAGTTAAATCTAGTAAAGTTAAAAGATAAGTATA
TAGCTTACGTGTTTGCTATTACTCATATATAGTTAATAATAGATAGTTGTTTACTGCTAGCACTATAGTTATACTAGGTA
TGCTTGCTTGGTAGTGTTTAAAAGGATAAGTTTAGTCTATTATAAAGTTAGTTAAGGTTACTACTTATATTAACTTGTAG
CGTACTAGGTCTTAAAGTAAGTAATGTATATTTAGGTTGCTTATAATAATAATGTTAGTATTAAAGGAAAGAAGGGATTA
TGCTAGCTAAGAGAAGAGGAAGGTTTAAGCTTATAAGTATAAGTTTAGACTATAAACGCTATATATATAAAGTAGCTAAA
GGCTTAAGAAGAAGAAGAGAAAGATATAGTTTATAGTAATAGTAAAAGTTTATAGGCTAGCTAGTATATACTAAATGACG
TAGGCTATAACCTAGCTATTATCTAGCTAAATCTTAATAAACTAGCTAGTTGCTGCACTTAGAATGTTTCAAGTTAACTA
GTTATACTATAGTTCTCAAAGAAGAAGGAATATTAGTGCTATTATATTATATTTAATGTAGTATTTTAGCAATATATTGC
TTATATTTAAAAACATTTTACAACACTATATATATAAAGTAAGGTAGAGAGAAGGAATTATACTAAGTAATGCCTTTGCT
ACTACTATTGCTATAGTTTAAGCTGTTACCTTTATACTTTTATCTTATACTATCTTTACTATTAAGCACTAAGAGTAGTA
TGCTAAATATAGCTTGAACGCACTTTTTGATTCTAGTATAGCTATACATTACTAGCTTTAATAATCTACACTACAGTATA
TGTATTATTAAGGTTTATAGTAGTAATGTACTATATATTTTTATATTTAGCATTTATAGTATATAAGTAGTTTATTATTA
TAGTATAAGACATTATTATGTACCATATATGTATTAATTATTATATAAACTTTACTTATAGCTATTAAAAAGGCAGTAGC
TACTATAATATAAAAACATCTAGTTAAAGCTTTAGCTTTAATTATTAGCTAAAGGCTAATAATTTAAGTGCTATATTTAA
CTTAATTTTAAAGGTTTATAAACTAAAAAACTACTACTAGAATGTTATATATAACTATGTAAGTAAAGGTAGATTTTAGC
TAAAGTTTAAGCTTATTAAGCTATACTATTTTTATTTAAACTAGCGTATAGTATATATATAAAAGACTATTATAATATCT
TTATTTAAAGTAATTTAAATAGCTTATATATAAGGCTAGTTGAGCTAGGCTAATACCTTATTAGTTATATTAATAATTTT
TACGTTTATTAAGTACTATCTTTAAGGTTTATAAATAATAAGCTTACTTTTATCTTTTAAGTTAAAGGTTTATAAAGTAA
GGTAAGTTTACTTATTATTATTATAAAGGTAAGTAGCTAGTACTTTTATATATAATAAAAGGACTAGTTGTCTAAAAAAA
GGAATAAAAGGAAGAGAGGGTTAAGAAGAAACGAAAAAAGGTTAAAAAAAGACAAAAGGTATATAAGTAATAAGCGCTTA
TATTAGTAGTAGTAGTATTAGTGCTATTATAGCTAGTTTACTATATTAGTTAATAATTGTTTAGAAAAAGCTTTAAAGTA
TACTATTAATAAGGTAAGCAGCTATCTAGTTTAATACGCTATATAGTAGTGTAATTGTTGCTACTATGTATAGCTAAGAG
ATCTTAAAAGCTTTAAGTTTTATACTAAGCTAGTTAAGTTTGTATAAGAATCAGCGTAGCGTTACTTCTAGTTTGTTTGT
TTATTTAAGAGGGAGTTGTTACTAGCGTTTAGGGTTAGGAAACTAGTATACTGGTACTAACTAGTACTAATACTAGTGTA
CTAGTATTACTAATAGTATTAATAGCTTTTAGCCTATAATAAAGTTAACAAAGAAAGCAATAACATAGTAAGTAATAGTA
ATATAAAGAAATAGTAAGTAAGTAAGTAAGAATAACTAACTAACTAACTAATAAGTCTTTAATTACTTAAGTTATTTTCC
TTATATAGATTATATTTTAATAAGCCTTATAGCCTATCCTTTAGTTTACGTTATTAATATATATAAGCTTAAATTTTTAC
TTAAGATATATCTATAAAAAGATTAACTAAAGTATAGAATGCTAGCACAAATTGGTAATAATTCAGGCAGGCTCGCAGAA
TAAAGTATATGCAGACCGCGCAAGGCTTAGCAGGGCCGGAGTAGGGCGTCCGGCGAGTCTTGCCTAGTAGTAGGAAAAAG
TATCGCCGAGCCCCGCTAAGGGCGCTAAGCCGGATTCGGCGACCAACGGCGAATAAGCGAAATAACGCTTAGCGAGCTTT
GCTGAGCGCCTTAAAGCGTTCTGCTACGCTATACTGCTATTGTAGCATATATATATATATATATTGTAAACGCTTACTAG
TAACGAATTTAAAAGGAGTAAGATAAAGTCTTACTACTACCCTTTTATACCTTTTATCTTGTAATTTATTTTGCTGTGAA
TTGTGTGCTTTATATAATACCTATTATAATATTAAGTAAAATAAACTAAGGAATAAGCTATATTATAGCTTATAAGTAGT
ATAATATGTATAAAGTAAAAGATTATAAAGTAAAGTAAAAAAAAAGATAAAAATATTATATAACTTACTAGTAAGTAAAA
GAGTAATAATAAAACTAAAAGTATATTATTACTATTACTATTGCTATTACTATTGCTGTTGCTATTGCCGTTGCTATCAT
TATTATTATAATAATAATAAAGAAAACGTAAAGTAAAGTAAGATAAAAGATAGTATTTATATATCTTATATTATAATAGA
AGCTTTTAAATTAATTACTATAAAAGCTTTTAGAATACTTACTTATTAATTATTCCTATAGTACCCTAGTGCTTAAGTAC
TACTAGTAATACTACTAGTATTTTTCTTAACCTTACTAGCGTTATAGTCTTAATTAGTAGTAGTGTTGCTAGTAGTTGTA
ATATGTTTGCTTACGTTTATATTTATATTTATGTCTTTACTTATAGTAGTGTTCTTAGCAGTAGTAGTAGCTTTATTAAT
ATCTTACGCGTTAATAGTAAGAGGACAACTTAGATATAGTTCTTTATTCCTAGTTTCTTTATAACGGTTGTAGTTCTTAT
TCTGCTTTACATAGTAGGAGTAATTACTTTTAAGGCCTTATTAGTGCTAAGAATGGTAGAGAGGTTAATGTGTCGTCTTA
CTATAGGTGCTGCTAGTGCCTTATATATCTTGCATACTTGTTTTAGCATTGTTATTATTACTATAGCGCTAGTATAGCCG
TTATTAAATTCGTTATTAGATTTGTTGTTAGATAGCTTAAACGTAGCTATTATAAGAAGTTTTGCATTTAATAAGCGTAA
TACTATATAGGTTAGTATATAAGTATTATCTTTTTATTAAGCTATATTTAAGATAGTTAAGGCTAATAGTTTTATAGCTT
TTTTTATAATTAAGAATAGCACTTATATTAGTTTTCTAAGCTACTTACTAAAGTAAGTTAATAAATCAATATATAAGTTA
TTTAAGGGTTGCTTAACGGCTAAGGTTATACTACGTATATATTATAAGAAGCTTTATTAGAATTTATACTAATGGCTTTA
TACTTAGTTATAAGCTTATAGCTACAGCGCTAGTTAATAATTTACTTATAAAAGGCTTAAGATAAAAGGTATACTTGCTA
CTCTCTTTCCTTTTACTATTATAATAAGCTATAAAAGTTAAAGAGTATTAAAAGATAAAGAATTATAATAAGTATTACTA
GTAGTATATAATTTATAGTAGAATAAAAAGTAAGATAAAAGGTATAAAAAGCTTAAAAGTAAGACTTTATCTTACTCTAT
TTAATTTTATTACTAGTAAGCGCTTAAAAAATATATATACGCTACAATAGCGGTTAAGCGTAGCAGAACACTTAAGGGCA
CTCGGCAAGCTTTACTAAGCGCCCTTTTACTTATTCGCCATTATTCGCCGAATGCGGCCTAGCGCCCTTAGTAGGGCTCG
GCGGTACTTTCTTTTGCTACTATTAAAAAATACTAGTTTTTAAGCTACTATAATTATATAAACTACTTTTAAAAAAAACC
CTAATTTAACTAGCTAACTAGCTAAATATTAACAGTTATATTCTACGTTATTTTAAGGCAGCTTTTATTTTGAAAGCTTT
ATAAAGCATTTAATAAAAAGGCAGTTAAAAGCACTCTATTTAAGCGAAAATTAAAAGTATTGAAAGTAAAAATTAAAAGC
CTATAACCTTAGAAAAAGAAGGCTATAGCTATAAGCCTAAATTTAAAATTCGCTATAATTAAGGACATACAAAGTAGTTA
AGCCGCCGCAGGAAGAGAAGTAATTAAAGTGGGCGATGGCTCTGAAGGAGAGCTTTCAAATGATATATAATTTGCATGAT
TTTGTTAGGTATTTCAATTGCTATAATTGGGGGGGGTTTTTTTTTGATGCTATCAAGTTATCACGATTTTTGGGTGGCCC
AAATGGGGGGGTGGCCGAAATCCCCATGGTCCCACTTTCTCCGTATCTCGGCGCTATTCAATTGTGAAGGCTTTTACAAG
CCAGATAGGTATGCGAAGTCACATAATGGATACCTCATTTTACAGCCGTCTTAGCGGGCTAAAATAGGTATAGCGCATGA
GTGCGAGCACTGTGTACTGGGCTTTTCACTAGCCCAGTCACAACTGAATCTAGGCCTAATGCTACAAGCCTTTTCTGTCT
TTCGTCCTACTAATCGTTCTGTTCTCGTCACCTGTTTTCTTTATTATCGCCATTATAGTTATTATCTTACTTTTACAAAA
AGAACGTAAAGCAGCCATGATATATGACAATGATGGTGCGTCTCCGGCCCAAGATGCGTCACAGGAGAAGTTGATTGCAG
GTGAGTCTCTCTCAAATGTGTCAAACGCAGCTTCATGCACAAATCTGATCGATATTTTCATAATGAAGACCTGGGCATTG
TTGCAACAGCAGTGGTAGCTGGAGAATGGACAGTGGACAAAGCTGTGAACATGATACCAACCGGAAAACCCGAGGGGGGG
TCACTATCCGCTGTACCTTATTTTCACATTCTCGAGCGGCTGAAGACAACAAAGAGGGAGGGGTGGCGGAGATTTGGAAT
TATCCAGTGAGCCGATGAAACAATTGTTCTGTTCAAGATGATTATGATCTGACCCTTCTAAGTGGTGAATCCATTGCAGA
TCACATGTACCGCATGTCTCTTATTACCATGCTAGCCCCCCCATCGCTCTCTTCGCGACTTGACATGACCAGGTGTATGA
AGATGTGTCTCATACATGACATGGCCGAATCACTGGTTGGCGATATCACCCCAGTTGACGGCGTACCGAAGCCAGAGAAA
AGCCGCAGAGAATCCTCCACTATGGATTATATCACCGAAACGTTACTTGGTAACGTCGGTGGTGGCAACCCGGGCCGGGA
AATGCGCCACATTTGGCAAGAATACGAAGATTCGAGGACACCAGAAAGCATTTTCGTGCACGATGTCGACAAAATCGAAC
TTCTCTTACAGATGGCCGAATATGAGAAGCGTGGCGATGGTCGTATCGACCTAAGCGAATTTGCCTATGTGGCCACCAAA
TTGTCACTTCCGGAAACAAACGAGTGGGCAGAGCAAATTCTCCGAGAACGCGACGAGTTTTGGGGTAGCCGCCTACACGT
CCAGAATGACCAAGGTGTTGATGGTGGTGTCTCTACAGACCGCAACGAAATGCGAAACGCGTACTACACACAGAACGGCG
AGGCCAGGAGCGATAATGATTGATGGGATACCGAACCGGGTTCTAGATTTCCTGGTGGCCATAGATGGAGTCACTGGCGA
CAGTGCGGAGAATTAATCAATATTTCTTCACCCCCCCCCCCCCCCGACCGGTGTTTTCGAGATTTCAGAACCTGTACGAA
GTAGTTCAAACATGTCGTTTGGTAACAATCAGTTCTATAACATTATTGATTTTACAGAGTACGAAGTATATCCATCTGTA
AATATAGCTATCTGAGCTTACGATTACATAACCGAAACGGGTCGTTATTGCTAGGCAACGGAACTTAAAATACAGTACGG
AGTACTCGTACGGAGTATGGTGTTTGTTTACGGCACCTATTACGGAGTACAGATAAACACTTGCAAGTTACATACCCCAC
AAACACGACACGTCCGAGTATATGTATACCCAGACGATGGCACACTGGAACGAAATTGACACGATCAGATAACCGCGACT
GTGTCTTGGTCGATTGGATAAGCAGAGAGTGCGTATGAACTCAATCAAATAGCGTGGCGGTGCTTTTTTTCAATAGTGTG
GCGCTTAAAGTAAGATAACACAGCATCGCATTGCATTCTGCTTGATGAATAATGCTAGCAAGCTAACGGTTTCACATCAG
AAGGCTCAGTGCCGTCTGCTTCTTTACCAAACCCGTTCATCTTATGATTTTGCGCGACCTATCCTTGTCAAGGGTCTATC
AAGCAGAGACTCAAGCCTCTCCTTTGATGCGGCTTGTAACAAAGCCAGCCGCTTGATCTCCCACAACATAGACTCCTGCG
TTCCTGTTTATGCGCCTCTGCCACCGCCCCCATGACCTCTTCGAAATCCGAGTTTCACGTGCCAGGCGCATACCGAATCG
ATAATCCACCCTGGCCAATTTCTGCCTTGGGTGCAAATATCTACCTTCCACCCACGTCTCCATCTGTGTCGAACTCTGTA
CTCAACTTGGACAAGTCCACTACAAGCCTTTACTCTGATATATCGATAATGAATGGCATGGATATCCCCACATCTGTCAA
AAGAAAGCGAAAACGACCCGCGAACGATTACAGGGAATCAACACCACTGGCTGAGTGGCAAAACATGAGCATGGACACAA
CAAGCGACCTAGCCCTACCCTCAGAAACTAAAGAACAGTTAGGCGAGAGGTTGTACAAAAGAAAGACCGGAGGGCCTATT
CAGTATACGCTTGCAGGCCAGATAGAGACTTGTGAAACAGCGGAATCTGGAGCCTTGGAGGGTAGCACCTACTCAGATAT
CGAATACCGAAGAGCTCTAGGCCCCACGCGGCTGCACGAGACAAACGAAGGGACAGGTCGGTCCGGAACAGATGCCAATT
TCGAGCCCCCAGCTTTGGAACACTGGTCCATTCTGCATGCTCTTGGAAGTGTCGTTGGTAGGGTTTGGGATTTCTGTACA
GGAAGTGGATTCCGCGGCTTTCATGCTGGCGGCGGTGTTGGCTATGACTGGGACACAGGAAAGCCGGTGGACCAGAGCGC
TACCCACGTGAATAACACCTCGCACATCGGTCTGCAACCAGCTACAGGGTGGCCCGAAACGGACGAAAGCAAACAGAGCC
GTGCTCCCAGTGATTTTTTTCAGCCTGATTGGAGCTTTCAGCCCAGCAAAGACGTTCAAAGGACGGAGGAGACTCAAGAC
TCAAAGCACAGATGTGCTTTGAAGAGGCGGCAAGTTGGCGTCGCAGGCGAAGAACTCGGGCGCAACTGGGTCGTTGTGGA
GACCGACCGAGTACGTGACAACGAACGACGTGCAGTCGGCACATCAGAGGCTACCGACGCCCGAATACCAGCTCAAAGGA
TGAGCATGACAAAGGTGCATACGTCTGACACTGCACTGCGCCAAATAAGCACACCTGTATCGCGGCTTGCTACTCCAGTA
CAGTCAACCAAAATATGGAACGGACGTGTCCCCCATACTAGCAGTCCGATGATGTCGCCACGTGAGCCGGCAAGTTTCAC
CTCTCCACGGTGCTCTCCTTCGTCGACGCAGCCGGGCTTTGATCGTAGCGCATATGGCCAATCCACTAGCCGCATTCCAG
TTCCGTCGATGGGTGGTCGCACGACCAATCCCTTTGCACGCACGGCATCACCGGCGTCTGGATACAGAGCGAGGAGCCGA
AACGGGACGGCACCTACGTCACCGACACTTTCCGTAGGCCGGCCAAACGGTGCTCAAAAGTTACGTCGACGGGGTCACAG
CATGACGGCGGTGGCGTCTCTTTCTCGGAAAGGCTTCGGACACGAAGCGTTGGAAGGCGCTATCGATGCAAGCCCACGCT
TAGACGAAGAAGCAAGGCAGTTGGCTGCCCGTAGGGCTGTTGCTGAATTGGATGCTGACGCTAAGATGGAAACCTTTAAT
TTGAGGTTGCAAGCTATGATTCGCCAAGGCAAAGAAGCTCTCGGAACGGCATTCGAAATCGACGGCGATGGCGAACAAGA
AGGCTGGATGGATGCCGACTGATACTATTGCTGCGCCTCTTTTCGATTTACTGTTGGCAACCTACCGGCCTACCTTTCAA
AGCGAGGGAATGTTTACTTTCTAGTTCAACTATGATTTTGGACAGGCCTTCTTGCCTTTTACAAAATCCTATGGTACTGG
GGATATCCTTGTCCATAACTCCATTTATTCCAGATGAAACAGATTGCTCAATTCGAAACAACGATGTATAAACACAGAAA
GAAGAAATCAGATCGTAACTCCTATATTGATTCGACATCTTCGCCTTCAACCCCCTCTCCGAATTATCTCGCCTTGCATC
CTGCTTGCAAGACCGAGTGCCGTTGTACAGAGTTGTACACAGACGCCGTAGCAAGCCAGTCATGTCTGCCGGCCAACTCT
CACATCCAAAGGCCTGCCCGTTTTTGATCCCGAGGCAGTACAGTATTCATTCGCGTTGGCCAAAACTAGCACCCGAATTA
CTTGAATCTCATGGTGGCTTGGGGCCCCGGACGGACATTGCTGTCCACTTGGCCTCTAAGCATCCTGGTCTCGTTTAGAA
CATCCTCTAGTTCTTGTTTCAGCCTGACGTCACGCACGGAGGTCAAAATGTCGAGGACTGTGCGCTCAGCACGACCCATC
AGGTCGACAACCCAACGCGCTATGCTTGCATCCCCCTTTGCACTCCCAAGACCGCTAACTTCGAGCTCGTGGCACCAGAT
GCCCACGACTGTATTTATCCATTCCACGACCGCCTTTCTCCGGCGTCCAGTGAATGGCACCTCCTGCGTATCTAGGATTC
GCTCCAAAACCCGAACAATCATGGCATGAGATACCCGCAACTGCAGAAAAAGCAAGACAGGCCATGCAGGATTGGCACCA
ATAGAAGCGTCTTGCTGTTTAGTCAGCGCATATTCGCACACAATTGTTAGCAAAACGTCGATTGGGAAAATGAGCGAGCC
CAACGACGTGCGGTGTGCAATCGTCTGAACTTGCATGGAAACAGCTTCGTATGGCAATGGCGGTGGCCCAGTCGCGTTCA
TACTGCTGTCGCTCACTCTATGCCCACGACAAAACTCTTCGTACGCAGCAAGCCGCTCTTCGACGTCTTCATGTGTGCTA
TTAATGAGCTGCTTCCAGGTGTCCGCGATGACACGAGGATTATGGTAATCCGCAGCATTGAATATCAAGAGGCAGAGATC
GTAGTAGCCTGCCTGATCGGCATATCCGTTGAACAGCTTGGACAATATTAGTTTGACAATTGACCCTGACAACTGTAGGC
AAAAATTGTAACATACCTCTGATAAGCCAAGCACCGGCCCATCAAGATCCTTTTCAATTTCAGTTTTCCGAGCAGCAGGT
ATACGGCTATCTGAGAGCAATCTCTCAAGCAGGTCGTCTTGGACATGAGCGATATCGAGCAGTTCTGTCACTTCATGGTT
GAGCTGTTGTTGACTTTGTCCACTGACGCCTGCTGTGGATACACTGGCGTTGGCTTTAGCTCGACTGAGAAGCGTGATGC
GGTCCTTGATGCTGACGTCAAAGTTGGATGCAGCAAGGTTGTATTGAACATTGGCGGCATCGAAAAATCTGCTGCGATGC
GTATAAAAACGACACAAGAGATCTGCGTGGCTGGCGTCGACTGAGGCAAGGCGCTCGAGGAACGTGACAATGTGTGGCGA
ATCAATTGCAAGAAGACGATCTGTTAGACCTTGCTCAATATACCACTCGTACAAGTCGAAATGAAAGACTTCATCGTCGG
AGTCATTGACAACACTGTACGCTTCCATTCGTTTGGTTGCGGCGAGTGTGAGCCGACCATCGATGAGCTCGGGTTCCGCA
GTTGAGTCAATATCAAGCTGGCCAAGCACAGTATGGATGAGGTCATAGCAACCCTTTCGGCTCTCCCATTTACACTTTCT
TGGATCGCTTTCTGACTTTCCGTCACTAATCCATGCCGAGGCTGTGTTGCCTCGGTCTGACTCCCTTGCCACAACAAGAC
ATAACTGGATTGCACCTGCGTAGTACTTCAGCTGCACGTATTGCTTGACGGCGGCATGCAAATTCGGAAATGACAAACTC
CCAGCGACGCGTTCAAACAGGTGGAGACTCTCATTCAGGAGATTGCGTGCGACGCTGGGTGAGTTGGCCTGCTCTAGAGC
TCTTTGCAACTGCTCCTGGGCTTTGAAGACCACAACGTCGTCAGGACTGCAGAAGCTACCACAGCGGCGACGCAGAGCGT
CAGCTACTGTTTCAACGTTGGAGCCGCTCTCAATATTTCGATTGACAATGACCTTCACAAGCAACTTGGCCAGTTGCTTT
CCCTCCGGCTTGGAGAAGAGACTTTCGTACGTTAATGAGCGTAGTTCCTGGCGGGTGGAGTCGTCCATTCTAACATAAAT
GTCGGATACACGCTCGTCGAAGAGCATTAGAACGAACGAAATACCCTCAGAAATGCTCTCCATTAGCTTCTGCAAAGCAT
GTAACGCCTGATGCTCGGCCTGCAGGGCGATTTCTTCATGTCTCGTGGTGCGGCGCAGGTCTGCAGGTCCTGACAATCCC
TGTATAGAGCCCGCATTAACCTTCAGAAAAGTGCGCAGCCGTTCAAGGTTCTCTTGGACAATTGTGAGCTCGCCGGTCGG
TACCGTGGATTTGACAACTACACCGGTAGGGGAAAAGTCTCTGGTGATAACTCTGGCGCCCCACAAAGTTCGAATCAATC
GTGTGAGGTATAGCACAAGGGCATCATGGCGAGAGGAGAGCCTGACTGAGTCCATAGTGATAGTACTGCTGTCCGTCTCG
GAGACGGTTGGCTGGCCACCGTAGTTAACAAAGGCTGCCTTGGCTCGATCCTCTGTAGCCTGGTCAACGGCGCGGCTTGT
ACCTGCTCGAAGATCGCTTCCCTGACCGCATGCGACTGCAAGGGTAGTAGAAATAGTTTCGACGCGCCCGTATAACTGGA
TGAACTTTCGAATTTCTTTGTCGAACATGTCGTCACTGCCAAAAGCTCGAATAACAGTAGCGAATATGTCGACAAGACGT
CGTCTTCGGATGATATGAATTCCATCGTTCGTCATGATAGCAAATTCGCTCGGTGGAGAGTCGAACTGCACAGCCAACTC
ATTGCCAAAACCCAAGGGTTGCTTTGCTGCCGCAAAGGGCTTTGTCACAAGGCCAACATCCAAAGCGTCTTGCGCTCTTC
CTAGCGAAATCCAATTACCGTGCTCGTAATATTTCAATGCGGAGGCGGGGGTAGTCATCTGTATCTTTCCAGTTTCGGGT
GCCGAGACGAATAGCCGTACCTCCTGCCCCCCGACGAAGTCAAAGAAAAAACCTGGTGCAAACCGACAACCCTTTATTGT
AGGGTCTAGGGCACGAGATTGAAGGTCCACCACAGCATCTGTAGATCCACCGAGACGCGACATTGCGCCAACCGCAGCTG
ACTGATCCCTAGGAGGAAACTTGACAAACTGAACTTGCATGGATTGAGGTGCTGTGTTCGATGAATTCATGATGTAAGAT
GCCGAGCTTGTCGCACTGAGAAAAAGGCGGCAACCGGTGCTTGTCAGCGCCATCAAGTGAAGCTTCGAAGCTTCTTGTGC
AGAAATGGGACTGATGCCGATGATGGAAACGCGGTCTGTCAAAAGCGGGGACGAGTTGATCATATGTGTGATGTCTCGGA
GACAGTGATTCTTTTCTTTCTCGATAACCTTCGTGAGCTTGTCCGGACCCTCAATGTGATATGTGCGTATGGTGGATTTA
TTTGAGAGCGTGTACAACAAATTTCGCGAGTCATCAACGACCATTTGTACCAGAGACTCCGAGTTTCTTTGTGACCAAAA
GTCAAGGTTGACAGGTAAGACCGGGACAACCGACGACCAGCCCGGATGGCTGTGGTTGCACCTTCCCACGCGGTTAGAGA
ACCATTTTTCTTCCTGTTGGTAGTAGATTTCGTGCACGTCGGTATCGTTTCGACCACCAAGGAAGATGCGACCAGACGAA
GTGCCCACAATGAAAGCCACATTGGCACCGCCACGGTGAATGGACATCTTTGTCTGATATAATGAGACTGCCTTTGAGCC
GGCAGGTGTATTGGTAGCCTCAACACCAAGCAGAATGATATCAACCTCTGTGGCGACTACCAGTATGTGACTGATGTCAT
TGACAAAAACGCCTGGTTTAGGACGCACAAGACCGACTGCTGTAATGGCGTGTGGCTGGTCCTCGAAGCCTATCAGCTCG
GGATTGGGCAGCGTAAAGTCCCACAAGAAAAGACTGCTATCTATGCAGGCATAAGCATGGTTTAATTCTGGGAAGAGTCC
CATGATTGTGACAAGCTGGGAAACGTTGTATCGTTCGAAGATCTGTTCGGGGATAGGAAATGTCTGCACTTTGTGGAAGG
GTGCCCGCGGCGATTCGGCGCCGTGAATGTCATACTCTGAAGATGCGCCAGCTAATGTTGATATAATCCTATTAGCTCCC
TTGCCTTATGCCCCCTCCCTGTGAATGAAACCTGCAGATATAAGGGTGAATGCGCGGCATACGCAGGATAATGACTTACG
TCGACAGTACGAATCAAGGTCTGGGTAGCTCTCGTCGAGCTGTAGAACCTTGTTCACCGACCCAGCAGCCTTCAGAATAG
GAGAGAGCGATGGAAGAGCAGGGAGAGCTGTGACGGGGTCTATTGGATCTTGGTCAGGCGGTTGGTTGTGCGCAATGGAG
CCGTTGATGTCCGATGTAGGTATCGCGTCGAAGAATGAGCGTCCGGCGTCAAGTTTGGATGCTTTAGCGGGGGTTGCGAA
AAATGCACCCGGAATCGGACGCCCAGGAGTTGCTGCCATTCTGACATACAGTACTTTGAAGATATATCAGGCGGCGCGTC
AAGCAGCTGTTCCCTTCAATTAGTAACGAGCCGTCTGTCCCAGGCGGTTGACAGGGAGCCTCGAGAGGAAATGTTGCTAG
ACACCCTGAATGCGTAGTTCTTCTAAAAAAGAAGGATTCAAGGGCGCGACCTGCGATGCAAAGAGAAGCGGGCGTAGCTT
ACGACTCTTTTCTAGAATGGCATGTGGTGGTCTGGTTCTGCTGCTTCCGAAAATTTGGAGCATGAAGGTTTGGACATTTT
GAGCTCGAACGCGACGCTGTCGCGCAAACACACTAGACCCCATAAGATACCCGATTACGTAACTGGGCGTTCCCAAGGGG
ATGTGCTAGACACAGGTCAAAATTCTACAAACAAGGGCCAGGTGACTTATTTAGGCGGTTAACACAGGCAGAATATTGAA
ATCGTCTCTGTGTAAGTCATAATAGATTCGAAGTAAAATAACCAAAAACACTAAATAAGAACAGAAAAGACTAGTAAATA
CCATACAAGACCAGTTATGCCGCCGTGTCCTTATCCATTGTATCAGAAAACTCCCTCCTACTAAGCGTTATCGGCACCGG
CCTGCCCGTACGGCGCGCCGCTGCCCGTCCTTGTGCGTGCACCACTAGTCTGTACGCGCAATCTCTGCGCGTGTACTAGT
GTATGACCCGTACAGTACAATACGCACAGTTAGATAAGCACGCAGTTAGATAAGCACCTTGCACGTAGCACGTGTGCTAT
AGGTGTTATAGATAGTAAGTAACCTTTGCAATGTTAACGCATCTTTGCGCGCTGCGCACTATAAAATGGCTTGAATTGGC
GGCCTTTCCCTTATAATGTAATCTAATAGTAAATAAACGCTTAGGCTACACTACGCCAATATGTGTTTAAATATAGAAAG
TTAACACTAAAGGTAGGTAGGCGTATCGTAACTGTTTCTTGCAACCACCAGTACCAGTAGCGCCAAGTAGGCGAAGGGGA
TTTAATGCAATAGACAAGGATATAGTGCTGTAACTGGTTTTGAATGGTATACGTTGTATACCAGCCTTTTTAGCTTTTAT
ACGCGGTTTTTGTTATTGTGCTTTGAATCTATCGCCGCTTCTGCGATTTCGGTATTTTAAGATACTATGGCTAACCGCTA
AGTAAAGTCACGTGTAGGCCGTTGGGGGGCGCACCTAGACTTGGGGGCGGGGGGGGGGGAGGGGGGGACGCACCTAGCAC
ATCCTGTTATTAGAACTGTTCTGTTATTTATTACTACCAACATTCACCATGTTTCTCATGTCAACACCTATACGGAGCAC
TCCCTAATGCTATGAAATGCTCCGTACGGCGCATGTCGTTTGACAATGCTACCGGGTAAAGCGATATATCTTGGCACGGC
CCAAAATGGACTTCCCCGAACTTTTGGTGTCTTGTAAGCTGTATCCTACCCCCATAAGGAATAATACTTGGACTCCAAAT
CACTAGGCCTTCTTCGCCTCGCGGGACGCCTTCCGAAGAGCCCTGCTGCGGATGCCCTTGTGCATCTTTGAGTTATACCA
GATGCCAGCACTATTTCCCACACCTATAGTATTCTCTACAGCCCATTGCATGATTGCATGCGTCCAGAATGGCGTGTATG
TGAATGCAAATGCTTGTGACCCACGGCCAATCTTCCTTAGTGCGGACCGCACAAACGCATCTGGCTTGGGAATCAGGAAA
CTCGAACGACGGACCTTGCTCATTGCTGACACGACTAGGTAGCTCAGTACGAGGTATGCGTCGACACCACTCGGCTTGAG
CTCCGCGGCCAGCGACGAGTTCCAATGTTGTAGAAAGGCTTTGCTGCCACTGTACGTGGCAAGATAGGGCGTTGGCATCC
AGCCTCCAAACGACCCCATGGTTAGGATCAGCCCGCGCTTGCGCCGTACCATTCCCGGAGCGATGACCCTTGTTGTTTTC
AATGTGCCCAAACAATTGATCGTCACAATATCCTGGAGTTCGTCTTTGGTAGTTTCAAGGAACGGGACGGGAATGCTGTG
GCTTTGTCCTACATTGTTGACCAGTATAGCAATGTCGAGGCCGCTAACAAGCCGGGCCAGTTTATCGTAGTCTGCGTCGT
CGTTTTTGGAGAAATCCATGGCTAGAACCTTCGTCTGTATACCAGACGAGGCATACTTCTTCTGCAGTTGCTCTGCGAGG
GTATCGAGTTTGGATTGGGTGCGGGATATGAGGACAATATTGAAGCCCTTGGAAGCTAGCTGCGTAGCAAACTCCTTGCC
GAGGCCATCCGAAGCACCTGTGACAACAGCCCAAGTACCCTTACCTCCATATTTCCGTAGCTAGGTGTCGCATTAGTTAG
CTACTTGATGATATACACGAGAATCAATCAATCTGCGTCGTTTTCTGGTCGTCTCACATCGGTTCCACGAAGGATGAACA
AGTTGAAGAAGAAAGCCAAGCTCGAGAAGAGCTTGCTCCCTAAAAAAACCACACCGACAAATGCAATTGCGCCTTGCACA
GGTTTGGGAACCATGCCAATAGACGCTTTAAAACCCTCCATTTTCACGGTGCGGTTTTAGAGATGCAAGGGTGTTGTAAT
TGCTGGGCTGAGGACGTGAGAGTTTTGGTAAAAATTGGGATGGTGAGGCGGGGAGTTTTCGAATTATGAAGGTCGATTAC
ATAGCCAAGTTCGTATTACTAATAGCTAATAACCCTGCAAGTCCTCGTACCTCCGTACCGATTTGTATCTTACTCCGTAA
GATACCGTAATTACTGAAAATCCTCTCATCTGAAACCTTCAAAAACACAAAAATCTCCTAACAACTGAAGCGCTACCTTA
AAATGAATGCTCTTTTCTCCAATCTCCCTCTTGGCGATCAGGGCATTCTGCCCTGCTACCTTTTTCTGGTACGTTACGCG
TTCTATGCATGATGAAACCAGTATCTTTGTCTGATACATAATGATTGGGCAGGTTGGCGTCGTTTCGATTGGAAACTCAA
TTCAAAATCTCGTCACACTACACTACACTCGAAGAATATACAACGGCAAATTTGTCCCGAATTCATCGCTGGCACAACGT
TCAAGCGAAACCGACTACGCAGACAGCATTAACAAGATTATTCCCGCATTGAGCAAGACGAAGAATGCCGACAAAGCACG
GGATCAAGTAACGCCACTTGCAGCGAGAATATTTGGGGTCTGGACGATACTGGCCGGCATCATTCGCATATACACAGCGC
GGGATGTCCACAATCGGGCTTTGTACGAGCTGAGCCTCATCACACACGTGGTAGCGGCCATACACTTTGGCAGTGAGCTG
CTCGTTTTCAAAACGCTGAAATTGACGGGCCCCCAGTTTTTCCCCCTAATGGCTGGCTTCGGTGGTACGATTTGGATGGC
GATGCAATATAGCCACTATGTGTTTTAACTAGTTTGACCGAACCGCGAAAGCATTGTAAGAACGAAAAAAATGGCACGTT
TCAAAGGTGATATACGGCTATTATGTAGGGGTTCTCATAGAGCCTGGCGGTAAAGCTGTCCTCCACTATCCCTCAAGCGC
GCTGCAGCCTGTTCCGGGGTGATATCCCGTTGTGGCTCAGCCATCAACTCATATCCGACAAGGAATTTGCGAACTGTGGC
GGATCGAAGAAGTGGAGGATAGAAATGCATGTGGAACCAGCTATTCTCTGCCTCTTCGTCAGAACATTCAAGCGGGGCTT
GGTGGATGCCAGAGCCTATCGGTATGTTTTTTTAGCTAGCATCCTATTAAAGGTACTCCGTAGTCCCGCAATCACTGGGT
CGAGCTTACTATAAGGGAAGCTTGTCTCGAAAAGATTGTCGTAACGTCTAGCAACTTCCTGAATCGCATCTGCAAACAAA
AGACGCTCCTCAGTAGTTAAATCGACAATCGCTCGGACGTGCCTTGTGGCAATGATCATGACTTCGAATGGCCATATGGC
CCACCAAGGGCAGACGACGAGAAAAGCATCGTTTGTATACACAACACGTTCACCTTTCTCCAACTCTAGCTGGACGTAAT
CGCTGAGCAGGTGCCGACCGTCATTTGCAGCACGGTATTTGCGCATCTGGACAAGTTCTTTTTCCGGTTCTTGGGGCAGA
CTAGACGTTGCCCACACTTGGCAATGCGGGTGCGGATTGGAGCAGCCCATAGCACTGCCCTTATTTTCGAAGATCTGCAT
GTATCGAAGCTGTGTGCGTGGAGGGGACACGCCGGCATACTCGAGCGATGGGGAGGCCTTTAAAAAGCTGTCTGCTGCCT
GGGAAATGGGACTGGAAGGTGAAACATGCTTTGCATATATTTGAGACCAAGAGAGAACGATGGGCACGATGGCTTCGGCG
GGCATGTCTGCAAGGGTCAGATTATGCTTTGGGGAAAAAGTGAGAACGTAGCATCTGCCTGTCGTCGGTTCCGCGCGCAG
CAACAACGTCTCAAGATCTTATCTATTGTCAGCCAACCAGTCCTGGAGGAAGAGCGGAGCGTAATACGTACTATTCTCAG
GTCTGGGCTTGTAATCCTCTTGTTCCTCCTTCACCGCGCTGTAGTCATTTACAAAGACAAAAGTGCTGTCGTAATTGGGG
TTGGGATTCCCCTGTGCTCTGGTATTCCCTGGGCAAAGGTAGCACTTTGAGTCATACTCTGGCAGTGTGTTCTTCATGGC
GACCTCCTGCTGGCCTCTTGAAGAGTTTGGATTGTCAATTTGCTAGTCAAGTCGTAGAAAACTTCACAGATGAGGAGCAC
TGACTGCCAAGGACGTTTGGTCCTGTGGGGAGAGACGAGCAGCCATGCGCCAGTCAAGGGATTGTAGCGGCGGTGGGATA
TATTGTTAAGAACGTCGTCAGCCATATTTTGAGGTCGGTCTTTCGAGATAAGACGAAGTGAGAATTCGGTGTAGATGTCT
GGTTTCTTTTGCCCTCAAAAAGGAGGGGTGGCAATTTGGGCGGGGTAAAGCATGACCGATACCCTCTTACGATCGGTTTT
CAAAGCACGCGATGTGAACACGTTCTGAAAAAGGAAATCAGGAGAGCAACGCACTCTTACAAGTACATTTTTTCAAGCCG
GAATCCCATAGTACATTGCTTCTAACCCCACTAAGGTCGCATTAAACCTTATTAAAATTAAAGTAGAATAGGAGCTAAGT
TCTTATTATTAAATAGTATTATAATAATAGCTAAAAAGACTTTACTTTAATTTTTTTTGGCTTTTAACTATTAGTAGTAA
GGTAATTATAAAAATCTTTAACTAAGTACTTTAATAAAAAAAGCACTAGTAAGCTAATAAAAAAAAATCGTAAAGAGAGT
ATACTCTTAAGAGTTAAAGTTATATACTTATACTAAGTAAGGTTAAGGAACTAGTATACTAGTACTAATATTTGCCTGTA
CTAGTACTAGTCTAGTACTAACTAGTACTTATACTAGACTAGTACTTTAAAACTGTAAAGCTTTAGACTAGAGCGCACTA
TAACCATTCTAACTAATGTTAGCAAAGCAGCCTCTTATTAGTTAGAATAAGTAAAAGTAGGGATTAGCCCTATTAAAATC
TCTGCACTATAGAAGGTGCGCTATGTACTCCTTTCTAGTTGATATATTACGCACTTTATTAGCCATACTAAGCAGACTTA
TACAGTGCTTTGTATCATTTGCTGTTAGCATTAGTTGTAACAGGTTATAAGCTTAGATACTATATCCGGGTCTGTTGCGG
TAATTTGCGTTATCTTACAATAATTTACGCCTTATAGCACCTTTTCTTTGCCTTCTAGCTTTATTTTTCGCCTTAAGGCA
TTACTTCTAAGAGCGTTAGCATTGCGCTGCGTTTTATTTATTTCTTAACTAATATTTAGTTAATTTAGGCTTTATAAGGC
TATAAATTCACCTTAGGTGCTAATATTTAGCATTATTTTTTATTCTTATAATTTTATACTACGATTAACCTCTATTAAGA
CCTTTAAATCAAAGGCAGCTAGTTATTAAATTATAATAGTAAGCTAGAATTTTTTTTAAAGCTTAAAGTAAGGCAAGGTT
TAGTAGATTAGACTGCTTAGTATATTAAGCACCTTTATTTAAATTAGCTAGTAAAAGGCAATCTTTTTAACTTTAATTAA
TTAATAGCTACTAAAGAGACTAGTATTGCCTTAACTGATAATCCTTTAGTAGAAACATTTTATTTTAAACCTTAAACGCT
TGTTAGACGTCTTTTTAAAGCATTAAATTTGCCTTTTAATAGTAAAAGGCTTAACTAAACTATTAACTTTATTTTAAAAG
ATTCTAAAAGTAAGCCTAAATCTAAGAATAAACTAAATGTTTAGTATCTTTAAGCTTAATAGTAGTAGTAATAATAGTAT
TAATATTAATAAGTGTTAAGCATTGGAATCCGCCACACTGTGGCCCTTCCGCCCCACTTGGCCGTACGGGCCTGTAATTG
GTCAGAAGGCACAAAAGCGGGGCCTGACACTAGTATTAATACGGATCCCCAGAAGGGTCGCGATGTATCTATTTCTTCCT
TAGTACACAACACTTCTTCGCCCACACTAGACCCTATTCAGCCTCCTGCTCCTCACAGTGCATCACGTTATATGACCGCT
ACGTATAGCCTCCTTTAACCTTTACAATAAGCTATACTCTTTAAACCCTTATTAATAGCTAGTATAGTAAGTATTTAAGT
GTTAAAGTAATATAAGGGTTTGTGTGCAATATATAGTTATAAAGGCTTAAACATGCTTATACTATTATATTAAGACTTTA
ACTTAACAAACTATAAAAGACTAGTAAGCAAGAGCCTGCTATCTAATTTATACGTAAATAGAGGGTGCGCAATAGCGCAA
CCCTAAGCAGGTGTAGCATAGCTAAGTAGCTATACTCTGCCCTGTTTACGTATTAAGATAGTTTGTTAAGTCTAACGCTT
AGTAAGCGGTAGGTCGCCAAACTAGTGCGTAGGGCACGTATGTAGAATACTTTTATACTATCCCTTCTCTTTTAAAGTAA
CGCCTTTAATAGTAAAAGGTATATACGTAGCAACTGCTTGCTTATTAAAAAACCTTCTTTAGTAAGTTAAGAAAAAGAGT
TAAGTATGCTAGGGTATTAGCTGTTGCTAAACGGTCGCAGACTGCTTGTTATATAACTGCATTCTTATATTATAGAAGCG
TATATATACTACTTAGGATATAGTAAAAGTAATTGCTAAATTTAATTAAGTATAAAGTCTATCTTATAAAGGCGCTTTTT
AAAAGGTATAATAATAAGATTTTAATTATAAGATACTTAAGTTGCTGCTAATAAAGGTGTTATAAGAAGGGTAGCCTTAA
ATAATAGCTATATAAAGATATAGAGTATGCTAACTAGAATTAGTAGTATATAGTTAAGGTTTGTAACTTATAGTAAAGGT
AGAATAAAAGTAGTAACAGTTAAATATTACTTACTAATTATAAAACTATTATTAACTAGTTAGTAAAAGTAGTTTATTAT
TAAGATATTTTATTATTTAATAGTTAAATAATCTAGTACGCGCTTAATTAAAATAAATAGAATAAGGCTAAAGTATTTAA
CTTATAGTAAAGTAAGTAAAGGTAGTAATAGCTATTTATTGCCTACTAATTATAGAACTATTATTAACTAGTTAATAAAG
GTAGTTTACTACTAAGATATATTTTTACTTATTTTTAAATAAGGTAGTATATACTAATTAAAAATAGCTATATAAAGTTA
AGGTATTTAACTAATAGTAAAGTAAAATAAAGGTAGTAATAGCTGTTTATTGCTTATTAATTATAAAACTATTATTAACT
AATTAATAAAGGTAGTTTACTACTAAAAGATTTTTTTATTTAAGTTTTAAACGTTTTTTTACCTTACTATTAGAGTAAAG
TTAATACGTTTTTAAGACGCGTTTAAACGTTTAGTTTTATAGTCTTTTTATTACTTTAAAGTATAAAAAGATTAAATAAT
TCTTATAATTTAAAATAAACTTTACTTAATTTTATAAAACTACTTTTACTTTTTAGCCTTTTTTTTAATCTTACTTAGTA
GTAAGTTAATATAACTATTTATATAATAAAGTAGTAACTAGCTAATAATTATTTATAAAATAATAGTAAACTAAAGTTGC
TTTTTTAAGTCTTTATAAACTTTCTAGTAAACGTAAATCTTATAAAATACTTAGCATAAGCATACGCGTTATCCTTTAAT
AGTATAGGTTCTTAACTATATAGCATTTGCTAAGTAATAGCTAACTTATTAATAGTCTCTATACCTTAACTATATATTAA
AAACATACTTAAATATTTATTATAAGTTTATATAGTAATCTTAAAGAACCGAAGGCGCTACTTCAGTTATAAAACTAATA
ATATATTATAGCTTCTTTAAAGTATATTAATTCTTATATACTAGTAAGCAACTACAAACTAGTAATTTTTAAAAAGCTTA
AAAGCTTAGCTAAGTATATTTAGTAGTTTTATATAAATATAAATAAGCTTATTTTTCTTTAAAGTAAGATAGTTAATAGC
ATTATAGTAACGCTAGTAGATTATATAGTAATAATATAGTAGTTACTAGCACTAATAGTAATAACTAAAAAGCCTAGCTA
TACTTTATAAGAGAAGAAGCTAGATTTACTAGCAACTAACTAGCAATCTTGCTATAAATGCTTTAAGATAGCGTAGTAGG
CTATACTATAGCTTAATATTCTTTACTAGTTTTAGTAAAAGCTAAAGCTAACTTTAATAGCTACTTAATAGTTAGTAAAG
ATATCTAGCTTTTACTACTTACGTCTTTAAACGCTAGCACGCTTTCTTAAGTATAAATTTAGGTTACTACTACTTTATAA
GTAATAGCAAGTCTCTTTAGCTTTATTACTAAGTTATTGCTAACTTATTACTTAAGCTAATATTTATTTTATTTTATTTT
ATTATATTATTTATAAAATAATATAATATAGCTATCAAAGCTAGCTATGCTAGCATGCTTTATTTTATACTAAGGGTAAA
AGACTTGCTTAAATAAAGTACTTTATAGACTATAAAGGCTTTAGCTATACTAGCTTAGGCTAACTAGGTAGTGTTCTTTT
CTTAACTTTTACTTTTAGTAGCGCCTAGTAAGTAATACGCTTACGCCTAATTTTTAACCTTAGCTAAGCGCTAGTAAGGC
GCTAAGACCATTCTTAGTGTTATAGCTAGTAATAGTAAGGTAGTAGTAGTAGCTAGTAGTAGTAGCATAGCTACGTCTAG
TAAAAAGGTATAGGTAAGTAGCTAGTTAACGCTTAGCAAAGCTTATATACTAGCTAGTAAAGGATAAAGATAATAATAAT
AAAGAAGAAATGAGGTTATTTATAAAAAAGAATAGTAATAAGTAGCTAGCAGCTAAGTATTAGCTAGCTAATCTTAAGTT
TTAAGTTTATAGCTTAAAAAGGCACCTTTTAAGTTAAATAGTTAGTTTATAGTATATACTTATATAAAATAAAAGGAGTA
ACTATTTAATAGTTAGCTTATATATAGCTAACTATTATTTTATAATCTTTTTATTTCTTATAAGTATGTTCTATAGTTTT
TTAGTAAGACTATAATTTATAGCTAGTATACGTTAAGTGCTCTTTTAGTTCTTAGGTATTATACTTAGCTAGCTATCCTT
TCTATTTTATTAAAAAATAAGTTTATAACCCTTTACTAAAGTAAGTTATAATATCTTTAAGCTTATATTCCTTCTAGTTT
TTTACTTTTTCTAAAAATAAAAGTTCTTTCTTTTTCTTTACTATAGTAGTTTATAGTTTTAAGTAAGAGACGTAAAAGAC
GTTATATTAGTAAGCGTACTATAATAGTAAGGCAACTTTATATATAATTAGCCTTAGCTTTTTTATAATATAGATATATA
AAAAGGTTAAGTTAAGCTTTTTTAAGCCTACTAGGTTTAAGTGCTTTATTAATGACCTTATAAATTTGCCTTTAATAAAT
TTGTTATATAAGTATTGCTTATTATAGCCCTTCTTTTATTAGTAAATTGCTTTTTCCTATAGTATTTTTAGCTTTTACTT
AATAGCTTATAGCTAACTAATATACTTTTATATGCCTTTAACTATTACCTTAGTAAAAAGAAAAATGTTTATAAAATGAA
GGTAGTATATATATAACGTATAGAATAAAGACGTGCTTATTATAGTATAGTAAGCATTATTATATACAAACTTTATAATA
CTTAATACTTATATTTATTAATATTATAAGCAACTATAGAACGTTTATAAATATTACTTTAAAGTTTAATTTAAAATCTT
TATGCTACTATCTATTTAAAGGTAGTATACTATAGATATTATTAGCTAGACCTTTTAAAGGCTTATTAGTTCTTACTAAA
ATTAGCTAGTAAATAAGCTATCCTTATTACTAAACAATTACCTTTAAGATATTAAACTTAGTCTTTATATAGTTATAAAT
AAGTTAAGCAACCTTAGCAACTATAACTATTATTTAAGTAAGAATAAATATACTATACTTTATATAATAGTTAACTATTA
CTAAGATAGCATTATATAAGCAGCTATCTAAACTTAAACTAAAACTAAGGCTAGTTATAAAGTTTATACTATTATGCTAG
AATAGTTAAAAAGGCATTAAGAGGGACTAAAGGTATTTATATAGCTTATACTACAAGACTTTATTGCTTATATATAATAA
GTAGTTAGTAATAAATGCGCAAACGTTTATAGCTATGTTTAGCTAGTAGTATCTCTTGGTAAGAAGTTTTATAGTCTTAT
AAACTCTTATATAGCTAGCTATAAGAGAGTTATAGTATAAGCTAATTAGCTTAGCTTATAGCTTATTTACTAAAGGAATA
ATAATATAATTCTTATAAAATAAAGTATTACTATTTACTAAATAGTAAGAGTTATTCCTTTAGCTTTATTTAGCCTTTAT
ATATACGTTATCTAGTAATTAGTCTTTACTTTGAGCTTTATATATAGCGTTATAAAGTTTAAAAGAGTATTAAGGTTATA
ACAGCTATTCCTAGCTAGTAATAACCTATGCCTTTTATACTAAATAGTAATAAGGCCTTAGGCTTAAAGAGCCTTAATAA
CTAGTCTATAATCTATAGCTTACTAAGAAGTAAGTAAAGAATGTTATTATATTTAATATTACCTTATATATAGTCTAGTT
ACTAAGATAGCTTATTAGCTAAGTTAGTAGCCCTTAAGCAGTGTTTAATTTTAAAGTTAAATACTAAAAGGCAAAACACT
TATTTAATAATTTAGTTTTAAAGATGTTTTACTAATACCTTAACAACGCCCTTTAACGCCTAGTGGTTAGTTAATATAAA
GTTCTTTAAACATTTTAAATAGTAACGCTAGTACTCTAAACTTTTAATAATTACTAAGAGCTTTTATTAACCTACTTTTT
ATTATATATTATAGTTTGTTAGCTTTTATAAGTAGTATATAATTAGTTACTACTTACTATTTACTAACTAAGATATAATG
TTAAAGATAGTATAACCTAATATATTTGTTTCTACTTAAAATGGTTTTATATTATTATAATAGTAAAGAATTATTACTAT
TATAAAGGCTATCTTTAGTAATTTAAAAGCAGCTTTTACTTTTTTAGTTTATATATAAAAGGTTGCGTAGTAATAGCTTC
ACGTTTACGCGGCTAACTAAGGATAGTATTAGTTAACTTTATTAAAGCTTATATAATATATAAGTAGTAAGAGATAAAAC
GTTTATTAAAGTTTATAAATCCTAAGAAAGATTAAACGTCTTATATACACTTAAAGACCTTCTAGTCTATAATAGCTATA
ACTTAGTTTAGTTTTATAGCTAACTGTAACGCCGCCCTAGGAAGGGGACCGACGCAGGCTACGCGCAAGCCGTACGCAGT
ATGCGCACAGCGTATTAGATGCACATCGTGGACTAGAAGCGGTGCTTGTGGCGCAGGCTGCGTGGCGTAGTACTAGCGCA
CAGGCCACAGCACGTGCTAGCGTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGACGGCGACCCTACTTTACTTA
CTTAGTCTTATGTCGCTAGCACGTGCTATAGCCTGTGCGCAGACTGCGCCACGTAGCCTACGCTATAAGCACCGCTTCTA
GTTTACAATGTGCATCTAATACGCTGTGCGCATACTGCGTACGGCTTGCGCGTAGCCTGCGTCGGTCCCCTCCCTAGGGC
GGCGTTACAATTGCTCCCCTTTTATGCCTAACTCCCCTAAGGCAAGTCTTAACGAAAGGCTTGCAACCTTTGTTCCTGGT
GGTGGTGGTGCTTGTCCGTTTGCGGCGGCCCCTTTGTGCTTGCTAAGATCGCTGTTAAAGGCGACTTAAGGCGCCTTTAG
TTCTCTTTATTTAAGAGGTTAGTCCCGTAGTTAAATTAGATTATTGTAGGGTCTGGCATCCGGTCACTTCTTCTAGAAAC
AACAAATTCGTCTTCTAGCAGCAACATAGCTGCTCTTAATTCTAACGTTCCTGTGCCTGCGGTAAGCGCCTCTGGCGCTC
TAGTACTCGCTGCGGCCCCGGCCCTTGCTCCTCGACACCCTTTGCCCTTTGGCCAAGGTGCTGGTTCCGGCCGCGCGCAA
CGTGCGCGCGGGGCTTACGCTGGCACAGTTCGTTGTTCGGCGCGGACTGCGGCGCGCGCCGTGCCTTCGGTTAGGCCTTC
GGTGGCCCGTTAAGGTGCGGGAGCTGCCCTTGCTGGTCCGGCGCTTTTAGGGTTGGTGGCGGCTACGCTACTAGCTTACT
CCTAGGTTGCCTTAGACGGCTTGTCGTGCGTGCAGTGCTTACACCGCTTTCTAACAACTTTTCTTATAGAGTTGCCTAGG
TTTGCAGCCGTGCTGTGTATTTATAGCGTTGCTAGCGCTAAGCGCTGCGATGGCTGCCGTGCTAGCAAGCATAAGTGTTG
TAGGGTAAGTTTCTTTTAGTGGCTATAGGCTGCTCTAGTGGCTAATAGAATGTAGGTTTTCCTGCTAATAGTTAGCAACT
AGGCCGACTTTAAGATAGTGCTGCGTAGCCTTAATAAGAAGCTTTATAGCTAGGGTTTGCTTATAGTGTGCGCGGCACTT
GCGCGTGCTATAAGTGCTTTTATTACTACCTTATTATAGATAGATAAGTAGTAGCGGCCTACGTTGCTAAGGGTGTTATT
AGCCGCTAACGTTACGTAGGTAGAGCTTAATCTTTACTAGAGCATTAAGGCTTAAGAGAAGGCTTAAAAGGTAGCTTGCT
AAGTAGAGGCCTAGCAAGCTTTATTAGCCTAAATGCACTTGCTATTACTATATACGCCTCTTTTATCTTTGCCGCCTAGG
CTTGCTGCTTTAACCCTTTAGTAACTTTTTTAGCTACCGTGCCTAATGCTTAGTAACACTAGTTATGCCGCCTTTACTAT
AGCCTTTAATGCCTTTCTTAAGGTAGTAGTAAAGGTGTATATTATAAATAAGGCTTATACTAGGGTAGCAGCCGGCGTAG
CGTTGCTTTAAGGGCTTTTTAGATAGTTTTGCGTAGTCTTTTATAAGGCTTTTTAGCTAGTTAAATTAATTTAAGCTTTT
GCTTATATATTTTTGTTTTTACGCGCTTGCTGCGCGTATACTACTTAATTGCTGCGTACGCATTTTCTATATTTTCTTCT
AGCACTTACTAGTTATATTTAGTTAGCTAGCTTGTTTAATATACTAGGTATTTAGTTTAGCTAGCCTTGCGTCTTTTATC
TAAGACTATTTTTACTTTTTATTTATTATTTAGGTTTTATAACGCTAGCATTATTAAAGGCGCTTGTTTTATGCTTTCTT
TGCTTTTTTAGTGCTTTAATAGCAAGACTAAGAAAACGTTATATAGTTAGCTATATTGTTTTAGTAGTACTAGTTAATAT
GCTTATTTGCTTATAGTCTTAAGGATTTTAAAAAGCTTAATACGTTTTAGTACTAACTTTTTATTTTTTAAGTAAAGATT
TTTTATAGAAAAGCTTATTAGCTCTTTTACTATAAAGCTTATAGGCTAGTAGCGCGCATTATAGTAACGCTTCTAGCGCT
TTATTGCGTGCTTTTAGTTTGCTGCTAACCTTTTTTATATAGCTTTTAGTTTTTCTAAGCGGTTATACACTACTAGGACT
ATATTGCATATATCTTGCTTTTTTCTTATAGTTGCGCCGCCTTTAAGGCAAGTTTGTAAGTTTAGTTTCTAACTATATAA
TGCTTTAAATAAGCTAATTTTAGTTATTATGTTAATAGCGTTGTTATAAGCATATTGCGCTAAAAACAACAAAGAAGGCT
AATTTAATTGCTTTTTTGTTATAAAGTAGTGTAAGTACTACTTTAACGTTTAGTTAGATCTTTTTGTTTGCTTGTCTATT
TAAAGGTAAAATGCAGTTAATAGCTGCTTATAGATTTTAGTTTAATAGCAATATTTACTTTAGAATTTGCTAGTAAATAT
ACTTTCTTAGTTAGAGACTATACTCTCTAGTATTATGCTGTACACTAGTTTTATATATTAGTGCATAAGGTATGTAAGGC
CTTTAGCTGTTAGGGTAGTCTATATAGTAAAGAAAAGGTTTATCTTTGTAAAGTAGTTAACAATTACTAGAATTATATTT
ACTTTGCTACTTATGCTTGCTTTAGCTACTAGTAGCCTAGTAATTAAGTTTATAAAGATTTCTTGCTGAGGACTTTGTAG
TAGCGGTAGTAGGTTTAGTTTACTATATTGCACGTGCTATTTAATTATCTATCTTTAACAGACTAAGCACAAAGCAATAT
AAGCCTTTATATTCTTTTTTATTTCTTCTTAGTAAAAGTAGCAATAAAGTAGTTCTAAGGTCCTAGCAACTGTAAAGTGC
CTAGAGATCTAGTTGTTATAATAGAGCTATAGCAGCTCTTAACGAAGGATATACGCGCCGCCTATATGCAGGCGGTTTTT
TTATAGTAATATACTATCTAGTGTAAGGCTTTATAGCTTTGTCGTACCTTCTACGCTTATAGTGCGCTCTACACACGCCT
TAACGACTTGCACCTTTAGGTTTGCGTTCTAGATTCCTACTATTGCTTTGCGAATAGCTTTAAAGACTTTGTTTTTTTAG
AGGTGTAGATGTAAGGCAGTAACGACAGCTAGTTGCTGTAGTAGGCTAGAGTACACTAGGTTCTTATCTGCGCCTGTTAA
GGGCGTTAGACCTTTAATTAGCGCTGTAGCAATAATATTCTTAAGGTTTTCTTAAGGTTTTTTGTAGTTATTTAGCCTTT
CTAGTTTACTACGCTTTGCTTGCTTAGGCGGTGCGCTGTTTTGCGCTGCGGTAGCTTGCCGCGTAAAATCTAAGGCTACT
AAGATCTTAAAGGTAGCGCTTAGCTTCTCTTCTTTGCTAGGTCTTTTTGCAGGTGCGCGCATTTTACGCGTCTTATTCGT
ATAAGCTGCGTTGGTGACTAGCTTAACGTTGTTATCTTTTATAATAGGTGCGCGCATCTTGCATGTCTCTTGCGCTATAG
CTGCGGTGCTTGTTAACTATGCGTCTTTTTTTTGTACCCTAGTGATAGTTATTCTAACTTGTCTAGGTTTATTAAAGTAA
TCTAGCCGTCTTAACGGCGCATTGGCCGGGTTTGTTATGCCTAGTCTATGCTTAATTATAAAGTTAAAGGAGAATAGGTA
TATAGCCTAGCAAGCCTTGCGTTCGTTATACTTTAGCTAGGTTATAAAGGTGCGTAAGTTGTTATAGTCTAATAAGACTT
TAATTGTCTCTTTGCTGCTATTAAGGTAGTGTTGCTATTGCTTAAAAGAGTTTACAATTGCTAGTAGCTCATAATCTAGG
GTGCTATAATTTAGCTCTAGTTCTTATAGTTTTCTTAACTAAAAGGCAATTAAGTGCTAAGCTCTTTCTTTGTTTTGTTA
AGAGATAATCTTGCTAATAGCTACCTTTAAGGCATTAGTCTCTACGCGTATTGCTTGTTCTAGGTTAAAATGGCGTAGCA
AAGGTGCTTTTATAAATGCTTTCCTTAGTATTGCAAAGGCTGCGCGCTCCTTGCTCCTTAGCTGCACTAGTCCTGGCTTT
TTGCCATTTTTGCTGCCTTATAGCAGCCTTAACAAAGAAGACAAGATGTCTAAGTAAGCTTTAATAAAGCAACGATAAAA
GTTGCAGAATTTAAGAAAGACTTGCACCTTCTTAAATGTTTGTAGCGTTGGCTATTCTGCGATTGCGCGTACTTTGCGCA
GGTTTATTACAAACTCTTTGCTTTTAATAATAAACCTTAGGAATTTAACTTTTTGTTGGTAAAACAAGCATTTGTTGCTG
TTAATAAATAACTACGCTTGCTAAAAACGCTTAAAGACCTAGTCTAGGTGCTTTGTATGCTTCTTCTTATTGCGCAAGAA
TACAAAGATATTGTTTAAGTAAACAATATAGATTATATCTACTAGACTATGTAGCGCTTGGCTAATATAGTACTAGAAGG
TTGCTAGGGCGTTGGTTAGCTAAAAAAGTAGAACTAGGTATTTAAAGAGACTATATTTAGTCCGAAAAGCCGTCTTTTAT
TCGTCTTTTTCTTTAATCCTTAGGCGGTAATATACCTTTTTAATGTTAATTTTTAACATTACCTTTATTCTTACTACGTA
GTCTATAATCTTAAAGATTAAGGGTAGCGAGTATTAGTTCTTTACTATAACCTTATTCAACCCTTTATAGTTAACGCATA
AGCGTAAGCTTTTGTCCTTCTTAGGCACAAAAAAGATAGGTGCGCCTGCAAAGCTTTTCGATAGGCGAATTCATCCTATC
GCTAGGTTATTGTCTAAGTACTAGCGTAGCTCTCTTAATTCTTTTTGCGACAAAGAATATATTGTCCTATATAGTAGTTA
ACCGCTAGGTAGAAAATTAATTGCATAGTTAGTAGCCTTGTATAGCGGTAAGACCTTAGCGCTAGATAAATTTAGCACGT
TGCTATATTTGCGCGCTAAATACGCGGGCAGTGCGCCTATGCCTCTTAAATAACCTTTTACTTTTAGGTTGCCTAGTAAG
ATTATATATACTTGTGCGCGCTCTTTGCGCGTTATAGCAAGGAAGATTTCTTATAGTATAAGTCGCATAGTCTTTATGCG
TGCTTCGAACTACTAGAGGCGGTTTGCTAGCTTTAGGTAAACTTTCTTACTTTAGAGGGTTATTATTAATAGTAATATTA
TTAGGCCTTAATACCTAGCAGGTTTAATAACTTTTGCATAAACTTGTGTAATTTTACAAGTGTACTTGCAAGAGTCTCTT
ATACGCAAAGGCACCTTCTACGCTCTTGCTACGCTTATAATGCTTTTGTTATACGCTTTAAAGGTTAGTACTAACATTTT
TGTAGATTCTAGTCTTTGTAGTCTTGCGAATTTGTAGTTAATAGTATTAAAACTTGCGTAAGTATTTTACGCAGCGAATA
CTTTTGTAGTTGTTAGTTTAAAAAGAGAAGCTTAGATAAGAAAAGGATTACTAATCTTAATTGTCTTTAGTAACGCCTAA
AGGTCTTAGTTTGTTCTAGGCGTTTTTAGTTTTTTACCTTTTTAGCATTCTTTTTAGTTAGTTAAACTAAATTTACTAAT
GTAGTCTTCTGCCTTTTTAGGCAGTTTTAGGCAAAGTAGCCTTTGCTTTTATAGATAAAGCACTTTATACGCTTACTATT
TATATAAGTAAGGTTCTTTTAGTAGCTCTTAGTAGCTGTAGCGGCTAGTCTGCCTCTCTTTTTGCTTTAGCCTTTGCCTT
TAGCACTACCGTAGTAGTTGCTGCGATTGTTTTCTTAATTAGTGTTATTTTTATAGCTGCCTTTATAGCCTCTTTGATTC
TTTTACGCTTTTTTACTGCGCGTGCTATTGTTGTTTTGTTTTAACCGAGCTTTTAGCTTTTTTAAGCTTTAAAACGTTAT
TGCTCTAGCTATTAGTTTTGCTTTAGTCTATAGTATCTTATTTAATTTTAAGAGATTTAATTTTAATTCTAAGAGTAGCT
TAAAGAATAGCAACTACGCTTATTTCTCTTCTAATTTAATAAGCAGTTAGTTTTTAAAGAAGGTAAGGTAGTTATTAAAG
TCTTAAAGGGTTTGCCTTAATCTTTACTAAGCCTTGCCGATTCTATTAATAATAATAAAAGCTATATTATAAGGATTAGC
TATAAGGGTTAAGATCTAAGCTTTAAATGCATCTTAGTTGCTTTAGGCTTTTGCTACTACTATGTTTATTATGCTTTGCA
GGCGCGTTTCTTATATAGTGCAGCATAATTGCTCTATATATTCAAGCATATAATTAATCTAGTAACTAGCGCTTCTAAAC
TTATTAAGAGCTAGATAAAAGTGTTGCTTTCTAGCTTATAGCTAGGTAGCGCGCTCTTAGAAGCTGCTAGGTGTCTTAAA
GAGCGGTTTAATGCTGCTTTTTAAGATAATATTTTAACTGCAAGAGCTATCTTTGTTAGAGTCTTTGCTGCAAGTGCGCT
TACTTTTTGCTTAGGTTGCTCCTATATTTAAGAGCTGTTGCTATAGGTTTACTATTTGCTGCTTTAAGCGCTTTGCTTTA
TGCAGTCAATTATTTTTAGCAATAAGGTCTGCTACTATCTAGTTTATAGTAGGCCTAATAGTCTGCCTTAAAGGGCCTTT
GCTTGTATTATTGTTATTTAGTTGCTTATAATCCTTCTTTAAGAGATTAGAGTCTTTGTTCTCTACTTCTTCGATGATAA
GGTTAAGGGGGTTTTTAACTATTGCCCTAAAGCTGCTCTCTTCTTGCGCACTACGTGCGTGCGACGTTTGCTTTGTAGTC
TTTCAAGGTGCTATTGCTCTTTCTGCCTCCTAACTTAGGTAGCTTAATGGTAGAAGAATTAGGAATTGTTAAAGGTGTAC
TTAGGTAGGCTAGGTAAGTTAGGCAGGCAAGGAGGTATCTTCTTAATAGGAGGAAGCAGCTGTATATTTAATAGCTAATT
CTTGCCTTCTGCACTCTAAGGGAGTGCGGGAGGCACTCTTTATTATAGGCGCACCTTTGGCGCACTAAGTGCGCAGGATA
GGCGCGACCTTGTTTCTACTTAGCCTATGCGCTAGCACGTGCTGTGGCCTGTGCGCAGACTACGCTACGCAGCCTGCGCT
ACTAGCACCGCTTCTAGTTTACGATGTGTATCTAATACGCTGTGCGCATACTGTGTACGGCTTGCGCGTAGCCTGCGTCG
GTCCTTTTCTTAGGGCGGCGTTATACTTTTATTCTTTAACTTTTTTTTTATAAGGAGCAATGTTTTATTATAAGGCAGCT
ACTTTATAATCTATATATAAATTATTTAGAGTAAAGAATATACTAATGCTACTCTTTACGCTAATATATAGTAGCTATAC
TTTGTGTATAACGTTTATAGTTACCTTAACCTTATTTATTAAATTAAATATAAAACTAGTATATATACTACTTAATAATA
CTTTATATAAAAGGATTAACTAAAGTATAGAATGCTAGCACAAATTAGTAATAATTTAGGCAAGCTTGTAGAATAAAGTT
TATACAGGCCGCGCAAGGCTTAGCGGGGCCGGAGTAAGGCGTTTAGCAAGTCTTGCCTAGTAGTAGGAAAAAGTATTGCC
GAGCCCCGCTAAGAGCGCTAAGCTGGATTTGGCAACCTACGGCGAATAAGAGAAATAACGCTTAGCAAGCTTTGCCGAGC
GCCCTAGAGCGTTCTGCCACGCTAGACCGCTATTGCAGCATATATATATTTTGTAAGCGCTTACTAGTAACGAATTTAAA
AGAAGTAAGACAAAGTCTTACTTTTACCCCTTTCTACACCTTTTATCTTGCCTTTTATCCTGCTATAAATTGTATGCCTT
AGGTAATACCTATTATAATTCTTTATCTTTCTATACTCTTTAGGTCTTATAGTCTGTTATAATAGTAGGAGGAAAGAGAG
TAGCGCGCGCAACCCTTATACTAAGGCTCTTTGCTAGCGAATTGTTAGCTAGCGCTATAGCCGCAGTTTTAATAGCGGCT
AGCAAGGCAGAGCATAAGGAAGTAGGCTTATTAACAAGGATAATAGCCTTTAATATAAATCTTAATAAGGCTCTCTTGCA
AGACACGCGTAGCGTAACTTTAGCTACTAAGAATTCCTTAAAGGACTTAGGCATTAATCTATTAACTTACTTTAATAACT
AGCTTAAGGAATTAATAAGGGTGCTACTAACGATTATAAAAAGATTTATAAGACTACCTATCCTAGCTATAATAAAGACG
GCGCCTTAAGAGGATAATGCGCGTGCACTAACCTATACAGTCTAAGTCCTTAATAGTAAAGCTATAGTAGTAAAGATTAA
GGATTAGATTTAAGGCGTAAAAGCTATAAATAATAACCGACTAAACGCATTTGTGTTAAAGGTGTACTTAGGTAGGCTAG
GTAAGTTAGGCAGGCAAGGAGGTATCTTCTTAATAGGAGGGAGTAGCTGTATATTCAATAGCTAATTCTTGTCTTCTGCA
CTCTAAGGGAGTGCGGGAGGCGCTCTTTATTGTAGGCGCACCTTTAGCGTACTAAGTGCGCACCTTTTAACGCTAGTTAA
CGCTAAAGGCAAATTATACACTACTATAATTTTATACTATACTATTAAACATAGCAAGTTAATAGTACTAATTTTACTTT
TCTTTAGTAGGATAGTACTATTTAGTATTTATATTAATACTACTAACTCTTTTTAAAAGTTTAGTTAGATCTAAAAGGTA
ACTTTTAAATAATTAGTAAAAGACGCTATATATAAAGAGTAGTTGCTTATAGCTTATATATTACTAGTGTACTTTAGCCT
TAACATTTTTATAATCTAAGTTATAAATATCTATTTATTAAAAGAACTTATAGTAAACTTCTTTATTAAAAAGAATGCTA
TAAACTAGAATACCTTGCTACTTCTAGCTTGCTTTACTAACTTTATAGATATTGTATCCTTAGTAGCCGCAAAAACCCTA
CTAGTACTATAAGGCGCAAAACATGCTATTAATCTTATACTAGACAAGCAGCCTCTTTATAAGCCTATTTATCTCTTTTT
AACAACCTAACTTTGCAAGTTATAGGAATATATTAAAGAAAACTTGCGTAATAGACATATCTAGCACTTTACTAGCCTAG
CTAGCGCGCTAATCCTATTTATCCCTAAGAAAGATAAAATACTATAGCTTTATATAGACTATTAAGGCCTTAACTAAGTA
ACGCGTAAGAACTGCTACCTGCTACTACTTATTAAAAAACTAATAGACTAGCTTATAGGCGCTATAGTATATTTAAAAAT
AGATCTTAAGGACGCATACTACTATATCCGCATTAAGGAGACTAACTAGTAAAAGACTACTTTTTATACTTACTATAGCT
ATTTTAAATATATAGTTATACTATTTAAGTTAACTAACGCGCTAGCAATGTTCTAAGCATATATCTATAAGGCTCTTTTT
AATCTCTTAGGCATCTATTATATTGTCTATATTAATAATATACTAATCTACTTTAACTTTAAGAAAGAGCACTAGTAGCA
TCTTTACTAAGTGTATAAGCGCCTTTAGGCAGCCTAGCGTTTTACTAATCCTAAGAAGTGTAAGTTTTTCTAGACCTAAG
TTAATTTTTTAGGATATATAATTAGTATAAAAGGCATTAGTATAGACCTAAACTAAGTTTACTTAATTAAGAAATAGCCT
ACGCTAAGTTCTTACTAAGATGTATAGGTTATCTTTAGTTTTACTAACTTTTACTACTATTTTATTAAAAAGTATTCCTA
TGTTATTGCCTTACTTACTAGCTTGCTTAAAGGCGGCACTAATAAGAGAAAATTAAACTTATTTAACTAAAGTAAGAAAT
AAGATTACGCGTTTAAGTAGCTAAAAGATGCATTTTAATTAGCTACTATACTCTATTACTAAGACCTAAGTAAGGCCACC
TATATAGAAATAGACGCATCTAAGTTTGCCGTCTTTAGGATTCTTACTTAGATAGTTAACGGTTAATAGCGCCTTATAGC
TTACTAGTCTTATAAGCTAACCAATATAAAAACCTAATAAGCTATAAGTTAGTAAGAGCTTTTAGCTATTATAAAGAGTT
TAAAGCACTAAAGGCACTATTTAATAGGCACGCTAAAGCTATTTTTAGTATTAATAGATTACTAGGCGTTAATAAAGGTA
TTAAAATTACTTATAAAAGACCTTAACAGTTAGCTTGCTAGATAGGTATACTATTTATTAACATTTAACTTTACTATAGA
ATACTAGCTAAAAGTCTTAAACCTAGCTAACAGCCTCTTCTATCGTCTTAATTATGCAGCTAAGACTATACTAGACTTAG
ACATCCTACCTACGCTATAAAAGAAACTAAACCTTATTATAAAACTTTTGCTAACTATGTAGGCCTAGATTGCTATACTA
CACTATATCTTTAAAGGATATAAGGTTATGCATACTATAGTTAAATAGGCTAAGTAAGTAATTTAGGATTAGCTAATAAC
TATTAATATAGTTACTAGAAAGAAGTATAGCAAGCCTTAAAAAACTAACTTAAGCAGTAAAGAGTAAAAGAGTAATAAGC
CTAGCAATCCCTTATAGCCTACACTAACTATACTAGCGCTAGTAATATAAGAGCTTCTTTAAGAAGAATCATTATAGCTA
AGCACCCTAGACACAAACCTCCTCTACGTTGTTATACTCTTATAAGTTTTAGATAAGGCGCTTTATAATATGATTACTAA
AGTCTAGCAACAAGGTAGCGCCTATAAAGAGTACTTACTTAATAAAGATAGCACTTTATTTATTAAAGGGCGTCTAGTTA
TTATAGAAAACAAGGCACTATAGAATAAGCTCTTTTATATCTATTATAACAACCCTTAAGCAAGGTATATAAAGAATAAT
AAGACTCTTAAGCTAATTAATTAAAAGTTTTATTAAAATTGTATTACTAATACTATCTTTATATATATAGGATTATATTA
AATTTATTAAAGCATTTAAAGGCTTTATTACTAGCCTTATAAGGAACTATAGTTATTGCTCTTACTATAGCACTTATTTA
AGGAAATTAGCATAGACTTTATTACTAGCCTCTTACTAACAAAAAGTATAGACAGCTATATGCAAACTTACGTCTTAGTA
ATTATAGACTACGTTATAAAGCTTACTCTGTTTATTCTAATATATAATACATTAATAATAGCTAAAGTAGCAGCACTACT
ATATAAGTATATAAAAGTTTATTTTAGTATACTAGTAAGTATTATAAGTAATTAAGATAAGCTATTTATAAGCTAGTTTT
AAGAAGAACTCACTAAGGTAAAAGCTATTAAGCAACAAATAGCTATAGCATACTACCCTTAGATAGATAGTTAAACAAAA
CGCACTAACTAGACAATTAAGAAACAACTTTAAGCCTACTATAATAACTACCCTAACATTTACAATAAGGCCTTTTAAAA
GGCTAAGTTTGTATATAATAATAGCCGCTACTTCTTTACTAAAGTCTTACTATTTATAGCTCTATATAGTTTCTACTCTT
AAATAATTAGCTATATAGCACCCTGCTACAAAAAGGAAGCGGTTAAAGAAAATAAAAGATATGCAAAAAAGCATGCATAA
GTATTAAGAACAAGCTACTGCCTCTTAATCTAAGCACTATAATAAGCAGCACTAGCTTAAAGAATTCTAGGTAGGAAATA
TTATAAGCTTAGCTATAAAAAACTTTTGTTTCTAAACAAGTAAGAAGATTGCGCCTATATTTATCTAGGTAAGAATCTAA
GAAAGAATTAGAAAGCAAGCGTACTAAGTAACGCTACCTACTAAGTATGCTATAATGCACAACGTATTCCTAGTGTTATT
GCTAAAACTATAAATTAACTAGCTAAGTGCGCCTAATACGTTATTACTACTAGACCAAGTAGATAGCTAAAAGGAATTTA
AGCTTAAGCAAATTATAGCCTAAAAGGTTAATAAGAAGATCACCTTTTACTTAGTAAAGTAAGTAGGCTAGCTAGTAAAA
TATAATATATAAAAACTAAAAGAGCACTTAAGTAACGTAATAGCAGCTTTATAAGCGTTCTAAAAAAAGTACAAGAAGCG
TTACGCCTATTAAGATAATAAGGTAGTTAGAATAAAACATTAATAAGCAGATTATTATTTTCTCCCTTAGTTAAAAGCAA
AGACTCTTATTTAGTTAAAAGTATAAACCTTCTTTAATTAAAAGTATATAATAAATTTAATTAAGTGTATATAAAGAAAA
GTAGTTACTTTAGTTTAAAAGAATAAAGCCCTCTATTAAGCATAGTAAGGCGCGCAATCTACCTATAGCTAAAATCCTTC
CTAGTTACTAGAATTATTCTCTTTAAGCTTTTTATAAGGAGTAAGGACTAGCGGCTAGGATTATAAGAGTAGAACGTAGC
AAGCAGTAAGCACAAAGCAGTTGAATAATAAGTCTAGCGACTAGACACTATCTACGTTAGCCTTAAGAGGTATTAGGCGT
AAGTTTTATTAGAAAGTTTAAGAGTATAAGCCTACTTACTATAGTAGTAGCAAGTAGCGCTTTAGTAAGACTTATAGCTA
AGTTAAGATATCCCTTAATAAGAGCTAGCACTAACGTAGTAGTATCTTTTAATAAGATTATAAGCAAAGTAGCAGCAACC
CTAGTAAGAATAACAACCGTAAACGTAGCAGGCTTAAGCTAAGACGCTAAAGTAACCGCTAGCATAACAGATTAAGTAGT
ATAGTATAAAGTAGCTAGCAAGTCTTAATACGTTATAAAAGGCCTAAATAAGACGCTGCTAGTAGGCGCGGTAAAGCCTA
GCGCGGCGCTAAAAGGCAAAGAGAAGAGTTTAGCTATCTAAATAAAAGCCTTTAAAAACAAACTCTAAGGAGTAACCCCT
AGGTATAAAGGTAGCTAGAAAGGCGTTACTAGTAGATAAGGCGTTATAAACGCAAACGTAAAGCCTATAAAGGCGTCTAG
CAAGACTAACCTAAACAACAGCACTAACTAAGAAGCTAATATACTAGCAGCACAAATGTCTACTAGCGTAATTAGCGTAA
AGCTACCGTATGTAGCTATGCGCCTAACACTTAGTTTAGCATTATATAAAAAAAGCCTTATAGTAAACCTTAGCTAGTAT
ACTATAGCTACTAGCGCTATATAATAATCTAGCTAACTATACTACTACTCTCTAGCTATATAAGCATTGCTTAAGGCAAG
CGCCTTACTATTAAGCAGCAAAGACTCTATAAGTTAAAGAATATGCTATAAACATAGTATTAGCTTAGAACAAGCGAAAG
CTATAGTTAGAAAAACATACTAACGCGCGCACTATAGTAAGCAGCTAAGCAATATCTAGCAAAAGTATTATTATAAAAGC
TATATATACTAAAAGCTTATTAAGTATAGTATTTAAAAGGTTTATAAGTAAAAGCGTCTACCTTAACTAATAAAACGTTA
GTAGTAAATAAAAACTATAAGATAAGTATCTAACTTATCGCTAATAAACGCTATAAAGCTAGTAAGGTTACAAATAAGTA
GGTCTATACTTGCAACTTATTTACTAAAGCTGTTAATATATAGTTTCAAAAGTATATACTTTTTAAAAGGCTACTAGTAT
AAGCGCAACTAAACGTAATTAACACTAACGCTAGATAGTAGTGCCTAGCCTTAGTAAAGAATAGTAATTAAATATAGGTT
AAGGCTATAGTAGTATTAAGGGCCTTAGATAGCTTATTTTACTAAATATACTTATACTTATATAAAGTAAAAGTATACTC
TTAAATAATAGCCGCTATACTTAATAATAAAGTAAGAATTTAAGCATTATTTAAAATTGTTAGCATAAAATAGTGTATAA
AATAAAAGAATAATAAACCTAGTAGTAAGCAGCGTTGCTAGCTAGCAAGTCTAGCAAGACTACTAGGTAAAGGCCCTCTC
TAAGTAAGAGCACTTAAAGTGTATGCTAAACTAAAAGCGCTTAAGATAAGCGCTTTGAAAGAGAGAATAGTTGTAAAAGG
ATTAACTAGAGTATAACATGCTAGCATAAATTAGTAATAGTTTAAGCAAGCTTACAAAATAAAGTATATACAGGCTGCGC
AAGGCTTAGCGGGGCTAGAGTAAGGCGTTCGGCAAGTCTTACCTAGTAGTAGGAAAAAGTATCGCCAAGCCTCGCTAAGG
GCGCTAAGCTGGATTCGGCGACCTACGGCGAATAAGCGAAATAACGCTTAGCAAGCTTTGCTAAGCGCCTTAGAGCGTTC
TGCTACGCTAGACCGCTATTGTAGCATATATGTATTTTGTAAGCGCTTGCTAGTAACGAATTTAAAAGAAGTAAGACGAA
GTCTTATTTCTACCCCCCTTTATACCTTCTATCTTGCCTTTTATCCTGCTATAAATTGTATGCCTTAGGCAATACCTATT
ATACTTTGCTAGCTAATAGGTAGCTATAAAGTAATAAATATACTTATATTATATAAACGCTAAGGGTATTAACTAGTATT
ATAGCTATAAAGGCTATAAGGCTACTACTTAGTAATTATTATTATAATAATAAGCTATTATAATATAGTATTAAGAAGCT
AGAAATTAGTGCTACTACTATTAAAGTAAAGAAGTAGTTAATAATAATAAAGAATGCTTATAATATTAATATATATAATA
ATGCGTTAAAAGATATAAAGATTATTTAAGTAAGTAGTTAGCTAGCTACTAAGTTAGCAGCTAATCAGTAAAAGCATTAT
AACTACTTTTATACTAGTAGGCGTTTAGTTATATACTTTATATAAATATACTTTATTATATTTATTTATTAAGAATACTT
AAACCTTAAATGTTAAATATTCTATATTTATAAAGAAAGCTAAATGCTTTAATAAGGTAGTAAGTTTTTAATAGTATACT
AGTAAAAGTAAGATTACTTATAATAAAAGATTTATAATACTTTTAACTAAAAAGGAAAGATTGCTTAAAAGTACTAGTAA
AGGCTAGATAACTACTTAGTAAAGTGGTACTAAAATAAGACTATTAGTAAGTTCTTTAGTATAGTAATAGTAATAAAGAT
TATAAATGCTTATAAATAGTATTAGTCTTAAGGCTAAAAGTAAAAGAAAATATAAAATAACTAAAACTAAATAGTTATAG
TTAATAACGTACTAGTTAGTAAGCTAATAAAAAATAGCGCTATAATAATAATAAAATAAAGAACTAAATTTTTATAAAAA
GTAATTAAATCTTATAACTAGTTGCTAGCTAAAGTTAGTTTACTTTCTAACCTACTAACCTTAATAGTATAATAATATTA
ATATTATATTAAAATGCTAAAATTATAGTAAAAGAGTAAGTATACCTTTTAAAAGTACTTTAAGCTTTAAGTAAAACTAA
AAGATAGTCTTTAAGAGCTTAATAACTAAAAGATAACCTATTTTAACTAAGGAAACTAGTAAGGTTAATAGAAAAGCTTT
ATTCTTTATTAACTTTATTAATATAGCTAACTAAAAATGTAATTCTTTACTGTTATACCTTAGTTAAAGCATAAACGCCT
AGCAATTACTAAGCTACTATTATTATAAACCTAGATTTTTATACTAACTTAAATATAGTCAACTTAAAGGTTATTTAATA
GCTTAGTTTAAAGCTGCTTTAGTAGTACTTATAACTTAAACTTAGTCTTTATTAATAAAAAAGTATAATAAGCTTATAGC
TTATATAAGCTAACTATTATACTAATAAAAAAGAAAGTCTTTTATATATTAATATAAGTTTTTATAGCTATTTACTAAAT
AAGCCTTAATTATAAAAGACTAAGGTTTTTAAACGTTATTATTAATACTATTTAATTAGCTTAGTTATTTACTATTATAG
TTTTTAAAACCTTTAACTAAATAAGCTAACGATTATATAACAGCAAAACGTTGTTTACTATCTACTTAATATAGTTAAAT
TTAAGTCTTTATAAACTAAACATTTTTACTATAAATAATAATATAGCTTCACTAAACCTTAGCTAGTAACTACTATTTTA
TATATAACTATTTACTAAAGTATTTAATACTAATAAGGTAAAGAAACTACTTTTATTAGAAATATAAAATACTTAATGAA
GTTAAAAGATAGTATAAAGGTGCTATATAGCTTACTTTACTTACTATCTCTTATCTAGTAAAAGAATCTTTATTACTTTA
TTAATAAGGTATTAATAAATAGGCAGATTGCTTATAGTAATAGTCTAGCTAAAGCCTTAGTAATTTTTATTTTAAAGAAG
GATAGTACTTTATATATGTATATTGACTACTAAAGTTTAAACTAAGTAATTAAAAAGAACTACTATCTCTTTTTATTAAT
TAGTAAGCTATTAAATTGCTTAAATAGTATAAAGGCATTCTTTAAGATAAATATAAAAAAAGTATACTATAAGATTTAAG
TTAAGGCTTTTAATTAGTAAAAGACTACTTTTTAAACAAAATGTAAGCTCTTTAAGATTTATATTATACTCTTTAAACTA
ACTAATGCGCTAGCTACGTTTTAAGTATACATTTACTATATACTAATAAAGCGAATAAGTATAGTCTATAAAGTATATTT
AAATAATATTTTAATTTACTCTTAAACTAAAAAGAAGTATAAAAAGCACCTTTAATTTGTTTTTAAGCAGCGAAAGGCTA
CGTAGCTATATAAAAACCTTAAGAAGTATAAATTCTTTATAAAGAAAATTAATTTATTAAGGTTTATTATTACTATAAAA
AGGCTTTTAAGTATATATAAAACGTTTAATTCTTTTTAAGATTTATAAACTTTTATAAACACTTTATTTTCTACTACTCT
TATATTATATACGCTTTAATAAAGTTAATAAAGATTGGCTGTAGCCTACTATATAAGCGTAAAGCTGTTACTATATAACT
GTTTATATTAACTAAAGAGGTAAAGGCTGTTTTTAAATTACTAAAAATAGCATTTATAATAGTAATAATTATTTACTACT
ATAATAACATAAAGCCTATATAAGTAAAAACAAATACGTTAGGCTATACTATTTTTAGCATTATCTTTTAACTTATAAAC
AGTAAATAGGAACTAGTTACTTACTACTTATATAAGCTAATAAAAGATAAGATATAATAAAGAGTAAGATAGTAAAAGCT
CTTAACTATTATTAAGAGCTTAAAGTATTAGACTATGTAAAAGGTTTAAAAAACTATTTATAGTTTTAACTAACTATTAA
GAGTTAAAAGGCGTTATTAAGATATTAGTAAAGAATTTTTAAAACTAAATTAATTAATAAGTATTTTGCCTTTTAGTATT
TAACTTTAAAATTAAGTACTACTTAAAGTCTACTAACTAAGCAAATAGTCTATCTTACTAACTAGACTATATAAAAGCTA
ATAGTATATATAATAACATACTTTCCTAACTTCTTAGCAAGCTATAGATTATAAACTAGTTATTAAAGCTCTTTATACTA
AAGGCTTTAGTACTATTTATATAAGAGGCGCAGGTTACTACTAGCTAAGAATAGCTACTATAACCTTAGTATTTCTTTAA
ACTATATATACTATTTACAATGCTTAAGGCTAAGACTAATTGCTAAACAATCTATTTATAAAAGCTAGATAAAGCTAAGA
GAATAACACTTATTATCTATTAAAAGAAAACACCTTATTTTATAAGGATTATATTATTATCTTATTTGTAAATAAGCTAT
AAAGTAAGGCTAATTAGTTTATACTATAACTGCTTTATAGTAAGCTATATAAAAGTTTATAAGACTATAAAACTCTTTAC
TAAGACGTATTACTAGCTAAATATAGTTATGAACGTTTATACGTTTATTATTAACTTTTTATTATTATAAGTAATAAGGT
CTTATAGTATAAGCTATATAAATACTTTTAGTTTTTACTTATACTTATTTAGATATTCTAGTATATTAGTATAAATCTTA
TAACTAGTTTTAAGCTAAGCTCAAGCTTAGATAGCTATTTATATAATGCTATCTTAGTAGTAGTTAATTACTATATAAAG
AATAGTATATTTATTTCTACTTAAAAGATAGTTATAGCTACTAAGGTTGCCTAACTTATTTATAACTATATAAAGACTAA
GTTTAGTATCTTAAAGATAATTATTAGTAATAAGGATAGCCTATTTACTAGTTAATTTTAGTAAGAACTAATATAACTTT
AAAGAGTTTAGCTAATAATATAAATAGTATACTACGTATAGATAAATAGTAGTACTAAGATTTTAAACTAAACCTTAAAG
CAATGTTTATAAACGTTTTATAGTTACTTATAATACTAGTAAATATAGGTATTAAGTATTATAAAATTTGCGTATAATAA
CGCTTACTATACTATAATAAGAACGTTTTTATTTTATACGTTATACATATACTATTCTTATTTTATAAACAATTTCCCTT
TTTAAAAAGCTATTGTAAAAGGCGTATAAAAGTATATTAGTTAGCTATACGCTATTAAGCAAAAGCTAGAAATGTTATAA
AAAAAAGGGATTTCTTAATAAAAGAAAAGCTATAATAAGTAATGCTTATATAAAGAATTTATTAAAGGTAAATTTATAAG
CTTATTAATAAAGTACTTAACATTAATTAGCTTAAAGAAGCTAAACTTAACCTTTTTATATATTTATATTATAAAGAAGC
TAAGCTTAGTTATATATTAAGTTACCTTATTATTATAGTACGCTTGCTACTATAATATATTTTACGTCTTTTACCTTGAA
TTATAAACTATTATATTAAAAGAAAAAGAAAAGCTTTTATTTTTATTATTTTTAAAAATAATAAAAAACTAAGAAGAATA
TAAGGTTAAAGATATTATTAAATACTTTAGTAAAGAGTTATAAACTTAGTTCTTAGTAAAATAAAAAGGCTAGCTAGCTA
AGTATAATACTTAAGAACTAAACAAGTATTTAGTATATACTAGCTATAAGTTATAGTCTTACTAAAAGACTATAAAGTAT
ACTTATAAGAAATAAGAAACCTATAAGGTAATAGCTAGCTATATATAAGCTAATTATTAGTAAACTACTCTTATTATTTC
TTATGCTATTATATACTATAAACTACTTATTCTAGCTTTAAAGGCGCTCTTTAAAGCTATAAACTTAAAAAACATTTTAT
TAGTAAGCTATTACTTAGCTACTAGCTACTTATTATTATCTTTCTTTATAAACTATAACGCTGCCCTAGAAAGAGGACTA
ACGCAGGCTACGCGCAAGCTGTACGCAGTATACGCACAGCGTATTAAATATACACTGTAAACTAGAAGCGGTGCTAGTAG
CGCAGGCTGCGTGGCGCAGTTTGCGCACAGGCTATAGCACGTGCTAGCGCATAGGCTAAGTAGAAACGGGGTTGCGCCTG
TCTTGCGCACTTGGTGCGCTAGAAGTGCGCCTACGATAAAGAGTGCCTCCCGCACTCTCTTAGAGTGTAGAAGGCAAGAA
TTAGCTATTAAATATACGGCTGCTTCCTCTTGTTAAGAAGATACCTTCTTGCCTGCCTAACTTACCTAGCTTACCTAAGT
ACACCTTTAACAATTCTTAATTCTTCTACCATTAGGCTACCCAAGTTAGGAGGCAGAAGGAGCAATGGCACCTTAAAAGA
CTATAAAGCAAACGACGCACGCATATAGTGCGTAGGAAGAGAGTAGCTCTAGGGCAATAGTCGAGAACCCTCTTAACCTT
ATCGTCGAAGAAGTAGAGAACAAAGACTTTAATCTCTTAGAGGAGGATTATAAGCAACTAGATGACAACGATGCGGGCAA
AGGCCTCTTAGGGCAGACTATTAGGCCTACTATAGACTAGATAGTAGCGGACCTTATTGCTAAAAATGATCGACTGTATA
AAGCAGAGCGCTTAAAGCAGCAAATAGTAGACTTATAGCAATAGCTCTTAAATATAAAAGCAACTTAAGCAAAGAGTAAG
CGCACCCGCAGCAAGGACTCTAATAAAGACAGCTTTTATAGTTAAGATATTATTTTAAAAAGTAGCATCGAACCGCCTTT
TAAGACACCTAGTAGCTTTTAAGAGCGCGCTACTTAGCTATAGGCTAGGAAGCGACACTTTTATCTAGCCCTTAATAAGT
TTAGAAGCGCTAGTTACTAAATTAATTATATGCTTAAATATATAAAGCAGTTATGCTGCACTATATAGGAAACGCGTTTG
CAAAGCATAATAGACGTAGTAGTAGCAAAGGCTTAGAGCAACTAAGATGCATTTAAGGCCTAGACCTTAACTCTTATAGC
TAATCCTTATAATATAGCTTTTATTGTTACTAATAGAATTAGCAAGGCTTACTAAAGATTAAGGCAGACTCTTTAAGACT
TTAATAACTACCTTGCCTTCTTTAAAAACTAACTGCTTATTAAATTAAAAGAGGAATAGGCGTAGTTGCTATTCTTTAAG
CTACTTTTAGAATTAAAAGAAGATCTCTTAAAATTAAATAAGATACTATAAACTAGAGCGGAACTAGTAGCTAGAGCAAT
AACGTTTTAAAGCTTAAAGAAGCTAAAGGCTTAGTTAAAATAAGATAACAATAGTATACGCGGTAAAAAGGCGTAGAAGA
ATTAAAGAGGCTATAAGGGCGGCTATAAAAATAACACTAATTAAGAAAATAATTGTAGCAACTACTATAGTAGTGCTAAA
GGTAAAGGCTAAGGCAAAGAGAGAGGCGGACTAGCTGCTATAGCTACTAAAAGCTACTAAAAGAACCCTACCTATACAAA
TAGTAAGCGTATAAAGTGCTTTATTTATAAAAGTAAAGGCTACTTTGCCTAGAACTGCCTAAAAAGGCAAAAGACTACAT
TGGTAAATTCGGTTTAACTAACTAAAAAGAATGCTAAAAAGGTAAAAAACTAGAAACGCCTAAGATAAACTAAGACTCTT
AGGCGTTACTAAAGACAATTAAGATTAGTAATTCTTTTCTTATCTAAGCTTTTTTCTTTAGACTAATAACTATAGAAATA
TTTACTATATAAGATACTTATATAAGTCTTAATACTATTAACTATAAATTTATAAGACTATAAAGACTAGAATCTATAAA
GATGTTAGTACTAACCCTTAAAGCGTATAACAAGAGCATTATAAGTATAGCAAGAGCGTAGAAGGTACTTTTGTATATAA
AGAACTTTTACAAGTACACTTATAAGATTACATAGGTTTATATAGAAGTTACTAAACCTGCTAGGTATTAAGGCCTAATA
ATATTACTATTAATAACAACCCTCTAGAGTAAGAAAGTTTACCTAGAGCTAGCAGACTATCGCTAGTGGTTTAAAGCACG
CATAAAGACTATACAACTTATACTATAAGAAATCTTCCTTGCTATAGCGCGTAAAGAGCGCGCATAAGTATATATAATCT
TGCTAGGCGACCTAGAAGTAAAAGGTTATTTAAAAGGCATAGGCGTACTACTTGCACATTTAGCGCATAAGTATAGCAAC
GTGCTAAATATATCTAACGCTAAGGTCTTACTACTATATAAGGCTACTAACTATGCAATTAATCTTTTACCTAGCAGTTA
ACTACTATATAGAATAATATATCCTTTATTATAAAAAGAATTAGAAGAGCTACGCTAGTGCTTAGACAATAACTTAGCAA
TAAAACGAATTTGCCTATTAAAAAGCTCTATAGGCGCACCTATCCTTTTTATGCCTAAGAAGAATAAAAGCTTACGCTTA
TACGTTAACTATAAAGGGTTAAATAAGGTTATAATAAAGAACTAATACCTGCTACCTTTAATCTTTAAGATTATAGACTA
CGTAGCAGGAATAAAGGTAATGTTAAAAATCGACATTAAGGAGGCGTATTACCGCTTAAGGATTAAAGAAGAAGACGAAT
AAAAGACAGCTTTTTAGACTAGATATAGTCTTTTTAAATACCTAGTCTTACCTTTTAGGCTAACCAACGCCCTAGCAACC
TTCTAGTACTATATTAGCTAAGCGCTGCATAGTTTAGTAGATATAATTTATATTATCTACTTAAACAATATTCTTATGTT
TTTATATAACAAGAAAAAGTATATAAAGCACCTAGACTAAGTCTTTAAGCGTCTTTAGCAAGCCTAGTTATTTGTTAATA
GTAACAAATGCTTATTTTACTAATAAGAAGTTAAATTTCTAAGGTTTATTATTAGAAGCAAAAGGTTTACAATAGACTTG
CACAGAGTTCGCGTAATTATAGAATAGCTAACGCTATAAACATTTAAAGAGGTGTAAGTCTTTTTTAGATTCTACAACTT
CTATCGTTGCTTTATTAAAGCTTACTTAAACATCTTGTCTTCTTTATTAAGGCTGCTATAAGGTAGCAAAAATAGTAAAA
AGCTAGGACTAGTATAGCTAAGGAGTAAGAAGCGCGTAGCCTTTGCAATGCTAAGAGAGGCATTTATAAAAGCACCTTTA
CTACGCTATTTTAACCTAGAATAGGCAATATGTATAAAGACTAATACTTTAAAGGTAGCTATTAGTAAAATTATCTTTTA
ATAAAATAAAGAGAGAGCCTAGCACTTAATCGCCTTTTAGTTAAGAAAACTATAAAGACTAAAGCTAAATTATAGCACTT
TAGATTAAGAGCTACTAGTAATTATAAACTCCATTAAGCAATAGCAACACTACCTTAATAGCAGCAAAGAGACAATTAAA
GTCTTATTAGACTATAACAACTTACGCACCTTTATAACCTAGCTAAGGTATAACGAACGCAAGGCTTGCTAAGCTATATA
CCTATCCTCCTTTAACTTTATAATTAAGTATAGACTAGGCGTAATAAACCTAGCTAATGCGCTATTAAGACGGCTAGATT
ACTTTAATAAACCTAGATAAGTTAGAATAACTATTATTAGGGTATAAAAAGAAGACGCATAGTTAGTAGGCACTATAGCT
ATAGCATAAGAGACGTGCAAGATGCGCGTACTTGTTATAAAAGACAACAGCGCTAAGCTAGTTACTAACGTAGCTTATGC
GAATAAGACGCGCAAAATGCGCGTACTTGTAAAAGGACCTAGTAGGGAAGAGGAGCTAAGCGCTACCTCTAGGATCTTAG
TAGCCCTAGATCTTACGCGGCAAGCCACTATAGCGTAAAACAGCGCACCGCTTAAGCAAGCAAAGCGTAGTAAACTAAAA
AAGCTAGACGACTATAAGAGACCTTAAGAAGACCTTAAGAATATTATTGCTGCGGCGCTAATTAAAGGTCTAACGCTTTT
AACAAGCGTAGATAAGAACCTAGTATACTTTAGCCTACTATAGCAACTAGCTATTGTTGCTGCCCTATATTTATACCTCT
AAGAAAACAAAGTTTTTAAAGCTATTTGTAGAGTAATAGTAAGAATCTAAGACGTAAACCTAAAGGTATAAGTTATTAAG
GCGCGCGTAGAGCGCACTATAAGCGTAAAAGGTGCAACAAAGCTATAAAGCCTTATACTAGATAGTATATTACTATAGGA
AAACTGCTTGTATATAGGCAGCGCATACATCCTTTATTAAAAGCTGCTATAGCTTTATTATAACAACTAAATCTTTAAGC
ACTTTGTAGTTACTAAGACCTTAAAACTACTTTGTTGCCACTTCTACTAAGAAGAAATAAAGAAGGATATAAAAGCTTAC
ATTGCCTTATGCCTAGTCTGCTAAAAATAGACGATTAAATAGTATGTATAATATAGTAAGCTAAACTCGCTACTACTACT
ATAAAGTCTTTAACAAAAAATCTTTATAAACTTAATTACAAGGCTACTAGTAGCTAAAGCAAGCATAGGCGGCAAAGTAG
ATACAATTCTAGTGATTGTTAACTGCTTTATAAAAATAAACCTCTTTTTTACTATATAAACTACCTTAACGGCTAAAGGC
CTTGCGCACTTTATATACTAATATATAGAACTAATGTATAGCGTAACACTAAAGAGTATAGTCTTTAACTAAAGAAGCAT
ATTTACTAGCAAATTCTAAAGTAAATATTACTATTAAACTAAAATCTATAAGCAGCTATTAACTGTATTTTACCCCTAAA
TAAACAAGCAAACAAAGAGATTTAACTAAACGTTAGAGTAGTACTTATACTACTTTATAATAAAAAGCAATTAAATTAGC
CCTCTTTAATATCTTTAGCGTAATACGCCTATAATAACGCTATTAACGCAACAACTAAAATTAGCTTATTTAAAGTGCTA
TATAGTTAAAAACTAGACTTATAAACTTGCCTTAAAGGTAGCGCAACTATAAAAGAAAAGCAAAATATATGCAATATAGT
CCTAGTAGTGCACAATTGCTTAGAAAAACTAAAAGCTATATAGAAAAAGTTAGTAGCAAACTAAGAGTATATAATAAAGC
GCTAGAAGCGTTACTATAATGCACGCTATTAGCCTATAAGCTTTATAGTAGAAGAGTTAGTAAGCTTTTTTATAAAAAAC
TTTTGCTTAAAAAATAAGAAGTTAGCACTAAGATATATTAAGCCTTTTAGAATCCTTAAAACTATAGGTAGACAAGTATA
TTAACTAGCACTACTAAAATAATATAGCTAACTATATAACGTTTTCTTAGTCTTACTATTAAAGCACTAAGAGAGTAAAG
CAAGTATAGAATAAGCGCCTTTAACAATGCTAACGTTAAAAAACTTAGATAATAAATAAAAAGTAAAAGCAGTTATAAAC
AAAAGACGTAAAGCTAGCTAGATTAAATACCTAGTATATTAGATAGGCTAGCCGACTAAATACAACTAGTAAGTGCTAAA
AGAAGATATAGAAAATGCACATATAGTAATTAAGTAGTATATGCGTAGTAAGCGCGTAAAAACAAAAATATATAAGTAAA
AGCTTAAATTAATTTAACCGGTTAAAAGGCCTTATAAAAGACTATCTAAAACTATCTAAAAAGCTCTTAGAGTAACGCTA
CGCTAGCCGCTACCTTAGTATAAGCCTTATCTATAATATATACCTTTGCTACTACCTTAAGAAAAGCATTGAAGGCTATA
GTAAAGGCAGTATAACTAGTGTTACTAGGCATTAAGCGCGGTAGCTAAAAGAGCTGCTAAAAGGTTAGAGTAGTAAGTCT
AGGCAGTAAAGATAAAGAGAGCGTATATAGCAATAGTAAGTATATTTAGGCTAATAAAGCTTGCTAGGCCTTTACCTAGC
AAGCTACCTCTTAAGCCTTCTCTTAGGCCTTAATGCCCTAGTAAAGACTAAGCTTTGCCTATATAACGTTAGTAGCTAAC
AACACCTTTAGCAACGTAAGCTACTACTGCTTATCTACTTATAACAAGGTAGCGATAAAAGCACCTATAGCACGCGTAAG
TGCCGTGTGTACTATAAGCAAACCCTAGCTATAAAGCTTCTTATTAAGGCTGCATAGCACTATCTTAAAGTTAGCTTAGT
TGCTAACTATTAGCTGGAAAACCTGCATTCTATTAGCTACTAAAGCGGCTTATAGCCACTAAAAAAGACTTACCTTGCAA
CACTCGTGCTTGCTAGCATAGTAGCCGTCGCAGCGCCTAGCGCTAGCAACGCTATAAATACACAGCATAGCTACAAACCT
AGGCAACTCTGCAAGAAGAGTCGTTAGAAAGCGGTGCAGGCACTGTACGCACAACAAGCCGTCTAAGGCAACCTAGGGGT
AAGCTAGTAGCGCAGCCGCCACTAACCCTAGAAGCGCCAGACTAGCAAGGGCAGCTCTTGTACCTTAACAGGCTACTAAA
GGCCTAACTAAAGGCATAGCGCGCGCTGTAGTCCGCGCTAAATAACAAACTATGCTAGCGTAAGCTTTGCGCGTACGTTG
CGCGCGGCCAGAACTAGCACCTTAGCTAGAAGGCAGAGGGTGTTAGGGAGTAAGGGCTAGGGCTATAGCAGGTACTAGAG
CGCTAGAGGCGCTTACCGCGGGCATAGGAACGTTAGAATTAAAAGCAGCTATGTTGTTGCTAGAAGACGAATTTGTTGTT
TTTAAAAGAAGTGACCAGATGCTAGACTCTACGATAATCTAATTTAACTATAGGACTAACCTCTTAAATAAAGGGAACTA
AAGGCGCCTTAAGTCGCCTTTAATAGTAATCTTAGCAAGCACAAAGAGGCTGCCGCAAACAGACAAGCACCACCACTACT
AGGAATAAAGGTTGCAAGCCTTTCGTTAAGACCTACCTTAGGGGAGTTAGGCATAGAAGGGGAGCAATTGTAACGCCGCC
CTAGGAAGAGGACCGACGCAGGCTACGCGCAAGCTGTACGCAGTATGCGCATAGCGTATTAGATGTACATTGTAAACTAG
AAGCGGTGCTAGTAGCGTAGGCTGCGTAGCGTAGTTTGCGCACAAGCTATAGCATGTGCTAGCGTATAGGCTAAGTAGAA
ACAAGGTCGCGCCTGTCTTGCGCACTTAGTGCGCTAGAGGTGCGCCTATAATAAAAAGTGCCTCCTATACTCCTTTAAAG
TGTAGAAGGCAAGAATTAGCTATTAAATATACGGCTGCTTTCTTCTATTAAGAAGATACCTTCTTGCCTGCTTAACTTAC
CTAGCCTACCTAAGTATACCTTTAATATAAACGTTCTTTTTATCTTTTTATTCTTTTTTTACTAACACTCTTTTTATTCT
TCTTTTTACTACTAAGCAAGCCTTTACTAACTAGTATATAGTTACTATAAGCTACTAACTAGCTGCTTACTAGCGCTCTT
CTACTAAATATAGCTATACTACTACTACTAGCTATTATAACTACTTTACTATTATTAGCTATAGCATTAAGAATAGTCTT
ATTGCCTTACTAACGCTTAGCTAAGGTTAGCAACTAAGCATAGGCCTATTACTTACTAGGCGCTATTAAAGGTAATAGTT
AAAGAAAAACTACTACTTAGTTACTCTAAGCTAGCTTAACTAAGGCTACTATAGTTTATAAAATCTACTTAAGCAGCTTC
TTTACTTTTATAATATAGTAAAGTATACTATTATAGCTAGCATAAATAGCTATAGTATATTAAGCTAAGCTAAGAATAAT
AGAATAAAGATTATATTAAGTAATAGGTTAGTAATAACTTAATAATAAAAATTATAAGACTTATTATTACTTTAAAAGTA
GTATTAACTTAGGTTTATACCTATAATAGCATGCTTATATTTAAAGAAGTTAGTAGTAAAAGCTAAGTTACTTTTACTAA
CTACTAAATAAGTATTAAGGTTAGCTTTAGCTTTTACTAGTATAAGTAAAGAATACTAAGATGTAATATAGCCTATTATA
CCATCTTAAACTATTTGCGCTAATAGCGCTAGTTCGTTACTAAAAGCTTTAATTTATCTTTTTATAAGGCGTAGCTAAGT
TTCTTAGCTATTATTATTAAGACTATTAACCTTTAAGTAATTTCTATATAATCGCCTAGCGCTATAATAATATTATTAGC
TATTATTAGCTAAAGTAGTAACTTATTTATACTAGCTAAAATGTTTTAAGTATATTAAGCTAAGCCTTTAATCTTATTAA
AAAGCTATTAGCTAGTAATTAGCTACTAACGTATATAAGTTAACGTACTTACTAGTAAACATAATATATTACTAGCTATA
TAACTAACGTAGTATGCTAGGTTCTTTAGTATAGCTATATATAAGAATTTATAATAAATGTTTAAGTAAGCCTTAAGAAT
ATAGTTTAAGCATATAGCCTACTATAAGGTTGGCTATTACTTAGTAACAATTATATTAGTAAAGACTTATACTTTTAAGA
GATAGTATATATACTTAAGGTAAGTGTTTTATAAGGTTTAAATTTATAAAAAAGTTTATTAAGACTTAAAAGTAGCTTTA
GTTAAATATTATTTATAAATAATTATTAGCTAGCTACTATATAAAGCTATAAACTATTATATTAACCTACTATGCTAGTA
CGATTAAAGAAAAAAAAAGCTAAAAAAGTAAGAGTAGTCTTATAAGTATAAACAAATTTATTTTAAAATTATAAAATGCA
CCTACGTTTTTATACTTTTAAGTAATAAAAAAAGCTACGTTATTAAACGTTTAAATATATCTTAAAAACTTATTTAACTT
TACTTTAATAGAAAAGTAAAAAGCGTTTAAAATTTAAATAAAAAAACGTCTAAATAGTAAACTACCTTTATTAATTAATT
AATAATAGTTTTATAATTAATAAGTAATAAACAGCTATTACAACCTTTATTTTAACTTACTATTAGTTAAGAACCTTAAC
CTTATATAGCTATTTTTAGTTAATATATACTACTTTATTTAAAAATATAAGTAAAAGAATATTTTAGTAGTAAACTACTT
TTATTAACTAGTTAATAATAGTTTTATAATTAATAAGTAATAAATAACTATTACTACCTTTACTTACCCTTATTATAAGT
TAAATACCTTAGCCTTACTTTACTATTTTAGTTAAGCATATACTATATTATTTAATTATTAAATAATAAAATATCTTAGT
AGTAAACTACCTTTATTAATTAGTAAACTAGTAGACGTTTTTAATAAGACTATTTAGCTTATTATTAGCTATGTTAAGTA
TTATAAACCTTTTTATAGCTAGTTTATTAACAACTAGCTATTTAATATAAATATATATATATATATTATTAATAACCTTT
AGTAGTTTAATCCTAACTTTATAAAACTATTATAAGTGCGTTTTATTATAAAAGGCAGCCTAGTAGTAAGTTATAAGAAA
AAGTGCACCCCTAAGAACACCTATTCTAGCCGCATAGAATAACAAATCTAAACCCTTACTAGATGCTATATCGTTATATA
ACCTACCCTAGTTTTCTTAACTAATTAAATGTAAAACAATTTATGCCTTCTAATACTACTTATATACTTTATGTATATAA
AAACCCTCTTTTCTCTACTCTCCTTAAGAGAGAGAGATAAGTAAACACGCATGCATAGAATTAATTAGTTATAGAGATAT
ATAGTATACTTATAAAGCACAAACTACGCCTAAGACTTTGCCGGGCAGGCTTATCTTATTATCTTTTTAGAATTATAAAG
TAAGCTTATATAGCTTTCTTTCTTCTTCTTTTTTAGACTAGCTATATACTACCCTTACCTTTTAATAAAGAAAGGTGCTT
TATAGTACCTCTCTTTATATATAGTTATGTTTATACGTTAATAAGTGTGTATATTATTGTGCTAAAGCCTTACCTTACCT
TTACTTTTACTAGTAAATATACTTAGATTTAATAATAAGTAGTAAGTATAATAAGATGCTTCTATCTATTAAATTTAGCA
TTATAAATAAAGAATATACTTTAATTACTTTATTATAATAATATAATGTTATAACTATAAATAAAAGATAACTAAAAGCT
ATTAAAGTAAATAGTCTTAAACTCTTTAATGCTATATATAAGCGTATATAAAAATAGCCCTATTTAGTAATTAGGTAAAA
GGCGCATTTTAGTAGTCTTTAACTACGCGCTTTAATTATAAGTATAAAGATAAAGGTAAGTCTTTAAGAGTAGCTTATAT
AAAAGAAATTTCTAATAAACTAAAGAAGTAATACTTTTATAGTAAAAAACTCTTTTTTTTAAGTTTTTAAAAGAACCTTA
AAAGTATAAATTTTACTTTTTATATAAAAACAAAGCGTATAAAAGATTTATAATAATATAGGTAATTATATAAAATAGAA
TAAGCGCTTAAGAAAAACGTTTAATAAAAGACTACTATTAAAATAGTTATTTATATTCTTATATAAAAATATAAAGATTA
CTTTTATTAAAAATAACGTCTTTAAGAAATAAAGTTATATAAAGCCTACTTTATAATTATTATACCTTATTATAAATAGT
AAAATTATAAGGAATATATTAAGTAAAAGGTAAGATTTTAATATTATAAAAGTATAATAGTTAAAATTATTACCTTCTTA
TACTTTATAAAAAAGTCTATATACCTAAAATAATACGTTTAAGATTTAAAAGGTTTTTTACTTATATAAGGCTATAATAC
TAATAAAGACTAAGTATTTAAAACTATTATTTTATAATATACCTTATAAGTTAAAATAAGGCTAAAGACCTTTAATTTAA
AAAGAAAAGAAAAGTTTAACATTAAAAGGTTTATAAAAGTAAAAAGCTAAAGAGTAATAATAATAAGTATTAAAGGTATA
CTTAGGTAAGCTAAGTAAGTTAGGCAAGCAAGAAGGTATCTTCTTTACAAGAAGAAGCAGCCGTATATTTAATAGCTAAT
TCTTGCCTCTTACACTCTAAGAGAGTGCAGAAGGCGCTCTTTATCGTAGGCGCACCTCTAGCGCACTAAGTGCGCGGGGC
AGGCGCGACCCTGTTTCTACTTAGCCTGTACGCTAGTACATGCTATAGCGTGTGCGCAGACTACGCCACGCAGCCTACGC
TATAAGCACCGCTTCTAGTCCACAATGTGCATCTAATACGCTATGCGCATACTGCGTACAGCTTGCGCGTAGCCTGCGTT
AGTCTCCTTCTTAAGGCGGCGTTATAATTGCTCCTCTCTTATGCCTAACTCTCTTAAGGTAGGTCTTAACGAAAGGCTTG
CAGCCTTTGTTCTTAGTAGTAGTGCTTATTCGTTTGCAGCGGCCCCTTTATGCTTGCTAAGATTGCTATTAAAGACAACT
TAAGGCGCCTTTAATTCTCTTTATTTAAGAGGTTAGTCCTATAGTTAAATTAGATTATTATAAGGTCTAGTATCTAGTTA
CTTCTTCTAGAAACAATAAATTCGTCTTTTAGCAGAAATATAGCTGCTCTTAATTCTAACGCTCTTATGCCTATAGTAAG
CGCCTCTAGCGCTTTAGTACCCGCTGCGGCCCCGGCCCCTATTCCCTAACACCCTCTACCCTCTAGCTAAGGTGCTAGTT
CTAGCCGCGCACGACGTGCACGCAAGGCTTACGCTAGCCTAGTTCGTTGTTTAGCGCAGACTGCAGCGCGCGCCGTGCCC
CTAGTTAAGCCTCTAGTAGCTTATTAAAGTGCAAGAGCTGCCCTTACTAGTCCGGCGCTCTTAGGGTTAGTAGCGGCTAC
GCTACTAGCTTACCTTTAGGTTGCCTTAGATGGCTTATTGTGTGTGCGGTGCCTGCACTGCTTTCTAACAACTCTCTCTG
CAGAGTTGCCTAGGTTTACAGCTGTACTGTGTATTTATAGCGTTGCTAGCGCTAGGCGCTACGACGGCTGCTATGCTAGC
AAGCATAAGTATTGCGGGGTAAGTCTTTTTTAGTAGCTATAGGTAGCTTTAGTAGCTAACAGGATGCAGGTTTTCTTGCT
AATAGTTAGCAACTAGGCTAACTTTAAAATAGTGCTGCGCAGCTTTAATAAGAAGCTTTATAGCTAGGGTTTGCCTGTAG
TGCACGCGGCGCTTGCGCGTGCTATAGGTGCTTTCGTTGCTACCTTATTATAGGTGGATAAGTAGTAGCGGCCTACGTTG
CTAAGGGTGTTGTTAGCTGCTAACGTTACGCAAGCAAAGCTAAATCTTTACTAAGGCATTAAGGCTTAAAAGAAGGCTTA
AGAGGTAGCTTGCTAGGTAAAGGCTTAGCAGGCTTTATTAGCTTAAATACACTTATTATTGCTATATATGCTCTTTTTGT
CTTTGCTGCTTAAGCTTGTTACTTTAATCCTTTAGCAGCTTTTTTAGCTATTACGCTTAATGCTTAGTAACACTAGTTAT
ACTGCCTTTACTATAGCTTTTAATGCCTTTCTTAAGGCGGTAATAAAGGCGTATATTATAAATAAAGCTTATGCTAGGGT
CGCAGCTAGTATAGTATTGCTTTAAAGGCTTTTTAAATAGTTTTACATAGTCTCTTATAAGGCCTTTTAGCCGGTTAAAT
TAATTTAAGCTTTTACTTATATATTTTTGTCTTTACGCGCTTGCTATGCGTATACCGATTAATTGTTATATATATATTTT
CTATATCTTCTTTTAATACTTACTAGGTATATTTAGTTAGCTAGCTTATTTAATATACTAAGTATTTAGTCTAGCTAGCC
TTATATCTTTTATCTAAGACTACTTTTATTTTTTATTTATTGTTTAAGTTTTTTAATATAAGTATTATTAAAGGCGCTTA
TTTTACGCTTACCTTACTTTCTTAATGTTTTAGTAGTGCTAGTTAATATACTTATTTACCTATAGTTTTAAGGATTTTAA
AGGGCTTAATATATCTTAGTGCTAACTTTTTATTTTTTAAGTAAAGGTTTTTATAAAAAGGCTTACTAGCTTTTTTACTA
TAAAGCTTATAGGCTAGTAGCGTATATTATAATAACGCTTCTGGCGCTTTATTATATTCTCTTAGTTTACTACTACTCTT
TTCTATATAGCTTTTAGTTTTTCTAAGTAGTTATATACTACTAAGACTATATTATATATATTCTACTTTTTTTTATAGCT
GCGCTACCTTTAAGGCAAGTTTATAAGTTTAGTTTCTAACTATATAGCACTTTAAATAAGCTAATTTTAGTTATTATATT
AACAGCGTTATTATAAGCGTACTATACTAAAGATAATAAAAAGGGCTAATTTAATTGCTTCTTTATTATAAAGTAGCGCA
AGTACTACTTTAACGTTTAATTAGATCTTTTTATCTACTTATCTATTTAAAGGTAAAATATAGTTAATAGCTGCTTATAG
ATTCTAGTCTAATAATAATATTTACTTTAGAATTTACTAGTAAATATACTTTCTTAGTTAAAGGTTATACTCTTTAGTGT
TATGCTATATACTAGTTTTATATATTAGTATATAAGGTATATAAAGCCTTTAGCTATTAAAGTAGTCTATATAGTAAAGA
AAAGGTTTATTTTTATAAAGTAGTTAATAATTACTAGACTTGCATTTACTTTGCTGCTTATACTTACTTTAGCTACTAGT
AGCTTAGTAATTAAGTCTATAAAGATTTTTTATAAAGACCTTATAGTAGTAGTAGTAGGTTTAGCTTACTATATTATACG
TACTATTTAATTATCTATCTTTAGCAGACTAGGCACAAGGGTTATAATAATATGCACCGTTATGTAATTGATTATATAAT
ACATTACATAATTACGTTAAAGACTTTATAGCTTTGCTTGCTAATAAGCTAGATATAGATGTAGTATAATGTTTTATAAG
ACTTGTACAACTCTATCTCTACTAATCTTTACTAGACAGCAGCTAATCGAGCTGCCGCTGCTATAAGCAGGGTTATAATA
ATATGCACTATTATGTAATTGATTATATAATACATTACATAATTACGTTAAAGACTTTATAGCCTTGCTTGCTAATAAGC
TAGATATAGATATAGTATAACGTTTTGTAAGACTTGTGTAACTCTATCTTTACTAATCTCTACTAGATAGCAGCTAATTA
AGCTGCTGTTGTTGTAAGTAGAGTTATAATAACATGCACTATTATGTAATCGATTATATAATACATTATATAATTATATT
AAAGACTTTATAGCCTTGCTTGCTAATAAGCTAGATATAAATGTAGTATAATGTTTTATAAGACTTGTGCAACTCTATCT
TTACTAATCTTTACTAGATAGCAGCTAATTAAGCTGTTGCCGCTATAAGCAGGGTTATAATAACATGCACTATTATATAA
TCGATTATATAATCTACTAATCTCTACTAGATAGCAGCCGATCGAGCTGCCGTCGCTATAAGTAAGGTTATAATAATATG
CACTGTTATGTAATTAATTATATAATATATTATATAATTACGTTAAAGACTTTATAGTCTTGCTTGCTAATAAGCTAGAT
ATAGATATAGTATAACGTTTTGTAAGACTTGTATAACTTTATCTTTACTAATCTCTACTAAACAGCAGCCGATCGAGCTG
CCGCCGCTATAAGCAAGGTTATAATGACATATACTGTTATATAATCAATTATATAATACATTATATAATTATATTAAAGA
CTTTATAGCCTTGCTTGCTAATAAGCTAGATATAGATATAGTATAACGTTTTGTAAGACTTGTATAACTTTATCTTTACT
AATCTCTACTAAACAGCAGCCGATCGAGCTGCCGCCGCTATAAGCAGAGTTATAATAATATGTACTGTTATATAATTAGT
TATATAATACATTATATAATTACGTTAAAGACTTTATAGCCTTGCTTGCTAATAAGCTAGATATAGATGTAGCATAACGT
TTTGTAAAACTTGTGCAACTTTATCTCTACTAATCTTTACTAGATAGTAGCTAATCAAGCTGCTGCCGCTATAAGCAGGG
TTATAATAACATACACTATTATATAATCGATTATATAATACATTATATAATTACGTTAAAGACTTTATAGCCTTGCTTGC
TAATAAGCTAGATACAAATATAGCATAACGTTTTGTAAGACTTATGCAACTCTATCTTTACTAATCTTTACTAGATAGCA
GCCGATTAAGCTGCTGCTACTATAAACAAGGTTATAATAACATGCACCGTTATATAATCGATTATATAATACATTATATA
ATTACGTTAAAGACTTTATAGCCTTGCTTGCTAATAAGCTAGATACAAATATAGCATAACGTTTTATAAGACTTGTGCAA
CTTTATCTTTACTAATCTTTACTAAACAGCAGCCGATTAAGCTGCCGCCGCTATAAGCAAGATTATAATAACATACACTA
TTATATAATTAATTATATAATATATTACATAATTACGTTAAAAACTTTATAGCCTTACTTGCTAATAAGCTAGATATAGA
TGTAGTATAAAGTTTTATAAGACTTATGCAACTTTATCTCTACTAATCTTTACTAGACAATAGCCGATCAAGCTGCCGCC
GCTATAAACAAGGTTATAATAACATGCACTATTATATAATCAATTATATAATACATTATATAATTACGTTAAAGACTTTA
TAGCCTTGCTCGCTAATAAGCTAGATACAAATATAGCATAATGTTTTGTAAAACTTGTGCAACTTTATCTCTATTAATCT
TTACTAGATAGCAGCCAATCAAGCTGCCGCCGCTATAAGCAAGGTTATAATAACATGCACTATTATATAATTGATTATAT
AATATATTATATAATTACGTTAAAGACTTTATAGCCTTGCTTGCTAATAAGCTAGATATAGATGTAGCATAACGTTTTGT
AAGACTTGTGCAACTCTATCTTTACTAATCTCTACTAGACAGCAGCCGATCGAGCTGCTGCTGCTGTAAGCGGGGTTATG
ATGATATGCACTGTTATATAATCGATTATATAATACATTATATGCACCGTTATGTAATCGATTATATAATACATTACATA
ATCACGTTAAAGACTTTATAGCCTAAGCCTTTATGTCCTTCTTTATTTCTTCTTAGTAAAAGTGGCGACAAAGTAGTTCT
AGAGTCTTAGCAACTATAAAGTGCTTAGAGATCTAGTTGTTATAATAAAGCTATAGTAGCTCTTAATAAAGGACGTACGC
GCCGCCTATATGCAGGCAGTTTTCCTATAGTAATATACTGTTTAATATAAGGCTCTATAGCTTCGTCGCACCTTTTACGC
TTATAGTGCGCTCTACGCGCGCCTTAACAACTTGCACCTTTAGGTTTACGTCTTAGATTCCTACTATCGCTCTGCGAATA
GCTTTAAAGACTTTGTTTTCTTAAAAGTGTAGATATAGGGCAGTAACGACAGCTGGTTGCTGCGGTAGGCTAGACTATAC
TAGGTTCTTATTTACGCTTATTAAAGGCATTAGACCCTTAATTAGCGCCGTAGCGGTAATATCCTTAAGGTCTCCTTAAG
GTCTCTTATAGTTGTCTAGCCTTCCTAGTTTACTACGCTTTGCCTGCTTAGGCGGTGCGCTGTTTTGCGCTATAGTAGCT
TGCTGTATGACATCTAGGGCTACTAAGATCTTAGAGGTAGCGCTTAGCTTTTTTTCCTTGCTAGGTCCTTTTATAGGTGC
GTGCATCTTATGCGTCTTATTCGCATAAGCTGCATTGGTAACTAGCTTAGCGCTGTTGTCTTTTATAATAAGTGCGCGCA
TCTTACGCGTCTTTTGCGCTATAGCTATAGTGCCTGCTAACTATGCGTCTTTCTTTTATACCCTAGTAATAGTTATTCTA
ACTTGTTTAAGTTTATTAAAGTAATCTAGCCGTCTTAATAGCGCATTAGCTAAGTTTGTTACGCTTAGTCTATGCTTAAT
TATAAAGTTAAAAAGAGATAGGTATATAGCCTAGTAAGCCTTACGTCTATTATACTTTAGCTAGGCTATAAAGGTATGTA
AGTTATTATAGTCTAATAAGACATTAATTATCTGTTTACTACTATTAAGGTAGTATCGCCATTGCTTAAAGGAGTCTATA
ATTGCTAGTAGCTTTTAATTTAAATTGCTATAATTTAACTCTAGTCCTTATAGTTTTCTTAACTAAAAAGCGATTAAGTG
CTAGGCTCTCTCTTTATCTTATTAAGAGATAATCCTGCTAATAGCTACCTTTAAGGCATTAGTCTTTACGCGTATTGCCT
GTTTTAATTTAAAATAGCGTAGTAAAAGTGCTTTTATAAATGCCTCTCTTAGCATTATAAAGGCTGCGCGCTCCTTACTC
CCTAGCTATACTAGTCCTAGCTTTTTGCTATTTTTGCTACCTTATAGCAGCCTTAATAAAAAAGATACAACATTTAAGTA
AGCTTTAATAAAGCAACAATAGAAGTTATAAAATCTAAGGAAGACTTATACCTCTTTAAATGTTTATAGCGTTAGCTATT
CTATAATTGCGTATACTTTACGTAAGTTTATTATAAACTCTTTGCTTTCAATAATAAACCTTAAGAATTTAACTTCTTAT
TAGTAAAACAAGCATTTGTTGCTATTAATAAATAACTAAGCTTGCTAAAGACGCTTAAAGACCTAGTTTAAGTGCTTTAT
ATGCTCCTTCTTATTACGTAAGAATATAAGGATATTATTTAAGTAAATAATATAGATTATATTTACTAAACTATATAGCG
CTTAGCTAATATAGTACTAAAAGGTTGCTAAGGCGTTAGTTAGCTTAAAAGGTAAGACTAGGTATTTAAAAAGACTATAT
CTAGTCTAAAAAGCCGTCTTTTATTCGTCTCTTTCTTTAATCCTTAGGCGGTAATACGCCTCTTTAATATTAATTTTAAC
ATTACCTTTATTCTTACTACGCAGTCTATAATCTTAAAGATTAAGGGTAGCAAGTATTAGTTCTTTACTATAACCTTATT
TAACTCTCTATAGTTAACGTATAAGCATAAGCTTTTGTCCTTCTTAGGTATAAAAAGGATAGGTGCGCTTATAAAGCTTT
TTAATAAGCAAATTTATCCTGTTGCTAGGTTATTGTCTAAGTACTAGCGTAGCTCTTTTAATTCTCTTTACAATAAAGAA
TATATTGTCTTATATAGTAGTTAACCGCTAGGTAAAAGATTAATTGCATAGTTAGTAGCCTTATATAATAGTAAGACCTT
AGTGTTAGATAAATTTAGCACGTTGCTATACTTACACGCTAAATACGCAAGCAGTGCGCCCGTGCCTCTTAAATAACCTT
TTACTTTTAAGTCGCCTAGCAAGATTATATATACTTATACGCGCTCTTTACGCGCTATAGCAAAGAAGATTTCTTATAGT
ATAAGTTATATAGTCTTTATATATGCTTTAAACTACTAGCGGCAGTCTACTAGCTTTAGGTAAACTTTCTTACTTTAAAG
AGTTATTATTAATAGTAATATTATTAGGATTAATACTTAGCAGGTTTAGTAACTTTTATATAAACCTATATACTCTTATA
AGTATACCTATAAGAGTCGTTTATACGCAAAAGCACCTTCTACGCTCTTACTATGCTTATAATGCTTCTATTATACGCTT
TAAAGGTTAGTACTAATATCTTTATAGATTATAGTACGCTTACTCTTTGCTTAGGTTGCTCTTATATTTAAAAGCTATTA
CTATAAGTTTACTATTCGCTGCTTTAAGCGCTTTACTTTATATAGTCAATCATTTTTAGCAATATAGTCTACTACTATCT
AGTCTATAATAGGCCTAATAGTCTGCCTTAAGAGGCGTTTGCCTACATCGTCGTTATCTAGTTACTTATAATACTTCTCT
AAGAGATTAAAGTTTTCGTTCTCTACTTCTTCGATAATAGGGTTAAGAGGGTTCTCGACTATCGCCCTAAAGCTGCTCTC
TTCCTGCGCACTGCGTGCGTGCGACGTTTGCTTCGTAGTCTTTTAAGGTGCCATTGCTCCTTCTGCCTCCTAACTTAGGT
AGCCTAATAGTAAAAGAATTAGGAATTGTTAAAGGTGTACTTAGGTAGGCTAGGTAAGTTAGGCAGGCAAGGAGGTATCT
TCTTAACAAGAGAAAGCAGCCGTATATTTAATAGCTAATTCTTGCCTCCTGCACTCTAAGGGAGTGCGGGAGGCGCTCTT
TATCGTAGGCGCACCTCTAGCGCACCAAGTGCGCAGGGCAGGCGCGACCCCGTTTCTACTTAGCCCGTGCGCTAGCACGT
GCTGTGGCTTGTGCGCAGACTGCGCTACGTAGCCTGCGCTATAAGCACCGCTTCTAGTCTACAATGTGCATTTAATACGC
TGTGCGCATACTGCGTAAGGCTTGCGCGTGGCCTGCGTTGGTCCCTTTCTTAGGGCGGCGTTATAATAAGATACTATAAA
GAAGAATAATAACATTATTATTTAAGCCTTATTTAAATATTTTTAATTAGACTAGAAAGAAAAATATATAAAAAGCAACA
AACTTTTACTCTTTTTTATTAGAAATATACTATTAGCATTAAGTTTTCCTTATACTTATTCTCTTTTATAAACAATTATT
AAAATTATATAAAAATAAGCAAAGATTATATTAATTTTATAAAATATAAAACATGTTAACTATACTAGCATCTAACCTTA
ATACCCTCTTTTTTATAAACTAGGTAATAATAAGGCTTTTAATTTCTTACTACCTAGTATACTCTTAAGCTTGCTTTTTA
CTAGTAATAATATTACTAGATTCTTAAAATACTATAAGGTCCTTACTAGCTCTACGAAACTTAAAAAAATAATAAAGTTA
ATAAACTTCTTATATACTATAGCAGCAACAATACTCTTTATATAAAAGGCTTAGTTATCTAGGCTATATTAAAGCCTACT
AAAAAAAGGATTAAACACTTAAAGGAATAAATAATACTAGCCTTTATAAAAAGAGATAAAGATTAAGTTATAATACTACT
TATATAAGCTTAAGCCTAGTTCTATTTAACCTACTTAATAAACCTTAAGACTTTTATTAAAGAGATAATACTACTCTACT
CTTATATAGTCTAAGCTAAAGAAGAATTGTTAGCTAGCTTTAAATACTCTAAATCCTTATATAAAACCCTCCTAGAAAGC
GTTAATAAAATAGGTTAGACTTATACTAATCTTAGCTATAATGCACTATAAAAGCTACATTTTAAAGACTTCTATAATTG
CGTTATAACTATCCTTAAAAATGTAGAATATACTAAGCAATCTTAAATAAAAACCCTTATTAGCTAAACCTTAAAGATTT
ATAGCAATACTTAAGCACTAACCTTTTATGGTTATTAAGGTCTTAAGTTTTAGCTTATATAAGCTTTTATAAGAAATTCT
ATTTAGCTAAGTTTAGACCTCTTGGACTTTATTACGCTACTAACTAAAGGGATAGAGAACTTTAATACTTACTAGCAATA
ACTTATTAACGCCTACCTAGTTATAAAAAGAGTTACGCCTTAAGCTTTTTTAATATAAAACCTATACGCTCTGTAAAATA
ATATACTACCTTTACTAATCTAATCCCTTACCTAGCTAATCTAAATATATATAACGTATATTAGTTAACTTAAGTAGCCT
TAAGAAGACTAGCTTAAAACCCTAGCTTAGTATATAGGATAGCGTTTGTAAGGACTACTAAGAGTTTACTACTATTTCTA
CTATAACTACTTAAAGTACTAAATTAAAGACTACCCTTAGATATAAGTTAATACTGCTATAGGAATTACGCATTTTAACT
TAGCTAGTAGGCGCTTCTATATAGGGAAATTAAGTAAGAAGTTTACTATTTTAAAGACCTTAGTTATTTACTATAAAAGA
TAAAGAAAGATTAAGAACGTTATTTAGTCCTACCTATCTTAGTATACTAAAATTAATAATACTACTACTATAAAAAAACT
TTAAGAAATAAAGGTTACTATAAAAGTAAAGATAAAGTATTTTTTAATTACTAAAACTATTAAACTTATTATTACTACTA
AGTCTATACTTATAAAATAGATTATAGTTAATATAGTTTAACTTAAGAAGAATAGCAAAAACCTTTAAGGTAGGATTTAA
GACATCCTTACTAGTAAGATAAAAGAACTAGGATAAAATTAATAGCTAAAAGAGATATAAAGAAATTTACTACATTTCTT
CTTAGATATAAAAGACAAAGAGCTAATACTAAAAAAAGTTATTAATAAAGATAAGAATATAAGAAATACTATCTTTGTTA
ATATAAACAAAACTTAAAAAGATTTAGCTATAAAGAACAACTAAAAGAGTAAAGGTAAAAGCAAAACAACGCTCTTAGCA
GTCCTTTCTTAAGACGCTATTATAAATATCCTTTTTAAATTTATCTTATTATAGCTAGTTTAAATTAAAATCTAATACTT
GCTTATATATAGCCTAGCCTTAGCTGCTTTAGTTATATAGTAGTGCTTAAACTATACTAATACTTTTATAAAGTAAGTAT
ACGTTAATAGCATTACTAACAAACCTCTTTAAGATTAAGGAGAGCTACTAAATGTATAAGTTAATATATATAAAGCATTT
AGTACGCTCTAAACTATACTTAAGAGGGAAATAAAGCTTATTAATCCTAAGCACCTTTAAATAACTTTTATTAAGTAAGC
AGAAAACATAGTAAACCCTCTTAATATTATTCTTTAAGTAGATAATAGGTGTAACGCCGCCCCAGGAAGGGGACCGACGC
AGGCTACGCGCAAGCCGTACGCAGTATGCGCACAGCGTATTAGATGCACATCGTGAACTAGAAGCGGTGCTAGTGGCGCA
GGCTGCGTGGCGCAGTCTGCGCACAGGCCACAGCACGTGCTAGCGCACGGGCCAAGTAGAAACGGGGTCGCGCCTGTCCT
GCGCACTTGGTGCGCCAGAGGTGCGCCTACGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAGACAATATAGGGTAGCGGCTCAAAAAGGGGGGGAGAGGG
GGGGATATAAAACCCCCCCGGTGGGTCTGTGGTAGGGGGGAAGGAGGGGTGGTGAGGGGGGGGGTAAAAAAAAGTTTTTT
TCTTTTTTTCTTCTTATAAAAGGGCCTAAGTATTATACTTAAAGGGAACCCCCTGGAAAAAAGGGTATTTTGTTGCTTAG
GGGTTTTAGCCATTTTACAGTGTGGTTGTAGGCCGTGTTAAGTTGGGGCCTTAAGTTTTGGAAGTTTTTTTTTTTAGTGG
CCCTAAATTAGTTTTTTTATAAGAAAAAGGAGGGATTGGGGGCTCTTTTTGGGCTGGCCTGACGGGAGTTTCTTAAAATT
AAAAAAGCTTCTTACTTAAAAAAACCTTAGTAAATAAAGTTTCCTGAAAAGTTAGGATCATAATATTTCTTAAGAGCTAT
AATTGGTAGAATTGTAGTCGTTACTAAGTTTAAACGTAGAAAATAGAGTGTGGTTAATATACTTTAACTTAGGAAGCATA
GCAGAAACCTTGAGGCTGGGATTTCAGACATGTTAGCTAGTAAGATACAGAAGCTAGGATAAGGTTCATAGTTAAAAGAC
ACATAAAGAAATTTACGACAGTTCTTGTAGTAGATAAAAGACAAAGAGCCAATACTAGAAAAAGTGATTAATCAAGATAA
GCATCTCAGAAATACTATCTAGATTAATATGGACACAACTGAGAAAGATTGAGCTATACAGAACATGTAAAAGAGTAAAA
GGTAAAAGCAATACAACGCTCTCAGCAGTCCTTTTTTAAGACGTTGTAATAAATATCCTCTTTAAAATATATCTTATTAT
AGCTAGTAGAAAAGTAAAATGTAATACTCGCTTACAGCTAGCCTAGCCTTAGCTGCCTCAGTTATATAGTAGTTCTTAAC
ATATATTAATACTTTTGTAAAGTAAGTATACGTTAATAGCATTACTAACAAGCCTCTTTAAGATTAAGGAGTGTTACTAA
ATGCATAAGTTAATATATATAAAGCATTTAGTACGCTCTTAACTATACTTAAGAGGGAAATAAAGCTTCTTAATCCTAAG
CACCTTTAGATAACTTTTAATAAGTAAGCAGAAAACATAGTAAACCCTCTTAATATTATTCTATAAGTAGATAATAGGTG
TAACGCCGCCCCAGGAAGGGGACCGACGCAGGCTACGCGCAAGCCGTACGCAGTATGCGCACAGCGTATTAGATGCACAT
CGTGAACTAGAAGCGGTGCTAGTGGCGCAGGCTGCGTGGCGCAGTCTGCGCACAGGCCACAGCACGTGCTAGCGCACGGG
CCAAGTAGAAACGGGGTCGCGCCTGTCCTGCGCACTTGGTGCGCCAGAGGTGCGCCTACGATAAAGAGTGCCTCCCGCAC
TCCCTTAGAGTGCAGAAGGCAAGAATTAGCTATTGAATATACGGCTGCTTCCTCCTGTTAAGAAGATACCTCCTTGCCTG
CCTGACTTACCTGGCCTACCCAAGTACACCTTTAACAATAAGAAGAGAGCAATTATAACGCTGCCTTAAGAAGGGGACCG
ACGCAGGGGACGCGCAAGCTGTACGCAGTATGCGCATAGCGTATTAAATGTATATTGTAAACTAGAAGTAGTGCTTGTAG
CGTAGGCTGTGTAGCGCAGTCTACGCATAGGCTATAGCATGTGCTAGTATATAGGCTAAGTAGAAATAAGGTAGCGCCTA
TCTTACGCACTTAGTGCGCTAAAGGTGCGCCTATAATAAAGAGCGCCTTTTGCACTCTTTTAAAGTATAAAAGGCAAGAA
TTAGCTATTAAATATATAGCTACTTTCTCTTATTAAAAAGATACTTTCTTACTTATTTAACTTACCAAGCCTACTTAAGT
ATACCTTTAATAAAAAAAGTCTATTAAAACTTAAAAGTAGCTTTAGTTAAATATTATTTATAAGCAATTATTAGCTACTT
ACTATATAAAGTTATAAACTATTATATCAACTTACTATATAAGTAAGATTAAAAAAAAAAAAAGCAAAAAAGGTAAGAGT
AGTTTTATAAGTATAAATAAATTTATCTTAAATTATAAAATATTGCAATTTTTTTATTACTTTAAAGTAATAAAAAAGCT
ACGTTATTAAACGTTTAAATGCATCTTAAGAACTTACCTAATCTTACTTTAATAATAAGGTAAGAAACGTCTAAAATTAA
ATAAAAAGACGTCTTAGTAGTAAACTACCTTTACTATTTAGTAAGTAATAGTTTTATAATTAACAAGCAATAAACAGCTA
CTATTACCTTTATCTTACCTTGCTAGCAGTTAAAAGTTACAAGCCTTACGCTGCCGTTTTTAGTTAGCGTATACTATACT
TTTATATACCTAGTGTTTAAGGCTAGCTCTCTTATAACACTTATTAGCGGCAACTTAAGCGTTCCCCGACTAGGATCTAA
GCTGCACGCTTCCTAGAGAGCTCTAACGAACAGGACGACCTGTATATTAGGCAGGATCCGGCGTTTACTGCCGCTATAGA
CTAAGCAGTACGTGTACGCTTCCACGTTACCCAAATGCAGTCGTACAAGCAAGCGGTCCGCGACCGCTTGGCGACAGCCA
ATAACCCGGAGCGCTTAACTCTTTTTCCTAACTCTATAAAGAGAGGTTTTTTAACGAGCAAGTGGCTGCCGCGTGTGCAC
CTTTAGGCTGACGGGGGCGTCACCTAGGGGGGGGGGGGATAGTGTAAAGGTATTCTACACACGCGTCCCTACGCACCGGT
TCGGCAACCAGTCGCTTACCAAGCGACGGACTTAACGAACTATCTTAACACGTTGCACGGGACTGGCACAGCCACTTAGC
TGTGCCACGCCCTACTAGGGTTGCGCTACACCGCATCTTCCAGCCACGTATAAATTAGCTGGCAGGCCTTCGCCTACCGG
TCTCCTATAGTTCGTTAAGTTGAAGTCTTAATACAACAGTACAAACCAGTTAAGCCTTCGTGACCACGCATTGCACACCA
ACCCTTACATTATTTTAAGTAGCACGTCGAGGTTGTCCGCTGTTGTTAAAGGCGCAGCGCGCAAAAGTTAAAGCGAGCTT
TAACCTAAAATTAGAAATATTTCATCTAAAAACCAAACCCTATATGTATGGCGTCTTTGTTGCCAACAGCTCCCTTTTAG
GCGACATTTGTCACAAGCCTAACCTACAAATCTAACAGTGTGTCTTTATTGCACCATTGCCTCTATCGTCTCGTCCGACA
CTTCTTCCTCTTTTTAGTGGTGGTAAACTGTTAGTTAATAGCAATATATTATATTCCCTTCGCCGATATACTGGAGCTAA
GAGGAGATGTTTTCTGCCATAGACGATCTAAGCATTAATCGAGTGAGAAATTTAGCGAGATGTTGCAACAGGAGGCTAAA
ATAACGCATCGAATTAGAAAAGCTTTTAGTGTCACCGATCGTTGTAATGAACAACGGGACCGCCCTGTCTTCGGTACCAA
AGAAACCTCAAGTACCGGCAGACTTCGAGTTTCTTACCCCTTTGTATACGTTATAGCGCTAAACGATCACAGACTTAATG
AATGGGTAGAAGAGTAATCTGACTGCTTCTTTTCAGTTTGATGTGCTCTGTGTAGGCAAATTTTAGCAGTTTTCTTTATT
CCAATGCTTATTACGCTGTTGTTAAAGGCGTGATACTAAGGAAGTAGTACAGTACTACGTCTCTTTCAAACATTGACGAA
AAACAAAATTCAGTGCACATTATCTTACATTCGAATGAAGCACAAGCCTACCATTTATCATAAGAGAATGCAATGATACT
CAACTCGTGAAATGGATGCTTAGTGTGCTAATGGACAGCCGTTTTGTCGACTGGTTCGGAATTATGAAGTTTATTTTTCT
TGGCTATTGTGACACATCTAGCCGTAAGTTAAAGTCGCTGAAAACAGCAAAGGGGGGGAGGGATGGGCAGACAGGGTGCT
GCGTAAAGGCAGTATGTTTATATATCTGAGGAAAGGCGGAATACGCTAGGCTTAGGTAGGTGACCTTATGGATAGCCATT
AAGCTGGATCTCAAAATCATAAAAAAATACTACAGAATACTGCTGGAGTACTGGAAAGAATGTACCCGTGTTTGAATTTG
GGGTAGGCCAATTTTAGCTGCCAGTTGTTTTGCTTTTTGCTACTTGCTACGAGGTATTTTGACTCCAGTCTTGACTTATA
TGTCAAAATACTCTTGTGAAGCCCACCTCAACAGGTAAACAAGCTGAAAGGACGACATTAAATCGCGTTCATTCGTTGCA
CCTTGATTACGAGCAGCCATCGGAGAAAATTTGCAGCCACATAATTTTATTTGCAATAGTAGCAAGATCTTCCTGTTGAC
TAAGTCAAGACTAAACCTTGCTATGACATGATGGGTGTGAGTTGATTTATAATAGAGAATTGCCGATCCTCTTTTAATTC
GAATATTTCGGGTCAACCTTCTTACTATTAGGATATTATTGGTTAGTAAGAAATGGGAATAGGAAACGTTAAGTGAAATT
ACATACCCCGTCGCCTTTTCGAAGGCAGAGCGAGCACCATCGGTAATTTTCTCGCTCGTGTTGCGGTCAACGGAATGACC
AGACTTTTTAGAAATGAAGACGAAAGCCTTGACCCCGGAACGGTCCTTTTATCCAGGGTCCTGGGAGGGGTAATGGCCCG
TCGCCTGTTGGGATTGCTGCTCGGATGCCATGGTAATGTAGAGTAAATGCGGGTTACTGTGCGAAATATAGTATTTTGAG
ATGATAAGTAAAGAAGTTATATAGATATGTTGCGTTCTTGGGTACGACCAACACCTATTTATAATCCTTAGTGGTTGACG
AAAGCAAGTATTGCATCATAGCTACATGATAGCCATGACGTATTCGGAGAACCCAGTTTCCGTGGCGGACCTGCAGCCCT
CAGGTCTGAGACATAGTACCAAGGCTTTATTGATGACTAATAGCCCTTAGTACTCCGTACGGAGGTAGGCATTGTTCATA
AACGCATCAGTTTATAATCTTATGTGACGTTCTCCTCAGTCTATAATATGATAACACTGTTTTCTAACAGAAGTATGGAG
TACGGAGTAAGGAGACTTAATCTAGCAAACGAAAGAAAAAGAGAAAGAGCGCGCACGCGTTTAGATTCCCTTAGGTCACT
TGGCCTCCGCCCGGAATCACCAGACTAAGCCCTGATCTGCGCGCGCACGCAGTCTACGGAGTCGTAGCCTCAGCCACCTA
CGAAATACTCCGTATCGTCACTACCATAGGTGCGCGTTTTAAGCGAATTATATAGTGGGGTGTAGCACGAGTACTCCGTA
CATGGACACCATCACATGCTCTTGATTACAGCATTTCTTACTAATCAATAGCAAACTATCTTATCGTTGCTCCGACACCC
TTTTCTCCCAGCAATATTTTCTACAGCTGCCAGTTTGCTACCATAGCAACGCGGCTGCACTTGCCCTTCCGTACCCGGAA
CTATGTATTACTCAATGACCTCAGGGCTTATACTTTAATATATATCTTACCTAATCCTATTCACTCACGAAGAGGTTTCG
CAGTCGAACTATAGCCGCGTCTGACCACGCAGCAAGAGTTACGTCTAGAGCTGTGCTCTACGGCAATCCGACGTAACTTT
AAATCCACTACAAGCTGCTGAGTCCGCAGATTTGCGACTTGCGACTTGCGACTTGCGACTTGGAACCGGTCGCACCTCTC
GCGACATTCTATTTACGACTCGCCGCGACGAGCCTTCCTCTGCACAACGGGCAGCCGCACGGCTGTGAGCAGTGGCAAAG
AAAATGGAATTTCGGCACTACAGTGAGGGACCGGGATACTTTTTTTCTAGAGACATCTCTACATAGACAGAGAAGCGATG
ATAATTCATTCGGGAGTATGTCTGCCACGACAATGCCTCTCGATCTCTCTCCCCCTCATCGAAGCCAGTCTCGATCGTCA
TTCCAGCACGAATAAAAAACAACCACTATCCCTTCGACCAATGATCCCGATAGTAGTCTGTTGGAAAACTTGGACCTGAA
AATCGAAAAACCATCTCAGCTATCCCGCGACCATATTTTGAACGAGACCCTGCCCGATATCGAATCAAGTTTCGTTGTCC
CCATCTCGCCAATGCCGACGATTGTCAAAGATGGGCCTGACGACACGCACTTTTTTAATGTACCGCAAAAACCGACGGCG
ACGAAAAGTGAGGGCACCTCAGAGAATGATATTCTCAGACATAACACGTCTCCCCAGCAGCCGGCGTTTTCTGTTCCAGC
ACCGTCCCAAATCCCAGCAGTCTCTAGCTCAGATAACAACATAGAGCGCGCTTCGGAGAACTCTTCGTGTGCGTATGAGG
ATAGACCGAAGGAAAGTTCCACTAGTCAACAAAACCCGACAAGTCCATCACTACATAATGCTTCATCGGTGTTCCCGCAA
CATAATAGCCAGAATCCCGACTCAGAACGGGGCATATCGCAAGATGGGACGAGCAGCGGACTTCGCTTTGGGAAACGCCC
AAGATTCCTCAAGAGTCGGAATGCAAGTCAGAGGTCTTCTGCATCATCTGTAACCAATCCGGATTCTCACGATGATGTCG
ATAGCGATGTCACCATCGGTCTCGGAACGGACTACGCTCTACAGTCAGGGGGCGCGGTGTCTACGCTGTACACAAAACAT
AGTGCGAGCGATGCACTTTCACGCTCTGCCAGTATCATGAGTGTGGCTTCGACTGTAGACGGCTTCCAGAATTCCGCCGA
CCATCTGGAGGCCTTGGCTGGAGCTGGAAACCAAAAAGTCACGACTTCAGGAAGAGGCGATGAATATATGCAAACCCCCA
AAGCGAAGCAGCCTTTGGCACCACCTACGGACACCGTCCTAGCACGTCGTGTTATGGATGTCCAAGTTCCGGAATCGTTG
GCAAGAGAATACAAATCGAAGGGCGGTCTCACGACACCTAGGAAGGACTTCGGCGTGGGTGGTGCGCAGCGACCGGGACG
AAATATGACGTTGAAAGAGCAGAGCAGCACGATCGAACGATTATCCAAAGAAAACTTTGACCTAAAGCTCAAAGTCATGT
TTCTGAGTGACCGGCTGGACAAATTATCAGAGGACGGCATTAAAGAAATGATTCAAGAGAACGTTGAATTCCGTACCAAT
ATTGCTGTCATGCAGCGGGACAACAAGGCGCTGCGACGTCGTGTCAAAGAGTTGGAGAAAAAAATTCAAGATGAGAATGA
TAGGCCCGGCACGTCACGAAGTGCGACTTCGTCTAGTGGCCAGGCGGATGCTCTAGATGCTGATTTGCAGGATAAAGAGG
AGGAAATCACATATCTACGCGAGCGTGTCGAGGAGTATACTACAGTAATCGAACGGCTTCGCGCAGACCTCTTTTCACAG
GAAACAGACAAGCGGCGTATGGCTGACCTAGTCAAGTCTTTACAATCGATCGGCGAAAAGAACGTCGGTGATAGTTTGGG
TCGACAAGAAGAAGAAGACGTCTGGAAAGATTTACTTGAGCAGGAAACAGGAAGGCGGGAGCAGGCCGATGAAGAGAATA
GGAAGTTGCGGGATGACATTTTTCGCTTGAAGCAAGACTTCCACATCGCAGGCAACAATGGTAGCGGAAACCTTCACCGC
TCCACAAGCATATACAGCATGTACAAGAAGCCAAGCAACGAGCCACAAGCACAGTTTTCAAGTGCCCACGCGGACACCAT
GGGAAGCACAACGAGTGGTGCTGACACACTTGTCGAGGAGCTTCGACGAGAGAGCGAGCAGCTGCGACACGAAAATGCAG
AGCTACGCAAAGAAGTCGGAGCGCAAACATCGATGTTGACGTCACGCAACAAGGAAAAGGAACGTCTTTACTTGGAAATT
GAAGACCTGAAGATGGCCCAGCGTAGGGGTGGGGGCCCAGCGCCATCTACAGTGGACAGTTTTCTGGACCGGTCGGCTTC
TCAAATTGGTGCTCGCGAACGGTCCGCATCTCGAACGAGCGGTGATACAAGGGCCGAAACGGTAGTCGGAGATCAAGAGC
GTGAGGATCTTGAAAACAAAAATGCCACCCTGCGCGACAAGATTAACGAGGTAAAGCTTGAAAATCAGACACTGTTGCAA
GAGCTGGACACGGTCCTACAGCAGAAGCAAGAAACAGACGACGTGGCTCTGGCATTGCAAAGGGACTACGAGAATGCAAT
GGCAGACTTGATGGCAATGCAAGCCGAGCGTGACGAGCTGATCACAGAGCTGAACGACCTAGAACAGAAGCAAAACGGCC
TGCAGGGCGAGTTCGAAGACTTGCGGGCCGAGGCGCAAGAGGCAATTGATGGCTATGAAGATGAAGCTGATTTACGCGAT
GCTGAAACGCAGAGGCTGCAGGCAGAGTTGACTGAGCGAACGGAAAACTTCACCGCTCTGCAAGAAGAGATGCGCAAGCT
AAGCGAGGCTCTTGTCGGTCTCGAAGATGAAACAAACGATAAAGTACACCGCATCCAACATCTTGAGCAGGAACTTGGCG
ATGCGAACAAGGAACTGGAGGAGCTTGAAAGCAAACTACTCGAATCCAACGACAAAGCCCCACGACTTCTCGTGCAACAG
GAAAACAGCCAGGGCGAGATTGCCTTCCTTCGAGAAGAGCAAGAGAGCGACAAAATTACCATCAGTCGATTAGAGGTCAA
TGTCACAAAAGCCGAGGAGCTACACCGTGATGAACAAGAACGGGTGAAGCAGCTTCAAGCACAAATCATCACAGAACGGG
AGCAGAGCGAGAGCCTTGCCACTAAGGACAAGAAGGAGATGCAGCACTTTGTCAACGAGCTCAGTCGTGAAGCCTCAAAT
GCAAAAGAGGAGGCAAGGAAACTACGAAAAAGCCTCACCTCTCGTGAGGTGGAAGCAACGGAGTGGAAGGAAAGACTGAT
GGAGTTGGAGAACAATCTGAGAGAAGCACTCGGCGATCTGAGTGGGACTCGATCCAGTCTTTTGAAAGTAAGTACAGTCT
TCGGTGCAACTCTCCGCCCTTCCCATTTTCAAGTCCTGATCTGACGTTGTACTCTTATTAGTCTATCGCCAAGCTTCAAC
GCGAGCTGGAAAACACTGTTCGTGAACTCGACGCAACAAAGGCATCTGCAATGGAAAAAGACCGCCTAATCAAGCAACGT
GACGCTCTACTAGAGTCCCATGGTCTCGAGGCTCGCAAGGTTGCTGAGGCGCTTGACAAAGAGCGTGCAGTTCACCGAAA
CACAAAACACCAATTTGAGACATTTCAGAAAACACATCAACATGTCTCTCGGACTGTGTCGAGTCAGGATGCACGAATTG
TCGAACTCGAAACGACCAAGTCGCAAGACAAGCGACGCATCTCTCAGCTGGAAATCACTTTCAAGGAGCAGCTCAACGAA
CGGAACAATCTTCTACTTGTTTTGTGGACCCGGCTATCTGCCCTTTGTGGGTCTGACTGGGCACACGACAATAGCCTTAT
CAATGGACGGGGCCCCTGCCCAGCCTGGAAGCTGTTGCAACGATGCTCCCAGGCTTTAGCAGGAACCTTGTGGCTGCCAT
CAAGCATATTGAGTCCATCATCAGTGGGTTTAAAGGCCGTATCAAGGGCGTCGAAAAAGACCTCTGGCGTGAATACCACA
ATTTGGAAAACAGTCTTGAGATGCGCATCAAGAAGCTGGACCGCCTGGAGGGCATCGTTCGCAGCGGTCTTGCCTCGGGA
ACTTTTAGCAGCACTGAGCTCCAAAACCGCATGATGAGAAAGGAGGACGCTTATCGACAACTGAAGGTGGAAAATACAAC
CCTGCGGACGGCGAACGAGGTGCGCGTCAGGGCTGCATATTCGTCGGCAGATGGGGGCCTTGACAATGATCCTGGCCTTA
CTGGGTCACCATCGCCGTCGATTCCAACCGGGCCTCGCGAACGTACTAAAGCCGGAGGCTCTCTTCGTCCGAAGACAGGT
AGCCGGAGCGGTGTGCCCCGACCGACCACATCATCGCGGCCGATGACGGCCGGTGAGCTGGCGCTTCATGATGCAGCAGG
TGATGCGGGCTCTGGAAGCGATGGATATGGCGCTGATCCGCGGGGGATCCTCCGTTTTACGGGGATCTTAGAGAACAAGC
TCAAACTCGAGAGAGAGGGACGTACTATGGATCGGAACGAGGCCGTACGCCGGTTACGCGAGCAAGAAGCTGAGATAAAT
CGCCGAAATGAGAGGGACAGGAGAAGTGGGCGAGACGATACCAGCGGGTAAAGGTTATTGCTATTGTACAGCATGAGGAA
TGAACAGGTCACTATGATTTCCTTTTCCTGAATCGGTTCTGCTTTCTTGTAATATCCTCAGTCAAATGGCAAATGGTTTA
CTTTACTCGGCCTTCACCTGGGACGTACAGTCTTGGTTTGAAGGTTTCTAGGATACTGTATTGAAAACTTTTTAAGGGTC
AAGCGACACCATCTTATTAGGGTTTCAGTTAATGTAAAACAAAAGCTAAATAGGCTGTGCATCTAGTACGAAGTATAAAG
TATAAAGTACGGAGAACTCGTATACGTGCGATTGGTATCTCAGCAAAGTCCAAGCCTAACTGTTTCGAGGAGCCTTATTT
TTGCCTAAAGTACTCCGTAATGTAGATTTCCCAAGGTCACCTAACTTAACCTCGGCCGCCGAAATCACTAGATAAGACGA
AGCCCTAATCTGCGCGCACATTGCGCACAGTCTGCTCTTCAGTCAACCACCCAACAAAATATCATCACTAGATCTTCTAA
AGGCCTTAGAGCTTACTATGATACGTGCAACTTGTCCGGACGAATATCCTATAAGGATTACCGTACGGGTCTTACACTAG
TATTCGCGCAGACGACTGCGCGTAAGTGGGACCATGGGGGATTTGGGGCCACCCCCCCTATTTAGGCCACCCAATTTTAT
CCTAATACACAATACTATTTTACAAACTTCAACACGTCGTACGTCTACTAAAATCACTCCAATTACCTCCTTTTTTACTA
ATAGTATTTATTAGACTATTATGCGCTAGTATACTAAAAAAAAAATTGCTAACGTGCTTAAATCGCTTAATAATGGCGTA
TCTCTTTAAAAAGTAGCTATTAAATACGGCTTACTATGATTAACGCTTTAGTATTAATTACTTAGCTACTAAAATTACTA
TAATGCTTATTAAGATTAGTAAAGGCTTTTTAGAGTTTAAGAAGAGCATTTAACGTATTAGATTTATATTTAAGGCTTTA
TTAGAGTGCTTTTTACTTACTTTTAAGTTAAGGCTATAGCTTAAGCTATAATGCTTAGTAATAAAGACGTAAAACTACTT
AGGTAATACTAGCTATATGCTTTTTAAAGCGAAATCTTAAAATTTAAGTTTAAAAAAAAAAATTTTTTAATTTTAAGTGT
TTAAATAAAGCTATAATTAATATAATTAGTATATAGTTTTATTAGCTTTTAGTTTTTACTATAGTATTAATAAAACTATA
AAATAAATAAAATATAAATAAAACTAGGCTAGCTTAAAGTAAAGAAGACTTTTAATAAGTGCTTAAAAGATAAAATATAG
CTATAATTTAAAAAAGAACGTTAGTTATTACTTATAGACTTTATATATAAAGTGTATCTTTACTAGTAGTTTTAGCATCT
TTTCTTTAATTATTTTTAAGGGTAAAAAGGTATAGTAGTAGTAGTTTAGTTTTAAATTAAATTAATATAAAGACTAGTAA
TTTATAGCTACTAATAAAGGCTAAAGTATAAATAAAATAAAGGTTAGAAATAGTTAAAAAAAGGTTTTTTATTTTTATAA
ATAGCTTTAAATATTATTTTTTTAATATAAGATTATTAGTAGTAGATAGCTAATAAAAGCTATAAGATAAATATATTTAT
AAATCTATACTTTTAGTATAATATTTACTTAATTTATCTACCTTTCTATATATTTTACTATTTTTTTAACTATTTAATTT
CATTAATCTTTTTTTATAAGTATTAAAAATAAAGCTGGCTTAGTAAAAAATAGTAATATAAAAATAATTATTAATAAGTA
AGCTTTCTTATAAGCTTATAAAATAACGTAAAATAAAGCACTTTTTATAAAAAACATTTAAAGTAAGTAGCGTACTACTA
GTTTATAGCTAATTAATAAGCTTTATTTATTAATAAGCCTTTTTATCTTACTAAATCTTAACAACTAGCTATTTATACTA
AATAATTTTAATGTTATTAAAATTAATAAAACTATAGCTTTAAAAGATACTACTTTTTAAGCTATTATAATTATATAGAC
TACTCTTAGAAAGAGAAACAATTTAACTAGCTAACTAGCTAAATATTAGTAATTACATTCTATATTATCTTTAAAGCAGC
TTTTATTTTAAAAGCTTTAAAAAGCATTTAATAAAAAGGTAGTTAAAAGTACTTTATTTAAGCAAAAAAAAAAAGTATTA
AAGGCAACAATTAAAAGCCTATAGCTTTAGAAAAGAAAGGCTGTAGTTATAAGCTTGAATTTAAAATTTGCTATAATTAA
GAATATATAGAATAGCTAGGCCGCTATAGGAAGAGAAGTAATTACAGTAGGCGATAGCTTTAAAGAAGAGCTTTTAGATG
ATAGATAATTTGTATAATTTAGTTAGGTATTTTAATTGCTATAATTGTTTTTATTTTTGTATTTTTTTAATGCTATTAGA
TTATTATAATTTTTGGGTGGCCTAAATAAGAGGGTGGCCTAAATCCTTATAGTCTTACTTATAAACTAGTGGTGTATAGA
GTAGAAGCTATAAAAAATCGATTTTTAATACTAGTATCTACTAGATATAAGATCTACTGCTTAATTGGTAAAATACGAGT
TTGCTGCTTCTTTTCTAGCAAATTTGGCATCTATACAATTTGTTTGAATTTAATACGATTTGTTTAAACCCTTTTTTGCT
GTTATGCTGCCTAGAAAAGCTGCCGCTGCTAAGCCTTGGACCTTTAGACTAAGCAATAAAGGTAATAGCAATATTATAAT
TAGAGTTACCCTTAAGTTCTTTAGTCCCTAGCTCTTAGGCTAGCTTTTGGAGTACCTTAGCCGACTATTAGACTAAGAGG
CTTGTCTTTAGTCTTTAAAGGACGAAATAAGAACTTAAAACGTAGCTGCTAACAAATTACTATACGTATTAAAAAGCTCT
TTTATAGCAGCTTCTAGCCTTAATAACAGCGTAGGCTGTACCGGCCTTAACGGCACTAGCGCTGCTAGTACTAGCGCTAC
TTGCTTAAGCGCTGCCTTTGCCGGTACTTGCCTTTTCTTTTTTAGCCTTAATAATAATTTAAACAGTTATTTACTAAGCC
TAGCACTATTAACCTCTTTGCTTAGACCCTTCTTGCTACACCTTCTTTACTACTAATAATAAGACTATTTAAAAGCTTGC
TATAAGCTACCTTAGGTATACCTAGTAATATTATTAAGTTATATAGTTGAAGGAATAGCAGCGTAAGCAGCGTAGATAAT
AACGTTAATAGCAAAGGACTTTACTTTTAAATACTAATACTTTTAAGAGTACTAATACTAGCCTAGCTATAAGCGTACAC
TTAGTAAGCAACTAGTATACGCTATCTTTTCTTTACTTTAGTACGCCTTTTAAGGCAAGCCTTAAATTACTCTACTAATA
ATAAATTAAAAAAAGCTTACCTTACTCTTTTTTAATTAGACTAATAACTTAAAGCTATATATAAAGCTAAAAAAGATTTA
GAGCGAATTGCTTTAATAGTAAATTATTATTATAAAGTAGTATATATATATAAGCGTTAGCTGTATACAACCTTTTTCTT
ACTTATACAGCTAGCCTTAAAGCGCTAAATAGTATTACTTTGTCTTTGTAGTAATATTAAAAAGCAGCTTTAAGTAGTAT
ATTTAAAAGCAAGATTGTATAATAAACTTAATACTTAATAAAAAAGGCTTAATTAAATATATTAATAAATAGTATAATTA
GCTTACTTTTATGCCTTTAATGCTTAAGCTACTATTAGTTTATTTAGCTAATATAAAAGATATATTATTTTAAGTAGATT
AAAATGCTTTAAAATATATACCTTCTTTATAGACTAACCTTTATAGTTGATTAATATATAGCCTTTAAATAAAAGAGCTT
TATATAAATTTAATAGACTATTATTATGAGATTACTATAATGTTTAGTCTTTTTAGCTTATAAGGTATACTCTTTATGAA
TTCAATTAGTATAAAGGTACTAACGCTATTTAGTACTAAAGAGTTTAATTAGTAAGCTAAAAAAAAGGAAGGTATAATAG
TAGTTACGTTATAAAAAGCAGCCTAGTGCTACTAGTGTAGTTAAACTAGTTACTTTACTACTAACTATCCTTAGCGCTGC
TGCTTACTATATAGTAAAGATTTTCTTGCTAAACGTTAAAGCTTAAGAAAGAAAGTTGCTTTTAATACTAAAGTAATGTC
CTTATATAAGCCTTTTATAAAGAGCGCGCTATATACTCTTTATAACCGCTAAAGAGGTTAGTAAATTATAGACTGCTGCA
TACTAATTAAAAACGCTACTTTATATAATATAAAAAAGCCTTCTTTAGTATAAAGCTAATAGTATAGTAGAACGTTTTTA
ATACATTAATAATAAAGTAGATTAAAAGGAGTAAGATTAGGCTAATAAAGCTAAAATAAGCAATAGTATATAAGACTCTA
ACTTTTTATAAAAACCTACTAACTATAGTACTAACATTAACTAAAGAAGAAGCTATACTTACTAAATAACTTTAATTAGT
AAAATCTTACTACTTAGACTTCTTAAAGGGTTTTTTAAAGGTTATAACCTTTACTCTAAGTACATTAGTAGTATAGTAAA
GCTAACTAATATAGCGTAAGTGCTAAACGTTAGTTAAGAAGAATAAAATAAAAAATGTAAAAAAAAAACCGAAAAATAAA
AAAAAAATAGCTACTAAATATAAATTTTGGTATCTTTTAGAATAATAAAAGTATAGCTTATTAGGCTATTAAATCTTTAG
TGTAATACATATAAAATACGCGCTTATTAGCAATACTAATAGTGCTTTTAAGCATAAGCTTAAGGCTTACTATAATAAAG
AATATTATTATTAACTTTAACCTTTTTTTTAATAGTCTTAATAGCTTAATATTAAGCCTTTTTATCTTTCTTTACGTACG
TATTATGCTAGATAACTAAATACTAAAAGACGTTCTAATAAGCTAGTTAGTATAAGAAAAACTAGGTTTTTTATATAAGC
TTAAAGGTATAATATACCTTATATTACTAAAGGCTGCTAAAATATAGCTTGCCTTAAGCATTCCTCTTTACTAGTCTTTA
TATAAAAAAGTAGCGTATTATTATAGTAAACAAACCTTTAACGTTAAGGCTAGCTCTTTACTAGCGCTAAAAGCGCTTAT
AGACCTCTCTTTACTTTTAAAAGTAATTGCTTTTTAAGAAAAATACTTAAAGTTATTTACCTAAAGAATAAAGTAGTAGC
CTATACTAGGCAAACTTATTACGTTATTAATATAAAAGACTCTCTCTTAATACGTATAAGATTATAAGAATATAGTTTAC
TTTAATAGTTAGCAATATAGCTATTTATTTAAGATAGCGTTGCTAATAGTATTATATATAAGAGTAAGTCTTTGTAGTTA
TTATAAGCCTTAGTTATACTAAAGGCTAAGCTAAGTTTCCTTACCTCTTCTTAAAGCAAGTTTAATAGCTACTAACTATA
GACTAGCTACCTTTTAGTATTACTATTTATATCTATATTAACTACTAACTACTAAACTATTATATAAAGCGTTATACTTA
TTTGCTTTTAAATATCAACGGCAAGCTTTAACGTACTACTAGTAACGCTAGCCTAGGTGAATAGTATACTAAGGCAGCCA
CTATATCAACATCGTAAAACTCTTATACTAAGGAGTTAGATTAAAGTCTGCAGCGCGTAGTATGCCTTAAGCATACGCTG
CCTTATTAATAAATCAAATCTAACTTAGTAAGTAAGACTCTTAAGCTAAAGTGCCTTAGGCTGGTTATCTAAGCTGCTAA
GGAGTCTAATTAAACTACGCAATACAATAATATAGTAGTAGTGCCTATAGCAGCGTTATAGTTAGGTTGCGCTAGGCTGT
ATAAGTTTAGAGGAATAAAGCTCTTTTAAAGAACTTAGATTAGGTTGCTTAATAACAGTTAAAGATAAATAAAGGGGTTA
TAAAGTGCAATAGGGTGCTTAATTTAGTCTATTTAAATGGATGCGCTTATTTTAATTAGAGTGCTTATATATAGTAATGT
GTAATACGATAAGTAGGCTGCGCTGTAAGGCGGAATAACGTGCTTTTGTACTATGTAACGCAAAGGTTGAAAATATAAAA
ATAGAAGCAGAGTGTGTAAGATATAACGATGCTATGTTACTAGGCACTAGTAGTATACTCTTTCAAATCTTTAAAATAGC
TTTTAGTAGATTTTTATAAACCTTACCTTAGCTAAAAAGGTTACTTTTTTTACCTTTTAAGGCTTATATAAATTTAACGT
TATACCTTTTAGCTTAACTAACGTCTTTACTACCTTTTAGTAGCTAATTAATAAGCTAATAAAAGAGTATTATATATACT
ATATAAGTTTAATTAATAACCTATATATATTTGTAAACTTTTAAGAGAAGCTTTAAAAGTATATAAATATAGTGCTATAA
ACGCTAGATAAAGCTTATTTAGTTCTTTAACTATGCAAATGCTACTAGGTTATAAATAACATTAAGCTTTTAAGTATAAT
AGTTAACTCTTAAAGTTTATAAACTAATCTTTAAAACGTTGCTATAATTATTAACTAGCTAGTAATATATACAATTATTA
ATCTATATAGCTTTCTAAGCGCTATAGGTCACTATCATACATTTATAAAGCTTTTTGCCTAGATTGTACTCTCTTTTAAT
GCCCTCTTTATAGTTAGCCTTTAACCTAGTATAATAATAGTATTTAGCCTTATAGTAAAAAAGGCTATTAAAGCTTTAAA
AAAGGCTTTAATAATAGCTTTCTTGCTAAAGCTATTTAGCTACTAGAAGCTTATTATTATTAAAGTTAGTTTATTAAAGC
TATATATTAGTACTACCTTATACTAATTATACTTTAAGGTTAGCTACTTAAAGCGTACTATACTTTACCTTATAGCTTTT
ATAAGCTATATATTAAGCTTAATATAGTAGCGTTATTTAATATAAAAAAGAAAAGAACTTATAATTATTATAGCTTTACG
TAAGTAGCGTAGTTAAATTAAAGGCTTTAATATTACTATCTTAATAAACTATAAAAGCGTAGCTAGTATAAAAATAAAGA
CTAAACTAACCTTAAGGCTAATAAAGTTTTTAAATAAAATTAAGCACTTTAGTCTTATTATTAAGTAGCGCTTAGGCTAT
AAAAACGTTATTACTAACTAGCTATTATGCTTTTTTTAGGCAGAAGTAGTAACTTTGATTAAAGACTATAATAAGCTAAT
AAATCTTACTAGCATAAAAAGCTATAAGAGTAACTTAATTAACTTTACTAAGATTTACTAACTATAGTAGCAACTAATAA
AGCCTTTATTAAAAACTTTTTAATAACTAGTTAATAGAACCTTAGTATTACTAGCACTAGAAAAGCCTATGCTAGCTCTT
AAATCTAGCTTAATAAGGCTAAGTCTAAAGATATTAACATTATAGAATATTTAAAAGATTAAAAACGGGTTTCTGCCTAA
CTTATAACTATTACTAGCCTGGATTAAGGCTTACTTTAAGAATATTAATAGCGCTTTTTACGTTATTAAAGATAAAGACT
ACTTACTTAAGGTACTAGATTAGAAAAATTTATTATAGCGCTTTTAAACCTTATATACTACTACTGCCTTATAAAGTATA
TTTCTTAACTTTTAGCTACTAGCCTTTTATATATATAACGTACGCGTAGTATATATAAAAGCTTACTTATATAAAAAAGG
TAAAAGCGGCTAAATAATAGGCCTATAATCTAATATACCTTAGTAGTATTTAAGATTAGCTAGCTTTAGTAAAGCACGTA
TAAATAGCTATATAAGGCCTTTTATAAGCTAATAAAGCTACTTTTTATTACTTTAGTATTAAAGATTAAGTGCTTTAAGC
CTAGCCTTAAAGGTATAAGCATAAGCCTTTTTATAAAAGGCTGCTTTAAGTAGCTTAAGTACTTTTAAATAGCTATCTTA
AGCTTTATATGCTTAATAGCATATGGCTTTTAAACTTATAGCATTCTAATAACGTATTTCTAGCATATATATAAGATTAT
ATAAAGCTCTAGAATAGAGCGCACTATAATCGTTCTAACTAATGCTAGCAACGCGGCCTCTTATTAGTTAGACAGATATA
AATAGGGACTAGCCCTAGTAAAATTTTTGCACTAGTAAAGGCGCGCTATATATTCTCTCCTAGCTAGTTATAACACGCAG
ATTCTTAGCCATATTGTAAAGACCTTATATAGTGCACTGCTACATTTGCTATAAGCATTAGGTGTTATAGATTATAAGCT
TAGATACTGCATTTAGGTTTATTGTAGTAATTTGCGTTATCCTATAATAATTTTTGCCTTAGCGCACATTTTCTTTACCT
TTAGGCTTTATTTTTCGCCTTAAGGCATTATTTCTAAGATTATTAGCATTACGCGGCGTCTTAGCTTTATTAACTAACAT
TTAGTTAATCTAGGCTTAGTAAAGCTATAAATTTACTTAGGTGCTAGCATTTAGCATTATTTTTCCACTCTTATAATTTT
ATACTTAGATTAGCCTTTATTAAGACCTTTAAATAAGAGGCAGCTTATTGTCGAATTAAACCAATAAAATAGCATCTTTT
TAAAGCTTAAAAACAAGTAAAGTCTAGTAGATTAGACTGCTTAACATTTTAGGCATCTTTACTTATCCTCTTTTTATTTA
TAAGAAGAAGAGCTTTTTAACTTTAATTAGTTAACAGCTACTAAAGAGACTAGTAATGCCTTATTTAGTAGTCTTGCGGC
AAAGCGTTTATTTAGACTATAAACGCCCGTTAGACGTCTTATTAAAGCATTTAGTCTACCTTTTAGTAGAAGGCCTAATT
AAATCGTTGATTTCGGTTTAAAAGATTATAAAAGTAAATGTAAATCTAAGAACAAACTAAATTTTTAACATCTATAGGCT
TAACAGCAGCTATAATAACAATAACAACAAGCTATATTCTTTAGATCCTTATTAGCAGCTAGCATAGCACGCATTTAGGT
GTTAAGAGTAAGCTTTAAATCTTTTCTTTAAGCACTACTTTAAGCAAGTGCTTAAATTAATAAAAGCAGAGGAATTTAAC
AAGTAGGATAAAGCTTTTAAAAGAGGGCTAAGCTTAATTAGATTAACCTAAATTAAAGAGGTAGTAAGAGTAAAGGTAGA
GTAAGGCTTTAGCTTAAACTAATAATAACACACATACCTACTAACGTATAGACGTAATTATGCATAAAGAAAGGTGCTAT
AAAGTACCTTCCTTTGTTAGAAGGTAAGGGTAGTATATAGCTAGTTTAAAAAAGAAGGAGGAAGAAAGCTATATAAGCTT
ACCTTATAATCCTAAAAAAGATAATAAGATAAGCTTGCCTAGCAAAGTCTTAAGCTTATTCTATGCTTTATAAGTATACT
ATATGTCTTTATAACTAATTAATTCTATATATGTATGTCTGCTTATCTTTCTCTTTTTAAGGAAAAGGAAGAAGAAAGGG
TTTTTATATATATAGAGTATGTAAGTAGTAATAGAAGGCATAAACTGTTTTATATTTAATTAGTTAGAAAAGTAGGGTAG
GTTATATAACAATATAGCATTTTATAAAGGTTTAGATTTATTATCTTATATAGCTAGAATAGGTAGTCTTAAGAGTACAC
TTTTCCTTATTACTTACTCTTTCCTTAGAATAATTTATACTTTTTATTATAAAAAAGGGTAGGTAAAGAGGGATAATAAA
TTAATTAATTTAAAAAAACTATACTTAATAAGTATATATTTAATGTTTTTTAGTGATAGACTTTTTAAATATATCTTAAA
TTTAGTTTAATTGTTAGCTATCTTAGTATCCTTTTTAATTTCTTTTATATTATATCTAGCTAAATACTTATTAACCTTAG
TATAGTAATGTTTAGTAAACGTTATTTAGCTAGTTTAGCGTTTTAGCGCTATTAGCGTAACTACTATTATTTTCTTTAAG
CCTAAGGTAGAAAGGGAAAAAAGCTATTTTATTTAATTTATCTTAACTATAATATCCTTAACTTGCTTTGCTGTAGTTTT
CTTAGCTTTATTATATAGGTTGTTTAGTATAGCAGTAGTAGTATTATTGTTTAAGCTTAGTTTATAGCTGTCTTTATATT
CTAACTCTTATAAGCTATATTTTACCTAATTGTTATTTTAATCTTTATTACTAACTATTCTTACGTTTAATATATAGCTA
TATTTTGTTTGCTAGTTACAAGAGATAGTTTTAATAATGTTTATACCTATAGTATTAATTAGCGCTACTAAGGGTAGCTT
TATAGTAGAAGTAATCTTAGTAAAGAGAACTATTTTTAAGGTAGGCGCTAGGGTAGTCTTAGCTAATTAGGCTTGCTTTT
TTTTAGTTGCTAATTAAAGTACTTATTAAAAGATTAGCATAGAAAGCTTAGCTAGTCTCTTTTACGCTATAGTTAGCTTA
ATTAGTAGTTTAATAAGTATAGTTGTAACTAAGGTTTTAGTAGCTAGCTTAGCTATAAGTTAGGCTAGTATAGACTTAGC
TAGTAATAGCTTAATTAGCGTTAATTTAGTAAGCGTAAACTTAACTAGTAGTTGTTTCGTTAGCATTTACTTAGCAAAGG
CTTGCTTAACTAGCGTTTTAGCTAGCATCTAGGCTACTAGCTTAGTTATTAGCATAATAGCTAGCTTAGCTAGTATAGTA
GCTAGCTTAGCTAGCGTAGCTTTATCTTTACTTAAGCTTTAGTATAAAACTAGATCTTAATATATAAACTATCTTACGCA
TAGAGTATAGCAAAAGTATTAGTTAATAAACATATTAATCTAAGTATTTAGTTTTTATAAGTTAATATGTATAGTATTAT
TTAAGTAGGCGTTTTACTAGCTAGCGTAAGCTAGGTTTATACTAGCTATAACATCTTTAATATCTTTTAAAGGTAGCTTA
AGAGCAGTTTTAATTTAAGAACTAGTTAAGCGCTAAAAGTCTCTTTAATTCTTTAAGGCAATAGATAATTTATAAGTATT
TTAAAATGTAAAAAGGCCTTATATTAAAGTATTTTAGTTTTAAATAAAAGCTAGCAATCTATAAAAAAGAATTATAGCCT
AACCCTTATCTTTTATTAAAACTTTAAAAAGACTTTATAATTAAGAAAGAGTGTTTATAATCTTATAAGCTTTAAGTTTC
TCTTAGTATTGCATTCTAGATAGTAAAGACTATAATACTAGAAGTTTACTTATAATACGCTAGTGCTATTTACTAGTTAT
GTTTCAATACTACTATTAGCTTTGTACTACTAAATAAAGTAGCTAGCTAGCTTATCTTTTTTTATAAAACGTGTTTGTTT
ATACTATTATACTAGTAAATAATTATTAAAGGTGTACTTAGGTAGGCTAGGTAAGTTAGGTAAGCAAAGAGGTATCTTCT
TAATAAGAGAAAGTAGCAGTATATTTAATAGCTAATTCTTACCTCCTACACTCTAAGGGAGTGCAAGAGGCGCTCTTTAT
TATAGGCGCACCTTAGCGCACTAAGTGCATAGGGCAAGCGCAACCCTGCTTTTATTTAGCCTATACGCTAGCACATGCTA
TAGCCTATACGCAGACTGCGCTACGTAGCCTACGCTATAAGCACCGCTTCTAGCCTACAATGTAGATCTAATACGCTGTG
CGCATACTGCGTATAGCTTGCGCGTAGCCTGCGTTAGTCCTCTTTCTAAGGCGGCGTTATAATTGCTCTTCTTTTATGCC
TTACTCTCTTTAGGCAGGTTTGAATAAAAGGCTTGCAGCCTTTATTCTTAGTAGTAGTAATGCTTATCCGTTTATAGCGG
CCCCTTTGTGCTTACTAAGATTGTTATTAAAGGCAACTTAAGGCGCCTTTAAACATTTTATTTAAGAGGTTAGTCTTATA
GTTAAATTAGATTATTATAGAGTCTAGCATCTAGTTACTTCTTTAGAAATAACAAATTCGTCTTTTAGTAGCAATATAGC
TACTCTTAATTCTAACGCTTTTATACTTGCAGTAAGCGCCTTTAGCGCTCTAGTACCCGTTGTAGCCCTAGCCCTTACTT
CTTAACACCTTTTGCCTTTTAGCTAAGGTACTAGTTTTAGCTGCGCGCAACGTGCGCGTAAAGCTTATGCTAGCCTAGTT
TGTTGTTTTACGCAGACTATAGCGCGCGCTATGCCCTTAGTTAGGCCTTTAGTAGCTTGTTAAGGTGCAAGAGCTACCCT
TACTAGTCTAGCGCTCTTAAAGTTAGTAGCGGCTACGCTACTAGCTTACCCTTAGGTTGCCTTAGATAGCTTGTTATGCG
TATAGTGCTTATACTACTTTCTAATAACTTTTTTTATGAAGTTACCTAGGTTTGTAGCTATACTATATATTTATAGCGTT
GCTAGCGCTAGGCGCTACGACGGCTACTATGGAAGCAAGTATAAGTGTTATAAAGTAAGTTTTTTTTAGTAGTTATACGC
AGCTTTAGTAGCTAATAAGATGTAGGTTTTCTTGCTAATAGTTAGTAACTAAGCTAACTTTAAGATAGTATTATATAGCC
TTAATAAAAATCTTTATAGCTAAGGTTTGCTTATAGTGCGCGCAATACTTATGTATACTATAAGTGCTTATATTACTACT
TTATTATAGGTAGATACGTAGTAGTAGTTTATATTACTAAGAGTATTATTAGCTGCTAATATTATATAAGTAAAGCTTAA
TCTTTATTAAGGTATTAAAGCTTAAAAAAAAGCTTAAAAGGTAGCTTAAATATACTTACTATTACTATATATACCTTTTT
TATCTTTACTACCTAAGCCTAATACTTTAACTCTTTAGTAGCTCTCTTAACTACTATATCTAATGCCTAGTAATACTAGT
TATACTACTCTTACTATAGCCTTTAATACCTTCTTTAAAGTAGTAGCAAAAGCGTATATTATAAACAAAGCTTATACTAA
GGTAGTAGCTAGCATAGCGTTACTTTAAAAGCTTCTTAAATAATTTTATATGGCTTTTTATAAGGCCTTTTAGCTAGTTA
AATTAATTTAAGCTTTTGCTTATATATTTTTATCTTTATACGCTTACTGCGCACATACTGCTTAGTTACTATATACGCAT
TTTCTATATCTTCTTTTAGCACTTACTAGTTATATTTAGTTAGCTAGCTTATTTAACGTACTAGGTATTTAGTTTAACTA
GCTTTATATCTTTTATTTAAGACTACTTCTACTTTTTATTTATCATCTAAGTCTTTTAACGCTAGCATTATTAAAGGCGC
TTATTCTATACCTACCTTACTCTCTTAGTACTTGAATAGTAAAACTAAGAAAACGTTATATAGTTAGCTAATATTAATTT
TAGTAGTACTAGTTAATACACTTATTTACCTATAGTCTTAAAGATTTTAAAAAGCTTAATGCGTTTTAATGCTAACTTTT
TATTTTTTAAGCAAAGGTTTTTTATAAAAAGGCTTACTAGCTCTTTTACTATAAATGTAAGGGTTAGTATACAATGCGTA
GTTATAAAGGCTTAACTAGTTTATACTATTATATTAAGACTTTAACTTAACAAACTATAGGAGACTAGTAGGCGAAGGCC
TGCCAGCTAATATATACGTAGCTAGAAGATGTAGTATAGCGCAACCCTAGTAGGGCGTAGCACAGCTAAGTAGCTATGCT
AGTCCTATATAACGTGTTAAGATAGTTTGTTAAGTCTGTCGCTTAGTAAGCGACTAGTTGCCGAACTAGTGCGTAAGGAC
GCGTGTATAAAATACCCTTATACTATCCCTCTCTTTCTTAAGTAACGCCCTTATTAGCCTAAAGGTGCATACGCGGCAGC
CACTTGCTTATTAAAAAACCTCCCTTTATAAAGTTAGGAAAAAGAGTTAAGCGCTCTAGGTTATTGGCTGTCGCCGAGCG
GTCGCGGACCGCTTGCTTGTACAACTGCATTTAAGTAACGTAGAAGCGCACACGTACTGCTTAGTCTATAGCGGTAGTAA
ACGCGGGGAGCGCCCTTAAAAAGGGGCACGGGGTTATCCTATTCGTTAAAGCTCCCTAAAAGGCGTGCAGCTTGGATCCT
AGTTAGGGAACGCTTAGGTTGCCGCTAATAGGTGTTGTAAGAGGGCTAGCCTTAGACACTAGGTGTATAGGGGTGTAGTG
TACGCTAACCGAAAACGGCGGCGCAGGGCTTGCGACTTTTAACCACTAGCAGGGTAGGGCAAAGGTAATAGCAGCCGTTT
ATTGCCCGCCGATTATAGAACTGTTGCTTACTAAATAGTAGAGGCAGTCTGCTGCTAGGACGTCCTTTTATTTAATTTTA
AACGTTTCTTACCTTGCTGTTAAAGTAAGGTTAAGCGAGTTTTTAGAATGCATTTAAACGTCTAATAACGCGGCTTTTTT
GTTACCTTAAAGTATAAAAAAGCAGGTGTATTCTATAATTTAAGACGAATTTATCTGCACTTATAAGACTACTCGTACCT
TTTTAGCTCTTTTTTCTTTAATTCTGCTTACGTAGTAGGTTAATGTAATAGTTTGCAACTTTGCGTAGCAGCTAGCTAAT
AATCGCTTATAGATAATATCTAACTAAAGCTACTCTTAAGTCTTAATAGACTTTTTTATAAATATAAACCTTATAAAACG
CCTTTTCTAGGCATATATACTATCTTTTAAGAGCGTAGGTCTTTGCTAGCATAGTGCTTGCTAAGTAATAGCTAACTTTA
TAGTAAGCGTTATGTTTAAACTACGTCTTCAAGGCTTATCTAGACGTTTACTATAAATTTTTATATATAGCTACGCTAAA
GAACCTAGCGCGCTACGTTAGTTATATAGCTAATAACACGTTATACTTACTAGTAAGTACGTTAACTTATATACGCTAGT
AGCTAATTACTAACTAACAGCTCTCTAAAGAGATTAAAGGCTTAGCTTAATACATTTAAGAATTTCTAGCCAGCACAAAC
AAGTTACTACTTTAGCGGATAACGGTTAATAATATCGTTGTAGCGCTAAGCAATTACGCGGCAATCACCTAAGGGTTAAT
AGCTTTAACGGCAGTAACTAAGGAACTTAGCTGCGCCTTATAGGAAGATAAGTTAAAGCCCCTAGCAACTAACTAGCGCT
CTTAGCGCGAACGTTTTAAGACGGTATAATAGGCTGTATTACGCCTTAGTGTCTTTTACTAGTACTAGTAAGAGCTAGAG
CTTACCTTAACGCTTGCATAGTAGTTAGCAAAGGTAGCCTAGCTCTTACCGCTAACGTTCTTAGACGTAGGCATACTATT
ATAGGCGTAGACCTAAGTTACTACTACCTTTAAAGTAATAGCAAGTCTTTTTATCCTTATTATTAAGTTATTACTAACCT
ATTACCTAGGGCGATCTTTATTCTATTATGCTTAGCCTAGCCTAGCGCGCTACGGCTGTTTAAGCCGGCTATAGCGGCAC
GCTTTACTATACTATAAAAGTAGAGGGGCTGCCTAAGCGGATCTTATAGACTATAGCGGCCTTAGTTAAGCTAGCTTAGA
TTAACTAGGTAGTAGTCTTTCCTTAGCTGCTACCTTTAGCGGCGCCTAGCAAGCAATAGTCTTGCACTAAGTTGCTAACC
TTAGCTAAGCGCTAGTATAGCGTTAAGACTATTCTTAGTGCTATAGCTAGCGGTAGTAAGGCGGTTATAGCAGCTAGTAG
TAGTAGTATAGTAGCATTTAGTAGAAGTGCGCTAGCAAGTAGCTAGTTAACAGCTAGTAGTAGCTATATGCTAGCTAGTA
AAGGCTTGCTTAGTAGTAAGAAGAGGAATAAAAAAGACAGTGTTAAAGAGAAAGATAAAAGGGTAAAGGGGACGTTTACA
AAGAAGGATAGTAACGAGTAGCTAGTAGCTAAGCGATAGCCTACTAATAGTGTATTTTAGGTTTATAGCTTTAAGTAGCG
CCCTTAAAGCTAGAATAAGTAGTTTATAGTATATAATTATATAAAAATAATAAGAGTAGTTAACTAACGATTAGCTTATA
TGTAGCTAGCTATTACTTTATAGTCTTTTTATTTCTTATAAGTGCGCTTTATAGTCTTTTAGTAAGACTGCACCTTATAG
CTAGCGTGCGCTAGGTACTTTTCTAGTTCTTAGGTATTATACTTAGCCGGCTAGCCTTTCTATTTTACTAAGAACTAGGT
TTATAACCCTTTACTAAGGTAAGTAATAATGTCTTTAACCTTATACTCCTCTTAGTCTTTTACTATTTTTAAAAATAAAA
GCTCTTTCTTAGCTTTTACTATAGCGGTTTACGGCTTAAAGCAAGAGACGTAAAACACGTTGTGTTAGCGTGCGTACTAT
AATAGTAAGGCGACCTAATACGTAACTAGGCCTAGCTTCTTTATAATGTAGATATGTAAAAAGGTTAGGTTTAGCTTCTT
TAAGCTGGCTAGGTTTAAGTGCTTTATTAACAAACCTATAAATTTACCTTTAATAAAGTCTTTATATAATCGTTGCTTGT
TATAGCCCTTCTTTTGTTAGCAAATCGCTTTTTCCTACAATACTTCTAGCTTTCGCCGGACAGCCTATAGCCGACTAATA
CGCTTTTATACGCCCTTTACCGCGGCCTTAGTAAAGAGGAAGTTGTTTATAAAACAAGGGTAGTATACGTACAACGCATA
GAATAGAGAGGTCTTTGTTATAGTGTGGCGGGCGTTGTTATACGTAAACTCTGCCGTACTTAACACCTGCGTTTACTAGT
ATTATAAACGACTATAGAACGTTTGTAGAAAGCGCTGTAAGGTCTAGTCGCTACTTGCTATCTACAAGCTAGGAGATAAT
GCTAAAGATAGCGTAGCATAACGCATTTATTTCTACTTATATAAGCTTTGTGTTATTATAGTAGCAAAGAATTATTACTA
TTATAAATGCTATTTTTAGCGATTTAAAAGTAACCTTTACCTCTTTAGTTAATATAAATAGTTGCATAGCAACGGCTTTA
CGCTTACATAGCAGACTAGGGCCTATCTTTATTAATTCTATTAGGGCCTATATAATATAAGAGTAGTAGAAAATAAAGCG
TCTATAGAAGTTTACAAACCTTAAGAAGGATTATACATCTTATACGCACTTAAAGGCCTTTTATTTAATAATAGCTTTAA
CCTACTTAGGGTTTATAGCTGGCCTCTTTATAGTAACAACAAACTTTAAGAAATTAAATTCTTCTTTAAAGAATTTATAC
TTCTTAGGATTTGCATATAGCTACGCAGCCTTTAGACGCTTAAAAACTAATTAAAGGTGCTTCTTATACTTCTTCTTAGT
TTAAAAGTAGATTAAGATATTATCTAGGTATACCTTATAGAGTATACCTACTAGCCTTACTAGTGCGTAGTAAATATATG
CTTAAAATGTAGCTAGCGCGTTAGTTAGTCTAAAGGGTATAATATAAAACTTAAAGAGCCAATATTTCGTTTAAAAAGCA
GTCTTTTACTAATTAAAGGCCTTAACCTAGATCTTATAGTATGCTTTCTTTATATTTACCTTAAAGAATACCTTTATACT
ATCTAAGCAATCTAATAGCTTACTAATTAATAAGAGAAGGTAGCAGTCCTTCTTAATTACTTAATTTAAACCCTAGTAGT
TAACGTATATACTTAAAGTACTATTCTTTTTTAAGACGAAAATTACTAAGGCTTTAGCTAGACTATTGCTATAAGCAATC
CGCCTATTTGCTAATAACTTATTAATAAAGCGGTAAAGCTTCTCTTACTAGGTAAGAGATAGCAGGTATAAAGGGCTATA
TAGCACCTTTACGCTATCTTTTAGCTTAATTAAGTGCTTTACGTCCGCTAATAAGGGTAGTTCCTTTACCTTGTTAGTAT
TAAACACTTTAGCAAACGATTGTATATAAAATATTAGTAAAGTAAAAGAATAATAATAAAACTTAAAGTATATTATTAGT
ATCAATATTACTATTGCTATTGCTATTGCTATTGCTATTGCTATTAGTAGTATTATTATAGTAATAAAGAAAATATAAAG
TAAAGAGAGATAAAGACTAGTATTTATATATTTTATATTATAATAAAAGCTTTAAGAATAATTACTTATTAGTTACTACT
ATAGTACTTTAGCACTTGTGTAATACTAGTACTAGTACTAGTGTTAGTATACTACTCTAGTTATTAATAGTACTAGTACT
AGTAGTAGTACTGCTAGTATTTTTCCCAACCTTGCTTATAATAAACTGGTAATGAATAGCCTTAGCTTTAATTAATTTAG
TATAGATATTAGCTAAAAGAATTGGCCATACACTACCGCTATTTTAAGCTAGTATATAGTATACCTTTATATACTAGTAA
CTAAAGTTAGCCTTTTTATACTACCTTATTAGACGTAACCTTAGTGTTCTTTAACTTATAATGTAAGCTATAGGCCTTTT
ATAAGCTTTTTAAAAGGTAGCACGTTTACGTTATAGCTTAGTAGTGAATAGAGTAGAAGCTGTATTGATATAGTTATGAG
GCATAGCTCTTTATTATATATATGCAATTTACAATAACTTTAGTAAACGACTAAACTAATAATATTTATTAGCTTTAGGT
AGGTAAGATAATGTCCGCGTCCTATATCAGGGGTTTTCTTTAGCGTGTCTTTATATCTTTACCACTATGTAAATTCGAGC
AGTACTTCTATCAGTACTAACGGTCGTTTTGACAGGCCTTGAAACCCTATGTTGGTTAAAAGTGATTTTGCCACGGTTCA
GACCTAGTAAGTGCACCGCGGGCAAGTCTGACTAAAATCCTATCTACCTCGTATACCCGTATCATTTCATTTGTTTCACT
ATACGAGTATACAGAGTACGGAGTACGATATCATATAGATAGGAAGGCATTTCGGTCCGATTTTGTCTCTTTCCTTTTCC
TTGCTAGCTTCCTCGTATTTTACTTATTATTATCATATGTTGGAGGCAGCCATACTCGGTACAATCCTAGTTACCGTAGT
ATTGTAAAATCAAGCTACCAGTAACTCGTATTAGCCTGTCCACATTTGCACACGCCCTCGGCTACTCCGTACGTCGTAGG
CAAGCTTTTCAACCAGTATTATTTGTAATGCTTACGGAGTACAGATAAAAAAACCATCTACGTCGTATAACGACAAGTCT
CTACGGAGTTCCTATAACTGTATCATAGCTTGTCGGCTATATAAATGGTGCATCCAATACTCTAGCATGCATAAACTATC
ACTCCTAACACATCGTTTTCTTGCTCATCTGACAAAATGGTTTTCTTAAAAAAACCGATCTTAGTATGGTCCTTGATGAT
AAGTGTGCTTGGACGTATATCGACTGCGGTGGACGTTGAATAGCAAGTGATACCCTTTATTCCCACTACCCTACCCCTAC
CGAATCTAACCACAAATAGCGATATCATTGTTGTTGGAGGCGGTCCTGGCGGCATTGTCTCGGCAACAAAATTTGCGGAA
GCTGGGCTTAACACGCTGTTGCTTGAGCATGGTGGCCCTATGCTGTGGCGCGATGGAAATCGTGAGGTTCCAGCTTGGAC
ACAGAAAGAATACCCAAACAACACGTTAACCAGGCACGATGGCATGGTCTACTACCTGGCACCTAGCGATGTGAACTACT
ACTGCCTTAATCTGCCAACCGGCCAGCGTGCAGCGTGCCAGCTAGGTGGTGGCACATCTGTTAACGCTATGCAGCAATGG
TGGCCACCGCGCGCCTACCTTGAGAACACATTTGACTTTGACGGATGGACTGTGGCCGACTTCGACGCGGCAATTCATAG
AACGGTTAAGCGCATCCCCCACACACCATATTGGTCTACCGACAACAAGGTAAAAAATACCAAGAGCTTTGTATGCCGAA
GTTTACTAGTTTACTGCAAGCTGACAGTGCGCTAGTTTTATCAAGACGAGGTGTACGGCCTGATGTCTAATGTGCTGTCC
TCTATTGGTCTCAATGAAGTGAATAACACAGTAGATGTGGACAACAAGTACAATACTTTTGGTCGCGACATGTTTGCTCA
GGCAGGTGGCCAGCGAGGAGGGCCGTCGGTCGGCTATCTACAGGATGCTAAGCGACATCCTAATTTTACACTAAAGCTCT
ACAGCCCTGTCACACGGGTTGTTCGGACAGGGAGCCAGATCACAGGCGTGTATGTCAATGGCACGATTATCAAGGCCAAG
AATGTCGTCCTCTCTGCCGGTGTTTGGAACACCCCCGCTCTACTATTTGCCTCTGGCATCGGCCCTGTGTCTGAGCTGAT
TACGGCAGCTGCCATCGGCTATACGCCCTACGAACAGAATGAGTGGATTATTAACAATGCCGTTGGAGCTAATCTGCACG
ATAACCCGACCGGCCTTGTCAGCTTCACATATAATGACACTAAAGCCCTGCCATACTATAACATTACAGGTTTCTACGAT
GGCAGCAACTACATTAAAGCCGACGCGGATTTGTTGTTTAGCCAGCGTGCAGGACCGCTTACAATTGTGCCACGCATCCT
ATGCGGCTGGATTAAGGTGGCTTACCCTCTTGATACGAGCAAGTATATGAACATTCAGGTTATTTGTTCTTCTCCGAACG
TCGAGGATGGCTCCTTCCAATGTCAATTCAACCTAAACGAGGGCGCGCTCAGCCGTGGCCGGATCACTCTCAATACTACT
GGCACGCTAAGCTTCGCCGATGGGGCGGGGCCTTGGTTGACCGATCCTAATGGACTGGATGTGGAGCTCTATGCGCAAGC
TCTAGAGCGGTTCGTCAATGGTTCTAGTAAATACCCTGGGCTTACTGTGACCGATCCCGTCCCTGGCACTATCCAGTCTT
ACCGTGAGTGGCTCGGGGAACACGCGAACAAAACCAACAATCGTAAGTGGCTATTCGTCCTCCGCCGTTTTGGTTTTAAA
AATATTTGTGCATCATTTCAGTATGGCTAAGAATTCTAGACTGGGGTGGTTCGTGTACAGTTGGAACAAGCGATGGCACC
AAATACAACAACGGCTCGTGTGCCGACATTAACGCAAAGGTCTACGGCACAGACAACCTATTCGTCATAGACGGCTCACT
AAGCCCAGCGCCAACGACCTCCAATCCAACGTTTCTATACGAGGCAATGGCGGAGCTTGCCAGCGAACGCATTATCAACC
TACTAACGGTGAACAGTTAGCTATAGCAGCGGTATGCAGGCGTTGTATCCGTGTATATGTTTGCAAGATATTCTGCATTT
ACTTGTCTAAAGGATTAGAAGATCGGTGTCCTTTCGTATGTACTAAATTTTTTTTATAGAAGATACGGAATAGTAGGGTG
TTGAATAATATATTTACTATACAGACGCGGCGGGCGTCGTCCTAGACATTGTTATAGCTACATGTTCGCACTTTGGCGTA
TTGCTGCACTGTTAGTCTAGATGTGCCGGTTGTTGCCGGGAACTGTCCTAAACAATTCCATGCTAGTGCGGCCACAACAT
TGCTATAGTGTTTGTGGCTACGGAGTACGGAGTACTTCTCCCGTTTTTTTTAAGCAGCCTACCGGAGTAGCCCACCGGAG
CAGCCCATCGGGCACTAGTTGAATTAGCCGGACTCCGCCTCGTGTTAAGCATAGGAATATGCCCCACTTGGTCGTACAAG
CCTGTGATTGGTCAGAAGGCACAGACGCGGGGTATGGCACTAGTATTAATACGGACCCCTAGAAGGGTCGGAATATATTC
ATTTCTTCCTTAGCACACAACAATTTTTGCATACTCTGTACACCTTACCTTATTTAGCCTTCTGCTCCTTTTAGTGCAAC
CCGTTATATAATTGCTATGTATTGCCCCTTTTAAGTTTTATATAAGCCTAGCCTAAGAGGACTAGGAGAAGCTAAACTAA
ATTTTTTATAATACGCTTTGTAAAGCCTTAGTGCTTTAAGCACTAATCTAACGGACGAAAGAGCCTTGTTAAGATAACTA
AGGTTATATTCATAATCTTGGCTAGCTAGAATACAACATTTAGCCGCAAACTAAGCAGTAAATCTTTAATTGTTAAATTA
AGTGCCAAGTATAAGTTAAGTAATAAAAGTAGTATTTATATAGCTAATAAGAGCAGTATTTATAAGGCTAAGCTTAATAA
AGACCTTTAAAATAATAAAAACAACGATAGTAGTAAAGAACTAAAATAGTAGTTAAAAGTTTTTAAATTGTTTCTTAAAA
TTAAAAAATTAAAAATTAAAACCTGAATTATAGTATAAGTTAGTATTACTTATAATTTAATTTAAGCTAAATTAATATAT
ATTAACTTATTTATAAGCTATTACTTAAAGTAAGTACTAAGGCTGACTATAGTATAAGTTAAAATAAGTAAGAAAAAACT
ATTTTTAAAGGCCTTAGCGTAAACTAATAATATATACTTACTAATATATATACCTATATATATAAAGAGGCACTATAACG
CACCTTCCTATACAATAAGCTAAGGTTGTATATAGTTAGTTTAAAAGATAAGAAGAAAAGCTTTCTAAGCTTATCTTAGA
ATCTTATGAAGGAAGATAAGGTAAGCTTGCCTAGTATAGTTATAGGTAGAAGTGGATAGCGCTCTTTTAAATATATTAAA
AACTTGCCCCACTAACTAGATTTCCTAGCTTACAGTATAAAGGGGTATGTTATCTTTAATAGCTAATACTGTATTAGGCT
GTAGCTTAATATAAAGCCTTAGCCCTACCCTTAGTATATTCTAGAAGGTTATTCTTACTATAGCCCCTCTTACAGCCACC
GCCTATAGGCTATATATAGCTTACTAAGGACCTTGCCTACTACGTAGAGTTACTAGTAACTTACGCAAGTAAGGACGAGA
GGCCTTCTTTAAAAAGAACTTATAAGATAAAGAAAGAAGAAAAAGGAAGAGACGTATATTAAAAGAAGATAAAGCTAGCT
TACTTATGTAGATATGTCTTCTTCTTCTTCTAGAAACTTGGTTTTTAACTAGTTTAATCTACTTAATAGTAACTTTTTCT
ATTAGGCTAAAAGTCTCATATAAAACTAAGCTTAATTGTTTAAACCTTTTTAAACATCTTTAACCCTTTAATACGTTTAG
AAGTAATTATAAACTTTAAGCCTTTATTATACTTCTTTAATTTTTAATATTAAAAGCAAAGGTAAAGTAAGGCCTTTACT
TAAACTAACAACAATACATACACGTAACTATACACAAATAAAGATACTGTAAGGCACCTTCCTTTATCAAAAGGTAGGGC
AGTATATGGCTAGTATAAAAGGGAAAAGGAAGGAAAGCTATATAAGATTATTTTAAGATCTTAAAAGAGATAGCAAGACA
AGCTTGCTTAGTAATGTCTTAGGCATAGTCTTTGCTTTATAAGTATACTATATATATATCTTTATGACTAACTAATTAAT
TGCGTGTATACATACGTATCTCTCCCTTTCTTACAAAGAAGAAAGAAGAGAGGGTTCTATATATTTAAAGTATATAAGTA
GTAAAAAAAGGTATAAATTTTTTTATATCTAATTAATTAAAAAAAGTAAAGTTAGTTATATAATAATATAACATCTTATA
AAAAGTCTTAACTTATTATCCTACATAGCTAAAATAAGTAATCCTAAAACTTTACTTCTCTTATTACTTACTTCTTCCTT
AAAACAATTTATACCTTTTACTATAAAAAAGGGTAGGTAAGAAGAGATAAGAAAGTAACTAATTATTATAAGGATAAAAG
AAAAGCAGGCTATACCTAGCAAATATATATTTAAGAAAATTAGTACTTTGTTCCTTAAATACATATGAAATTAAGTTTAA
CTATTAGCTATTTTAACATTCTTTTTAATCTTTTTAGTATTATATTTAACTAGATACTTATTAGTCCTAGCGTAGTAACG
TTTAGTAAATATTATCTAGCTAGTTTACTCCTTTAGCGCTACTAGCGTAACTATTATTATTATCTTAAAATTTAAGGTAA
AAAGGGGTAAGGACTATTTTATCTAATTCAATTTAACTATAATATTCATAACTTACTCTACTATAGTTTTCTTAACTTTA
CTATATAAGTTATCTAGTATAGTAGTAATAGAGTTATTGTTTATACTTAGTTTATAGCTCTTCTTATACTTTAACATTTA
TAAGCTTTTCTTTACTCAGTCTTCTTTTATTACTTTACTTATTATTCTTATATTTAACGTATAGCTATACTTTATTTATT
AGTTGTCTTTATTAGATACTATAATGTTTAGACTTATAGTATTAACTAGTATTATTAAAAGTAGCTTTATAATAAAAGTA
AGCTTAATAATAAAAGCTAACTTTAAGGAAAGCGCTAAGGTAATCTTAGCTACGAAGGCTTTTTTTCTTTAGTAGTAGAT
TAAAGCGCTTATTTTAAGGTTAGCGTAAGAAGCTTAGCTAGTCTTTTTTATACTATAGTTAGTCTAACTACTAGTAACGC
TGGCCTAAGTATATAGTATACTAAGGCATCCACTATATTAATATTGTAAGTCTCTTACACTAAGGAGTTTTATTAAGCTA
CACAGTGCACGATGTGCCTTAGGCAGCTACAACCTTACTAATAAATTAGATCGAACTGAGTATAAGGCAGTTATAAGCTA
AAGTGCCTTAGGCAGGCTACTTAAGCTACACCATATAATAATATAGTAATAGTACTTATAGCAACGCTGTAGTTAAGTTG
CGCTAAGCTAAGCTATATAGGTTTAAAAGCATAAGGCTTTCTTAAAGAACTTAAATTAAGATGCTTAGTAAATGTTAAAG
ATAAATAAGAGGATTATCATGTAAGATAAAGTTCTTAATTGCTTTTATTTAAACAATACGTTAAGCTTAATTAAAGTGCT
TATATATAGTAATGCGTAATACAATAAGCAGACTACGCTATATAATATAAAGGTTAAAACTTAAAAATAAAAGCAGAGTG
CGTAAATAAGTGCGTAAATATAATAATGCTATATTATATACTTACTAGACTATTATATTAAAGGTATATAAGGGTAGTTT
AATTAGTAAGAGCCTTTCGTATCTTAGTAAAAGACGTAGCTAACTATTTAAATAGTATATAATGTATTATAGTAAGAAGT
AAGTATTATAGAATAAACTAAATCAAGTAAAAGTAAAAAGAAATGATAGTAAAAACACTAACTTTTTAAGCGTCTTAGTT
AAGTAGTTTAATTAGTGATATAAAGTAATTTAGTATTACTTTACTTAAGTAGTTTAAATATAGTGTATAAATATTTAAAA
ATAAGATAAAAGAATAAAACAGAATAAGTAAATAAAAGTAAAAGAAAATAATAATTTAAAAAGAAACTTTAAATATAAAA
CTTAACTATACTAGCTAAGCTATATTTTTCTTTACCTTTTCCTTTATTTTAGTCATTAGTAAGTTGATTAACTTTTTTTA
TATATTGTAGTTAGTTAGCTAAAGCGTAAGCTTCCTTACTAGCCTACTATCTAAGCTAATAAGGCTAGTATAGTAAAAAG
TAATATAGCGTAAGTAATATAATATATTTATATATTAGTATACTCTAAGGTAACAAAGGTATTATAGTTTATTCTGCTAT
TATCTAATTTATATACAAATGTTAATAATAAAGTTAGTCTTAACTACTTTAATTGCTTTATTAATAGTATTAAAGAGTAT
AATAAGGCGCTATATCTTTGCTTACTTCTTTTCCTTTTAAGTCTTACATAGCTTTAAGATTATCATAGTATAAGAGTATT
TAAATGCTATTAGCTAGTAGCTTAGTTATATAGACGCTATAGCAATCTAGGCTAGCTATAGCGTATCCTATTAAAGGCAT
ACTTAAAGAAAAGCGTTAAAAATCTTATTAAAACTTACTACCTTATATAAGAAAGTGCCTTTAACAACTTTAGCAATCTT
ATCCTTAGTGATTATTTAAGATATAATATTCTAGGCCTAGTTTACTAGTTTAAGTTAAAAGGTTTTGCTTATAATATTAA
AAAGAAATAAGCTAATAGTTCTTTTATCTTTTATCTTTTTATTATAATTACTTATTATTCTATTTACTTTATATAATAAA
GAAAGGTATATAGCCTTTATAGGCCTATAGCTATATAGTCTTACCTACTGTTTCGGGCGCTAGGCTAAGTTCTTACCTTC
TAACGTAGCGTAGACTACACCTTGCTAGTAAGCTATACTTATATCTTAAAGCGTATATGCTTAGTTTTTACGTGCTATCT
TAATAGTAGCGGCTACTTTATTACTTCTTTATTAAGCTCTGTTCGTCCTTTCCGCTGCCTAAAGGTTATAAGTGGTAAAG
TTATAGTTTATAGTTTATTCTCGTTATTAGTAGCTAATAGCTAGTCCTTTAGTAAGGGTTATAGTAAAGGCTATACTATA
ATGCAAGCTAACTAGCTTATTTGTTATTTTTTTAATCTCTTTTAGTAAGGTGAAGGTGTTAAAGACCGGTTTGAAAAAAA
AAGAGGCAAGTTTAAGAATATACTCTTTAATAGTATAGAATTAGCTAAAGCCGCGGCAGTTAAAGAGCAAGTAAAAGGTA
TTAACTATGCATACTTATAGTTAGTAGTTAGATCTAGCAGAGTTAAAGGATAAGCATATAGCTTATATATTTACAGTTAC
TTATATGTAATCAATAATAAATAGTTGTCTGTTACTAGTGCTATAGTTATAATAGGTATATTTGCCTAGTAGCGTCTATA
CTAGCTAAAAGAGAAAGAAGGTTTATACTTGTAAGTATAAGTCTAAGCTATAAATATTATATATATACAGTAGCTTAAAG
CAAAAAAGAAGGAAAAAAGGATATAATTTATAGTATTAGTAAGAGTTTATAAGCTAGCTAGTATATACTAAAAGATATAA
GCTATAACTTAGCCGTTACTTAGCTAAACCTTAATAAACTAGTTAATTACTACGCCTAGAATATCTTAAGTAGATTAGTT
ATACTATAGGTTTTAAAGAAGAAAGATATCAGTGCTATTATATTTTGCTTAGTATAATACTTTAATAATACACTACTTAT
AGTTAAAAACGGTTTATAACACTATATATATAAAGTAAAGTAAAAAGAAAGGATTAAGTTTAGTACGGCCTTTACTACTA
CTATTGCTATAGTTTAAGCTACCTTTATATTTTTATCTTATACTACTTTTACTATGAAATATTAAGAGTAGTATGCTAGA
TATAATCTAAGGTAGTTTAAGCACGCTTCTAATTTTAGTATAGCTATATAACGCTAGCGTTAGTAGTCTATACTATAGTA
TGCGTATAGTTAAGGTTTGTACTAGTAATCTACTATATATCCTTACATCTAGCATTTATAATATATAGATAGTTTATTAT
TATAGTATAGGATAATCTTATATATTATATATTCTTAATTATTATATAAACTTTACCTATAGCTACTAGAAAGGTAGTAG
CTACTATAATATAAAGAAATTTAATTAAAGCCTTAAGTCTTAAGCTAATAATTTAAGTATTATTTTTAACTTAGTTTTGA
AGGTGTATAGACTAAAGAACTACTACCTACTAAGATATTATATATAACTATATAAGTAAAAGTAGTTTTTGGTTAATGCC
TTAGCTTATTTAGCTATATAATATCTTATTTAAACTAGTATATAGCGAATATATAAAAGACTACTATAATATCTTTATTT
ACATCGTCTTAAATAGCTTATACGCAAAGTTATTTAAGCTAAGCTACTATTGTATTAGCTATGTTAATAAAATATATATT
TATTAGTTACTATCTTTAAGGTTTTAGCTATTATTAAAGTTATTATACTTACTATATCCTTATAGTTATCTTCCTTTTTT
AGGTTTAGTTTGATTAGTATACTATATTAAGCTAGTAGCTAATTATAGGCATAGTAGTATAGTGTATAGGTATAAGTGCG
TATAGTTATAAGCATTTAATCTATATATAAAGTTAGGAAATATACTAGTAGTACTACTAGTAGTACTTATACTGCTCTAG
TATAACTAGTACTAGTACGGATAAAAAAGCTTTTATAGTAATTAGTAAGTAAGTATTCTAGAAGCTTCTATAGTAATTAG
TAGGTAAGTAATGTAAAAGCTTTTATTATAATATAAGATATATAAATACTAGCCTTTATCTTCTTTTACGTTACGTTTTC
TTTATTATTATAATAAAAATAAAAATAACAGCAACAGTAACAGTAATAGTGATAATATACTTTTAGGTTTATTATTATTC
TTTTACTTACTAGTAAGTTATATTATATTTTAATCCCTTCTTCTACTTTACTTTAGAAGCTTTTAATTTATATATGTTAT
ACTACTTATAAGTTATAATATAGCTTGTTCCTTAGTTTATTCTGCTTAATATATTTTATGCAAAAACGTAAGCTTATATA
TTACTACTTTTAGTTAAAGAATAAGTAGTAAAGCTTATAAATAATATAGTCTATAACCTTTTATAATTAAAATGTATTAA
AAGGGTATATTTATATTATATAACTTACTAACTTTTATTAGTTAAAATAGACTTTAACGGCTATACAACCAACCTTAACT
TTAAAGTTACTTCTTCTTTTATTACTACTTCTAGTAATAAAAGAAGTAAGCAGAATACTTCTTATAATAACCTTAATTCT
ATCTTAGATACTTTTAAATTAATAAGTTATATTATTAACTATAGGTTAATTATACAGACTTTACTACTTTATAAAGTTAA
ATAAGGAAAGAGAAGTATTAGTAAAGTGTATAACGTAAGCAATACTGTACTAACTAACTAACTAACTAATACGTATAACT
ATAAGAAGGTTAATACGCTTATAGACTTTAAAAGCTTAAAGTATATAAAACGTTATAAACGTTTTATTATAGCCTTTAAT
AAAAAGGCTAAAACTAAAAAAGAGTAATAAACTAGTAAGTTAATTAATATTACTTTACGTTTAATTACTTTACTAATTGA
ATTAAAAGAAGAAACTATGAATAATAGCCCTTTAAACTTCTTTAATTTATAGTCTTAAAAATAGGCTTAAACAAATATAG
ACGTTAAATTATTTATTAAAGACAACGTTTATAATAAAATTCTTACTTTTATTATAAAGAATAACTTATCTTTTAATATA
CTTAACTTTAATTTGTTTAAAAACCCTACTAAGTTAATATATCAAGTAAGTATCTAAAACACTAACTAACTAATTCATTG
CTTAACAAACTTATTATTATTAAGGCTAGCTTCTACAATTAATAGGAAAAAGGTTAAGGATATACTAGATAAAACGCATA
AACTTAACTTAATAAGCTTAAATAGCAAATTAAAGGAGAATATTAAAACGTTTAAAAGCTTTTCTTTAACGTTTAATACT
TAAACTTTAATTTATAAATAGCTTACTTTAGTATTATAATTGCTTATATAAGCTTATTAGTAAGTTATCTTTACTTTACC
TTAATAACCTTATTAGTTACTAAAGTATTAAAAAGGCTTTTATAAATTAAGCAATATATATACTAGTAAATATATTTATA
ACGAATTTGTAAATATAATAGGCTATAGCCTAATGTAAGTCCTTAGCTCTGCTCTCGGCCTAGAATAACTAGGTTAGTCA
AGGCACGTAACCTGCTACGTACTCTGCCAGAGACTATAGTAGGATACCTTAATTAAACACAAAAACTAAAAAGCGCTAGT
TTACCTTTTAAGCCATTACCTTTTAGCTATAGACTACTCTACGCTATGATTGTTAGTAACTTACTTAGACAAGAAGTAAG
AGCTAGTTAGAAGGGACGTAGGCTTACTTATATAAATATCTTTCGTCTTTAGCTTAGTTTTTAACTAGTTTGATTTACCT
AACAGCAACTTCTTTTATTAGGCTAGACCTTTATAGTTTTATTCTTTTAGTTATAACTTCTTTCTTTAGACAAATCCTTA
TAAGTAGTTAACGTATATATATAAAGTACTATCCTTCTTTAAAATAAAGATTACTAAGGCCTTAGCTAAACTATTGCTAT
AAGTAATCTGCCTATTTGCTAACAACTTATTAATAAATAAAAATAAAGGTTATTATTATTTAGTTTACTATTAGTTAATT
TATATATAAATGTTAATAATAAAGTTAATCTTAACTATATTAGGTTTAAGTAAGCTGAAATAAAACCCTTTGGGAAAAAA
CCAATATAGCTTAATATAAAAGCAAGTAAGGTTATATATAAGTAGTAAAGAAAAAAAGAAAAAAGGAAAAAAAAAGAGAA
AAGGTAAAAAGAGGCTATTGACTTTCTAAGGTTGTATAATTAAGCAAGTATTTCTTTACAGCTTATATTTAAGTTTTTCC
GTTCTATCCTAAATGTTAAGTCCGCTACCCCTCCTTCTAACCACCTCCCCCCCCTTCTAACTATTAATTAAATTAATCTT
ACCTACTCTTTTACCCTGCTAGTCTATTAAAAAACGCACCTACCGCAACGCTAATAATAGCTTTTAAAAGCTAATTTCTT
ATACATCGTATTCGTAATGTCTTAGTACACTAAAAACAATATAAATAACGTAAAGAGAGCGTTAATAACAGCCTTAGCGT
GCAAAATGCCGCTGCACTTTACTGCGTACTATACACCACCCTTTAGGACTACTTAGCAGGTACATTAACGCGCTAAAAGG
GCACTAAAAAGCAGCAGGTTATATTACCGCAGCTAGAAAATACCTTGGTGCACTAGATTACTATCTAAGCATAGCTAAAT
GCTTAGTATTGCATAGCTTTTGCTAGCTACTAAAGGATGCCTTTAATAGCTTAGGAAGTCTTAGAAGGCTAGTGTTTTTT
CTAAGGTACCTAGAGATTAAGACTTTACGTAGGACTTTAATTAAAAATCTCTGTGCTAATAGTGCTTTAGAGTTAAATAT
ACGTGCATTTGTTACTACGCTTTAACATTTAACTATTTATAAACTTCCTCTTGAATACTAGTATAATATAAATAGAACTA
AGCTTGCTAAAGGCTTTATAAAGAATAGCTTAGTTATTAGTAAGGCTAGAAAGAGCTTAAAAATTATAAAAGCAGTAAAA
AGTTAAATATAAGTAATAATATTTAAGTATATTTTAGTTATTAGTAAAGCTCTTTCTTTTTACGTTATTTTACTAGTAAG
TTATTTTACTAGTAGTACTTCCTTGCTTTTTTTAAGGATAAATATAATAATTAGTTCTCTATAGTAACCAGGGTTAGGAA
AAGTACTAGTAGTACTACTAGTAGTACTTGTACTACTCTAGTACAACTAGTACTAGTACGAGTAAATACTAGAGTAGCAC
TATAACACTAGTACTAGTACTAGTACGACTAAATACTAGTACTAGTACTAGTAGTACTTAAGTACTAAAGTACTTTAATA
GTAATTAGTAGGGTTGATAACCTTCTTATTAATATATTGTTCGATAAATTAAACAAAGACCTATATAACGATTCTTTAAG
CAATAATTTAAACAACGATTTAGAAAAAGATTTATTTATTTTAAAAGCTGATTTAAAAGACGAATGTATCTTATACCTTA
AAGAAGAAGAAAAAGGCTAAAAGGTAAGTTAAATAAAACCCTTTTAATATAAAGTATATAATAGTTAACTAATTTATTAC
TAGACTAATCCATTAAAGTACTAAGCTAATAGTGCTTTAAAATACCTTATTTTAAGCATAATAGCTAGATATTACCTAGC
TATTCTTACTACTTTAAGGGCTAATAAATTACTACTTTAAGGGCTAATAAAAGCTATTTCTTAGTAATAATGTTATTACT
AAGCCTAGAAATAAGCTTCTTCCGGATATAGCTAAAAAGATTCTTTTATTAAAAAGGTAGAAGATTAAAGATTTAAATAA
GTTTAAAAAGAACTTAGGTTTAGATAGTAATAAGTATAGGAATTAAGAACTTATTAGTTAGTTAGTTAGTTAGTTAGTTA
TTTTTACTTACTTGCTTATTATTTCTTTTTCTTTTAAATACTATTGCGTACTTTATTTATTATATACTTTACTATATTAT
TATATACTTTCTTAATATTATTATAAGTTAAAAGCTACTAATACTATAAGTAATACTAGTACACTAGTACCGCTAGTACT
AGTTTTAAAGTACTAGTTAGTACTAGTGTACTAGTTTCCTAGCCCTAATAATAAATAACTTAAGCTAGACTAATAATAAA
CTTATAGTTAACTAGCCTATATTTATCTTTTTACCTTTTACTCAGCTAAATAATATAAACTAATAGTAGCTACTAGTTCT
TAATAGTTATAAAAGCTATATTTCTAATTATTTTCTAATTAAGTATATAAATAATAAGGTTTAGCTTATTATACTCTTTA
CTTACTCTTTTCATATTACTTAGCCTTTTAATATAAGCTGCTTTTGACTACTTAAGTTATAATACTAATTTTACCTCTTT
AACCTCTTTAACCTTAACAATTTAAACGCTACTTATAAGCAAAACTTTATCTATTACTAATTAAAGACTAAATAAGACGC
CTTAATAAAAACAAATATTAAAAGCAGCTAAAAGGCTATAAGACTATAGCTAATATCTTTAAGCTAGGTGCTTTAAAATT
TATTTATTTTACTATAAGCACTATATACTCTAGCTATATTAAAGACTCTTAATATACTTTATACTACTTCTTTATACTAT
ACTTAATCTAGCAATATTATTTTTAATATAGTATCTACTAGCTAACAGATGTTATAGTAGATTACATTAGTAAAGAAAGA
GAGTAATTTAAATACGTTTATATAGTACCTTCTTTATAAAGCTAGCTACGCAATTAATTTAAAAACAGCTATAATAGCCT
TTTAAAAGTAGCAAATTAACAAGCTAAAAGTATTATAATTAGCGTAAAAGGATAGTAAGCTCTGTAAAGTAAAGCCTACG
CTAAATAAGTAGTTTGTACAAATTTAAGAGGTTGTAGTAGTAGGCTAGGCCGTCTTTCTTACCGCTAAAGTATATTTAAG
CTATACTATATTATATAGCTACTAGGGTAGGCAAGGGTAGTCGGCAAGGTTAGCCTAGTAGTTCAAGATAACGTGCTTAG
CTATTTCCTTTAAGTGTTTATATTAGAATTAAAGGAAACTTTGCTTAATGCTAGTAGTATATGTATCTAGTTAGCCTAAT
ATAGCTGGTTTAAATCTATATAAGAAGGCTGCTTTATGCTTTAGTAAGGTAGTAGTAGTAGCTTTAATATTGCTATAGTT
CTTAAAAAGGCGTTGTTATAGCTAGTATTTTTAATATATACTAGTTGCTTTATTTGCCTTTTATCTTCTTTACTGTTCTA
TTAGCGTATTATCTTTAGTTTAGCCGGCAAAGATTATAGTAGCGCTAGCCGTAAAGTTTATATTGCTAGCTAGGGTTAAG
GCGCGGCCGATTACTATACTATTTAGACCTATAGGCTAAAAGTATTAGCCTCTTATTTATATATAAGGTTAGTAAAAAAT
ATAGCTAAAATATAATTAAAGTAAAGATTAAGTAGTATAGTATATACTTTTGTGTAAAAAGCAAAAGTTATAGTAAATTT
ACATACCTTATTAACTATGCATAAGTATCTATAGTATATAGATTAAAGGGCTAGCGCTACGCTAAATACGTATCCGCCTC
TTAGCATAGGTTTATAAAAGACTAGTAATATATAAGCGATTATACTCTATAGTACTACTAAGCAGATCCTTTAAGCCTAT
AAGAGTATTACGCCTTACATATTTACTGCTAGGCGGTAGAGTACGTATCTTTATATCTATAGTTTCTCTTATATAGCTGC
TATATACACTTTAAACTAAAGTTTATAGTCTAGTTAGATGCTAAGGAATTAGGCGCTTTTCTTAGGCTAAAGAAAGACGT
CTAGGCTTAATCGTAGACCGGTAGTAGGGGCGCTGTGCTACTAGGAAAAGTAGAGGAGTTTGCTCTTTGCTAGAGCAAAG
ATTATTCCGCGCTAGGCCGCCTATAATTATATCGTCTCTTATATAAATGCTAGTTTAGTTATGTAAATATTAGTGGTAGG
ACTAATAGCTAAAAGGTTTGTGTTGTTTGTGTACTTAATTGCTATTATACTAATAAAGATAAAGGTAATTATAATATAAT
ATTCTATAATTACCTTACTAATAGTTACTAAAGTAACTAGTATAAAGGAGAGACAAATATAGCTAAACTGTTAATGTATA
ATAGTAAGAAGTAAAGTATAAAAAGCCATAAAAGCATATAACGTAAATAATAGCTATAAACGTTTATATTATAAATAAGT
AATATTTAATATATAAAAAGTAAAAAGTAAAAAGGCTAATAAAAAGCATAGCTTTACTTAAAGCTAGCTATACTAGCATT
CCTTTACTAAATTAATAAACTTAATATATGTTGTTAACTAGTACTCCTTTAGCTAGAATAAGTATTAGATTATATAATAG
CCTTAAAACTAAAGATAAGCGCTTTAAAAAGAAGAAAAGGTTATAAAAAGAAAAAGATACACTAGAGTATAAGATGCTAG
TCTAATTTAGGAATAATTAAGTAAGCTTACAATATAGAGTATATACATGCTACGCGAGGCCTAGTAAGGCTAAGGTAAAG
TAATTAGCAAGTCTTGCCTAGTAGTAAAGAAAGTACCGCTAAGCCTTGCTAAAAGCACTAAGCTATATTTAGTAAATAAT
AGCGAATAAAAGGGATAGCTCCCGGAAACGCTTGTTAGGCGCCCTTTAGAACTCTGCCTTGCTAGACCGCTATTACGGCA
TATATATGCTTTGTAATTGCTTACTTTTAAATAATTATAAAGGGGTAAGACAATGTTTTACTTCTTATTCTTTTATACCT
CTTGATCCTGCCTTTTATCTTGTTATAAATTGTATACTTATAGTAGTACTCTTTATATATTACTATTATGGCTTTGCTTA
TTAAATACGTTTTAGTTAATATAGTTTAGTTTAAAAAGGATAAAAATAACTTACTAAGTAAAATTTAAGATATCTTTACT
AAATAAGTAGCTAAACGTAGGTAAGATTAAGATATATATAAAGACTTTTTATAAGAGGTTAATATAGTAACTAACTAAAT
GTTTAGGAAAATTATTTTACTCTTTTTTTAGCGTAAAGGGTAAAGAGATAATACTAGTAAAGTTATTAATAATAATAGTA
TCTATTATATTTTTATTATTATTAATATAAATTACTTTAACCCTTTATAATCTTAAGATAATAAATAGCTAGAAAAGTAA
AAGATTAAGTAAAGTAAAACCTTTAGTATACCTTACTACTATTAAACTTGTATATAACTTAATACAAAGCTTTTAGTATA
ATCTAAATAACGCTTAAAGGAAATATAATTCTTATTAAACTTAAGCACTTTAGAATAACCCTTAGTAGTTGAATATGAAA
TATAATAAACCTTTTATTAATATTCTTTATAGCCTAACTAGTAAGGAATTAAAGACTATCCGAAGTTAAAATACTGCTTA
AGGTTTATACTAAAAGATATTAATTACTTTAAGATATCTTAGATAGTATCTTATAAGTTAACTTAATCTTCTTTAATATT
ATAAAAGCCTTTAACCTTCCTATTATACTTATTAATTCTATTTTAATTAGCTTTAACTAATTATAAGTCTAATTTATAAG
CAAAGTAACTATAACTATATCGATTAGTAAGCACTTAATCCTTATTTACTTATTTATTATACTCTTAAAAACATTAAAAA
AGACACTTTTACTGAGAATCCTTTTATACTTAATATAAATACACTAAACTGTGCAATTTCCAACCTTCTCGCAATGCTGA
CTGGTTGGAGCCGACTTAACAATTCCCTGATGCTGGGCCGCCTCCTCGCCTGCTGTGACGGCATCAACGTCGCCAAATAT
GCGGTCCATGCGCTCGAGGGCAACCCCCTTTGTCTCAGGCAGAATATAAATAACAGAAATCAGACACAAGGTGTTTAATC
CACACAGAAGCCAGTAACTCATGCCTCCCACTTCGCGGTTGAAGCGCGGCCACGGCTGTGTGATGGCCAGCAAACAGGCC
GTTTGACCAAGAAGCGAGAAGCCAAAAGCCTTATCCCGCACTTCTTGTGGAAAGATCTCCGAGGCCAGCGCTGGCGGCAC
AGGGCCGTTGGACCAACAGTAGGTTAGGCCGACGATGAAGAGCATTGCGACTTCGATAATGGCCGCCGGCTTGTTGTCAT
TGTGGGGGAATGCAGTCGTCAAGGCAGACATAACAAGTAAAGCGGTGGCTTGGATAGCAAAACCAGCAATGAGCAGTCGG
CGCCGCCCAAAGCGATCGACGGTAAATGTATTGACTAGTACGATCAAAAGCTGCAGTACCGACTGGATTCCATTGATGGC
CAGCGCCTGGTGCCCGGCGTCCCAACCGAGAGATTTGTAGATATAAACAAACTGTCAGATGGAAAGGAAAGACGAGAGGG
ACAGGAAGAAACTCACAATCGTTGCATACATTGTCAGTGCTGCGATCCCGCCAGCTTGCTGCAAGGCCGTCGCATATAAT
CCGTAAGCGAGCCGCTTGCGAAGGGCTCGCGATTTGAAGATTCCCGTGTAGCCTGTGTTGAATTTTTTGCGATACTCGTA
TGAAGCCACAATATCGCGAAATTCCTGGTGTACGTGGTCCGATTCCGGTGTGCCCATACGCAACTTGCAGAGCGTCTGCA
GGCAGCGGCTAGGGTCATCAGGACTCTTCTCATATAGCCAGCGAGGTGACTCGGGGTACCAAAAAGACACAACGATAAAC
ATGAGGCCGACCGGGATTTGGATTACGTTGGATACGCGCCATGCAATGTTAAATGGGTGCGTGTGAAATGACATGCCGTA
ACCGGCCCAGAAGGCAATGAGCGTCCCAAGCTGGTAACCAAATTGGGTGACAGTGCCGACAAAAGAGCCGCGCAGCATTC
GGGGGGCACATTCAACAACTTGAGGCGTTAGCAAATATATACCTAGAAGATGATAGATGAGATGCGTTTACCATAAAGAC
TGGTTGAAATGTAGATGCAACCAAACCCGAGGCCACTAACAACTTCTTAGTAAAACACAAAGATCAAAATTCGGGCGACA
CCTACGTCAGCAACCGACCGCAAATGAGGACAGCGTAAGTGTTTGGTACCACTTGCACTACCACGCCGATGACCATAATC
TTTGCCAGGCACAAAGTCAGTCCACATTCCGTGTAGAAAAAACCAATACATACCCCGATAGATATCCTCAGAGCCCAAAG
CCGGCCCACAGCGTTAGCCAGTGGGCCACCGATGCAAAGCTGGGCCAAACCGGTGCTCGCCCAAGGAATTGTGGCTATGA
CACCGCTTCTCGTACTATCAACATCGTAATATTTGACGAACTGAAACTGCGTTAGTGCTTGCACGATGCAATTGTACATA
GAGCTCTCACCTGGTCGTCGGCCAGAATGACCGTCATAATACCAGCATCATAGCCATTAAAGGCTAGGCTGAAAACCATT
CCGTACAGAATAAGTGCCGCATAGCGATCGTTAGTAGGGAGAAATGTCTCGACGATACCCATATTCTGTTAGTGTTTGTT
GGAAATTTAGATGCACGAATTTACAACAGAATCACTACAAAAGTGAACAATTTGAGAAATATGCGCTTTTTGAGACGAAC
TTTCCAGACACCAAGCACCCTCGCTACTTCGGTTTATGGCGTGGGAGAGATTGTGATATACAGTGGTGATCTGGGTGGCT
TTGTGGCTCCGGTGGGAGAACCTGCATATAGCAAATTCGCCCTCCCACCGGAAGCCGGAAGCGGAGACGGCAAAATTTGG
ATTGGGGTCGTATCATATAGGCTAATGGCGAACGCGGATAAGGAACAAAGAAAATTTAAAATCAGAGACATGTGCAGCTG
GCAGAGAATATAGATACAAAGCTTTAGGAGCCCTTTAGCACAGCTACTTGATACAGTCTTCTATTACCCAAATTATAAAA
TCAACATCCGATAGCCATGACAAATCCACAAATTTGCTTCGCAGACACTTATTTTGACGGTCTGTCTCTCCTCTACGATA
GACGCGAAGCGATACGTCGCACAACAGTCAAAGCGCAATTGCAGAAACTCCGTGATACGGGCCGTTTTGACTGCTTCAAG
CTGCAATGGCATCCTGTGTACGACGAGGACTACCCGTGGCCGGTGCCGAAGAGCTTGTTTTGGGACAGCGATATTGCCAA
GTGGATTGAGGGAGCTTGCTACTTTCTCACCCAGAGCTATGACCAAGATGTCGATGCAGCCGTGTGCGAGCTAGTGCAAG
ACATATGTCGAGCTCAGCAAGACGATGGATACCTAAATGTCTATTTTACCGTTGTCGATCCGGCCGCACGGTGGTCAAAT
ATTCGAGATCAGCACGAGCTATACAATGCCGGCCATCTGATTGAGGCTGCTTTGGCTCACTGTGCCTACTACCACACTGA
TGTACTGCTCAAGCCGATTGAAAAATACGTCGCGCTTCTATACCGTGAGTTTGGACCTGGTCCTGGTCAGCGCCGCGCTT
ATCCTGGTCATCCGGAAATTGAGTTAGCCCTGTTGCGACTGCACAAGGCGACCGGCAGTATGATGGCATATGATCTGGCT
CGGTATTTCTTGGAGGAGCGAGGCACTCTACGACCCACCCCGTGTGGAAGCACAAGCAACAACACAGGCGACAATACCAG
TTCTTACGAAGGTGCGTTGCTGCTGTACTACGACTGGGAAGAGAAAAAGCGCGGAGACTCACCTTGGAAGCGACCTAACG
CATACCCCGAAGCTCGGACAAGTCATTGGTACAACCAAGCACACGTGCCCATCCGGGAGCAAAAGTCGGTAGAAGGACAC
GCTGTCCGATCTATGTATCTGCTAACGGCGGTAGCTGACATGGTTTACATTGGTGTTGAGCGCCCCGTCGGAGACGAGAT
GACGTGGAAAACGGCCTTGGACCGGCTCTGGAATAACATGGTCGATAAGAAAATGTCAATGACTGGAGGCATCGGCGCCA
TAGCACAGTGGGAAGGTTTTGGTCGTGATTACTTCTTGCCTCAAGGCACCGATGAAGGTGGCTGTTACAATGAAACATGC
GCAGCCATTGGCGTGATGATGCTGGCCGAAAGGCTGCTGGAGCTTGATCTCGATAGCCGCTACGCCGACATAATGGAGCT
CTGTCTGTACAATGCCGTTCTAACAGCTATGAGTCTAGATGGCAAGAGCTTCACCTACATCAACCAGCTTTCCTCCTCCG
ACACCAACAAGAGCGAGCGCTACAGTTGGTTCGAGTGCGCCTGCTGTCCACCCAACCTTATGCGGCTGTTTGGCAGTTTG
GGGGGTTACCTCTGGGATTACAACTCTGGTCCTGGCTCTGAACTGTTTGTTAATGTGCACCTCTATACATCGGCCACGCT
GTCGTTCTGCCTAGCTGCTAAGGCTGGAGACCAGGTGGAAAACAAAGGTCAAATGTTTCGGCTAAGGCAAGCGTCCAATT
GGCCTTGGGATGGTCAAGTCACGTTTTTTCTGGAAGCCATGTCGTCCGTCCGTATAACAATTCGTCTACGGTTGCCAGCA
TGGGCAAAGGGAAACTTTACAGTATGTAGCCACCCTATACCGGCAACTTTGGTAACGGACAACACAGCTTACTGGCATAG
ATCAACCCCTCCTGTGATGCTGCCGATATCCAGAAAGGTTACCTTGTACTACCTCCATCTTACCTCTCCAATAATAGTAC
ATTTAAGTTTAACATCGGCGGCTTCTCCCCCCGACTTCTTGCTCCTCACCCATACACGGGACAGAATACGGTCACAGTGG
CCCGAGGACCCCTTGTGTACTGCGTTGAAGACTATGACAACCCCTGGGTCAAAGATCACTTCAAAAGTACTTGCATATCG
TCTGATTCTGCAATAACAGAACAGCCAAGGACCCTCGGCAGCACAGGACACGCATATGTAGCCCTGCATGTTACCGGTTG
GGAAGGTCACGCGGAGAGGTGGTGGGAAAAAGAGAGCCCAGGATCGTATCCGTCACACGAAGTGTTGGGAGGGGGGTCCT
ATTTAGAAACAGAGAGAGGACTGGTCCTTATTCCGTATTATCTCAGAGCAAACAGAGGCGGTAAAGGACAGATGAGGGTA
GGCTTGTTGCGGAAAGACTAGAGCGATATTTCCCCGCACGTTTCTCCACAATAATGGTACTTCACTTTAGCATAAATTCA
ACACGTCTCTCCACTTTTACCCATAAACAACATCTCACGAACTTATCCACAAAAGAGTGCAACACACTCGTGCACGACGC
AGTTCAACTGCTCGCTTCCTTCCATTACAGTGAACATGGCAGCAAATTCTTCAGTACCGCCAATGACAGCCTTGACAACT
GAAGTGGTCTGCAGAAGAACATTCCAGTGCCCCCTCTGTCCCAAGGTATTCAAGCGCCTCGAACATCTCAAGCGCCACCA
GCGGGGGCATCAGCTAGACGAACGGCTAGCATGCTCCGTGTGCGCAAAGACGTTCACGCGAAGGTGCGTCGGCTTCCGTA
TGCGAGCCGCTTCGTTATATCGTGGGACAGAGAGACTGTAAATCAGGCTCGAAAGCTGACAATCTAGCGACATCCGAAAT
CGCCATGAGTCCCTTCATGGGTTAGAACGACCAAGGACAGCACGCATACGAGCCTGTCTTGAGTGTGCGAGGATCCGTGG
TCGGTGCGACAAGGCGGAGCCTTGCTGTTCGCGATGCGCAAGCAGATTTTTGGCATGTGTGTACCCAGACAATGACGGTG
GTGACGGGAGGAAACAGCACAAATCCGATGAAGGCGATACAGTCAATGAAGAAATACACCCAGCGCACCCGGAAGACTTT
CTGTATCCTCTTTCACACGCCTTGGACAACTTTTCGGACTTCCTGATAACGAGCCCTCCCGGTGAGTTTTTGGCGAACTC
TATCAATTGGCTTGCCCCCGATTATAGTGTGGACATCGATCACTCGTTACTTCCAAATGCAAGCTTTAGAACAAGCAGTC
CACTACATATCGATTCTTCTACCAGCGCACAGTCAATGCCACCAACGTGGAACGGCGACCAAAATCTCCAGAGTCATTAT
CCAGATTTAAGGCGCACTCTCGCAGACCAGTTCGGCTCCCCCGTAGCATCTGCTGTGGTTTCCCCTCCCTCTCATGCGTT
TAAGGACCGAGATAACACAATCACTGCCGTGCCCATTACTTCACAATTCTCGATTGATTGTAACTCGTCACGCCTAGTCG
CCTCTGGTGGCATATATGCAACGAGCACCGTCGGCTCACGGATTCCATGTACAGCACGAACGAGGCGAAGTCCACCATCT
ATCTGGGGCTCAACACCATTGCTACCCGTTACAGCTGAGATGACCGACGACGACGATGACACTGACAAACAAGAATGTTA
TTTTCCCGATATGTCCGCCATGACATGTCCATCAGTCGAGACGGAAGGAATTGTAGTGGATGGTCGTATGTATTCGTTGA
TACTGTCCCACTATCGGCTTCTGTATCCGAACACGGATATCAACATGGGCTGCTTTCCCGATTACACGCATGTTAACCTA
TTTGCAACCCTCTTTTTTGAGCATTTTGACCCAATCCTATCCATCTACAACAGCCGAGTGGCCGCGATCGATAAGCATTG
GGTGTTGGCTTTGGCTGTCATCGCCGTCGGTTCTCAATATAGTGGAACAGTTGAGATGGCCCAGTGCGTGGTGCCGCTGC
ACGAATTCCTGCGACTTGCACTGGTGTCGAACATCGAGGGGTGTGATGGATGTAGTGGTGACGATGGAACGAGGTTGGCT
CGGGCCCAAGCTCTGGTTATAAACCAGGTAGGTATGATGTACTACGGGTCACGACGGCTCGACAGGCTAGCCCGCCACCG
ACGCGCCGAGTTGGCCGATATCGCTACCACCACTATGCGAATCTTAGCTGAAAAAGACGAGCAGCGGGAAGAACAGAGAG
CCGATGATGAGCCAGTCGCAGATGCATGGAGACGGTGGATGGTGCAAGAGGCGTGGCGTCGGCTTGGCTACACCATATGG
GTAAGCACAATCCTTCCAAAAGCTGGCAACAGCAACGGACAAAAACGCATACACACACGATGCTGACCCAGAAAACAATG
ACGACAATGTTCAAGCTACTCGACTGCATGGGTTTTTATCACTTTGGCCAGCGGCCTATGTTGTCTCTTGAATGCACCAT
TCGTTGCGATCTCCCATACGATGAGCTATGGGCGGCCCATACGGTCGAACAGTGGTCACTGAAATACAAATCGGATGACT
ACAACAGTATGCAGAACATTTTCAACGGCCATATCTATTCTCATCACACTTACATCTCCCAGGGCACCCATCTCTCGTGT
CTTCTGTCTACACTCTGTTTCGCCACCGCCAGCGGCCGTCAGACCTCGGCGAGTTTTCTGACCTTCTTCTGCTACATGGC
ATCTACGAGCATATTTATCAGGTAGATGATTATTACAGAAGCCCTCTATCGGAATGGATTCCAAGGACTCCCCCGGTTAG
TAGACGAGGGGCTGTTAATATTGACGTGGCGGAGACGGCAAGCACGATTCACTCAACCATAAATAATTTCGAATCATGGC
GTAGTGCCGCCATGGACTGCGTCGATGTGCTGCATTGGGCTGCCAACGGAACAGTAGCGCGCCTAGCCGGTGCCGAGCAC
GCCACTGTGCTGCATTTACAATTTTCACGCGTGGTCTTGTGGGCACCATATGCAGCCATCAGGACGCTTGCTGAGTGGGC
GGCAGTAACGGCGAGGGCAAGAGAAGGCCCGGACTGTCTTGATTTCGTTTATAGTCGCGAGGGCCAGTGGCTAAGCCGAA
ATGAGGTAACCCGACACGAGAACACGGTCAAGCAATGGACCCAAGAAGATGAGGTGAGCCTAGAACCCCTTCACACATAA
AACCTACCTATTCTAACCAAGAGTCGAAGGCCAAGTCACGACTGACCGTACTGCATTGCGGCGTCGTTTTTTGGCACGTG
CGGCGCTACAGCTGCTGGGCTTATTATGAGCCGCATACTGTCTACCTGGCGACGCTAGTACTATGGGCGTTTTGTGCCTA
TGGACTTCGAAGCGATGACAATTCCTCCCTAACAACCGCAAAAAAACAGTTTGTCCACCTAGACCGACCATGTGATGATG
AGATGGTCCAGTTCTTTGTCCGCTACGGCCGGTCGAGCGCTGTAGTTGCCCATGTAGCCGGGGTTGGTGACATTTATGAA
GCAGGGGCATCTAATAAGATTTTGCGACTTGGGCGGGAAATTTTAGGCGCTAAAAATGGGGTATCTATGGCATGGGGAAG
AACAGGAAAGTATATAAAAGTTTTAACTAAACTAGAAGGATTTGTAGGGGAGCAACATTTAGTAGAAGAATAAAGGAAGA
CTTAAGATAAAAGTAGTTTATTAAGTGTAAAAGCAAAATTAAAACTCCTGAGTACCAATAGTAGGTTGTATTGCACCGCA
ATACAACATTTCTTGGCCCGTGCCATCCCTGAGTACCAATAGTAGATTGTTGTCAAGCATTGGAATCCGCCACACTGTGG
CCCTTCCGCCCCACTTGGCCGTACTGGCCTGTAATTGGTCAGAAGGCACAAAAGCGGGTCCTGACACTAGTATTAATACG
GATCCCTAGAAGGGTCGCGATGTATCTATTTCTTCCTAAGTACACAACACTCTTTCGCCCACACTAGACCCTATTCAGCC
TCCTGCTCCTCACAGTGCATCACGTTATATGACCGCTACGTATAGCCTCCTTTAACCTTCACAGGTTATGAGCCCGGCCC
AAGAGGACCGGGAGAAGCTGAACAAATAAACCGAAAAGCCTTTACGATACGCTTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGGCCCTTCATGACAACCCTGCCACGTATCACG
GCAAAGGCGTGACCGTGGTAACGCACGTTGACGATGCCCTCTATGGAGGAGCCGAAACTGACGTCGCTTCGTTCGAACTC
AGTATGCGTCAGTTGCTAGAGACAGAAATGACACCAACGCCCGAATGGTTACTGGGCGTCGAGATCGGGATCACCACCAC
AGAGGGGGGTACTCAGATCAGCCTCTCCCAGTCGGCGTACATTCGCAACCTCCTCGAATGCAAGGGCATAAACGAATCGC
ACCCTGTTGCAACCCCGATCACTAGTCTAGTAACTCCTAACAAGCATAAGCCCCTAGCAGACAGCTTTCGATATTAGCAC
GTAAACGGCAAGCTGATCTACGCTGGTGTAATAACGAGACTAGACATCTCCTTTACTATACACCAGCACTTAAAGGTAAT
GAAATCACCTAGGGAAACGCATGCTAAGTTAGCTAAGCGATCGCTTCGCTACCTGCAAGGCAAGGAGGACTACGCGATAG
TCTACCGCCGTCAGAAGCCCCCTCCGAAGGGGCACATTTGCGTTAAAGGGTGGGTTGATGCGTCCTAGGCCGACGATCTA
GTTAATCGTCACTCTACGTACGGCTTTGTCTTTAGGATTTTAAGAGGGCCGGTCTTTTAGAGAGCCAAGAAGCTTCCGAC
CGTTAGCACCTCTACCTATAAAGCTAAATACGGCGCCGCCTACTACGCAACAACGCAAGCCCGCTAGATCGAGCAATTTA
TACTCGAAATAGGCCTTTAAGCTAACATCTAGATGTTTGTAAACAACACCTTTGCGATTAGCATTACAAAGAAGCTTAAA
TTTAAAGAGCGTTCAAAGCACTTTAACGTTAAGTAGCACTACTTTCGTAAAAGCGTACTAAGCAGCTTATTAACGGTACA
GTATGTAAAGTCTAAGGATTAAATCGCTAATATTATAACGAAGGCGCTGCCTAAGGCAGCGTTTAAGAGGCTATTGCCTT
ACTTAATAGGCTAGCAGCTGTAAAAAGGGCTGCTAAGGATAATTTTAGTGCATTGCGGTGCGCCTACATAGCGTATTTAA
AGAGAGTGTTAAGCATTAGAATCTGCCACACTATAGCCCTTCCACCCTACTTAGCTATACTAGCCTATAATTAGTTAAAA
GGCACAAAAGCAAGACTTAACACTAGTATTAATACAGATCCCTAGAAGAGTCGCGATGTATCTATTTCTTCCTAAGTACA
CAACACTCTTTCGCTTACACTAGACCTTATTTAGCCTTCTACTCCTTATAATGCATTACATTATATAACCGCTACATATA
GCCTCCTTTAACCTTTACACAATTATAGACTTGTCGTACTAGGCGTAGCTTAGTAAGCTAAGCTAATTACAGCGATTTAT
AGTGCTAATGCTACTATTAGCAACGTTACTACTAAGCTATAAGTTGTAGCTATAAGAGACGTTTAAGGCAAAGAAAGAAT
TAAGAGCGCATAATATTTGCAAACGTACAACACAAGCCAACATTTGCATATACTATAAAGGAGCTAGGAGATATAAAAGA
ATTGTTTAACCAAGTTAGGCAGCTACGTAGTTTAAATATCGGCTTGCAAGGCATACAAAAGGGATAATATACTGCAGAAG
CATTAGTAGGATGCAAGCACTACCACGACCGGATAAATAGAGAGGAGAGAGAGGCGACGCTAAAGGAATAGACTAGCGGA
AAGGGTTTAGTGGCGGGGTAATACACGTTAGGCAGCTATGCAGGCTGCTAGACCTTACGCAGCAGACACGACAAGGAAGG
GCAATAGGCTAAGGAAGTGCTACAGTCGTACGTAGTAGTCTAACAACAAGCAACGCAAAGAGGGGCGCATGCTAGAGCGG
GAAGAAGACAGACTAGAAGGGCCGGCGACTAGCATAGACGCGGTGTTAACAGCAGACAAAAGGGCGATGGAGATTTTTGT
GCGCGCAATAGCGTGCCGGCGGACAGTGTTAGGGTAGTTTCTAGACGGGACAAAGTACAAGAGAGGTGATAGTATAGGGA
GAGGGGTAGCCTGCTATAACTTATGCACAAAGGCTAGTAAGTAAAGGATAGTTTACAGCAGGTGGTGTAGGGAGCACTAT
TAAAGTCTAGGATACAACCTTAGGTTACTATAGGCAGACGCTTGGGGCTACTAAGACTAGAGACACGGTTAAAATAAATA
GACACGCAAACATATGTAACTTAATATATATAATAACTGCTAGCTTTATATAATATTTAATAGTAAAAACAGCGACCGAA
ATTTAATAGACTAGAATTAGTAGTAGGGTAGTATACTAAAGTTAACTGCTATATAGTACTAAAGCCTTAGTTTTATATAT
AGTTTATTGCTATAATTTAAATCCCTTTTTGTATATATACTAGCTTTAACAAGACTAGAATTCTTAGCAGACTAGCAAGT
TATATATTTATTCCTTCTGCTTAATAGTATTTAGCTTTATATAAAACAATGCGTTTTTTGCAGCGCTACAACACTAGCAA
GTTTAGGTTTATAAAATATTTTGCGGATAATAAAGCGAAACCTCTCTATACAATCCTTTTATACACTTAGAAGGATAGCT
AAAAGATTACCTTTAAGGATATAGTAAAGGGTATAAGAAAAAGAAAGACTAGCTATAATAAGATTTAATTTTGCGCACAA
CAAGCTATAAAAGATAGCTTAGAATACTTTTAGGTAGATACTTGCTACATTAAGAAGTTAGACCTTATTAAGCTTTAAAA
TACTATTAACTCGATGTTTTGCTAGTACTAAAACGCAGCGAAATGCTACGTCTACCTATCTAATGTTTCTAAAAAACTGC
GAATAGCAAGTAGTAGAGTTATAGAGGCTTAGAGGCTAGCTTTTAAACAAAGTAAATAGTTCTTTTGCAGCTAGACACTT
TAAAAACTCCTTGCTTCTAATTTAGTTAAGTTATTTTCTAAAGAGTAGAAGAAACTTAGCAATAAAAGATTATTAAGGAA
GAAACTTTGTAAGTTTATAGGAATTTCTAATGCTACACTAAAAGGAGCACTTTTATATTAATTTAACAATAAAGAGCGAT
TTTTATAAATATAATACTATAAGACAAAGATTAAAAAAGACAAAGCGTATGCACTACTTAGCATTTTTAGCGTTAAAATA
CCCCTTTACTATAAAGAAGAATATACAAGTGCGTTTAGTTAGCTTAACAAAAAGATTAAGAAGTTAAACGAATGCCTTTA
AGACTTATACGTTATTAATCTTTATAACAAAAAAAAACGTATTAAAGAGACAAAAGGCGGGTTATTAAAGGACTTATACT
AGTAAATGCTTAGAAACCTTAAGTTCTAACAATAGCGTTATAATAGATAAAGCTGGCTGCTATAGATTAAGGGCGATCCT
AGTAAGAAGAAGACGATGCTGCTTTATAGCGTTATTAACAAACTAAACAAGTCGATAAATAAGATAACCTTATTATTCTA
TTTCTTTTGCTAGGCTATAGACTTACATAGAAACAACGCTATATTTGTATTACGCGGTTTGCTATACTTACTTATTAAAT
AGCAGCCATTACTTATCTTGCATTTACAATAAAAGTATAATTAAGCAAGCAAAGCCTTCTTTAAGGATGCGAATTCTTAG
GTTGTTTTGTCTAACATCTTTATAAACATTCTTTAGGACTTAAACTTAAACAATACGTACTTAGTAGTTAATGCGCTTAA
CGAATGTTAAAAGGAAGACTTGCTAAAACTATTAGATTTTATTAGTTAGAATTTGTGCATATTAACTTGTGTTAAGTAGA
TTGTCTTTAGCCGCAACTAGTTAAACATTAAGAAGAAACTAGATAAGGCGAACTAAAAGGTTAGGTTGCACCTTAAGCTA
AACAAGGACTTAATCTTTTAAGCTATTAATATATATATTAGCTATAAGGTAGAAGAACTAGCAATCTTAAAGAAGTATAA
TAAGAAAACAAAGAACGCCGTTACAACCTACTTAGCCTTTAATACTAAAGGCATATTTTTATAGGTAGCCTTAGTCTATT
AATAGCTTGCCGACTCTATAGTCTAAAAACAGCACATGCTTACTAGGTTAAAAAAATTCCTACTAAGACTAGATTCTTTT
TATAAGCGAATGCTAGAGTAAATCTATAAGGTTAATAATGCAAATCTTTGTAAGAAGATCTTAGCTTTTGCTTTTGTTGT
ATATTGCTTTATTACTTTGTTGTAAGTATAAGTTCTTTCTAAGTTGTTTAAGGACTATAACAATAACAACTTATTAGATA
TAATTAAGTCTTATAGCTTTTTCTTAACTTTTTAAGAAGATGTTATTTTCTTTGTGCATTAATTAGCAAAAAACTTTTTG
CTTAAAAAGGCATATAGCAAAGTCTTACTCTTAGGCATTACGCACTAGCACTAAGCTATTTTCTTAAGGTTAATATAAGC
TATCTTAAGCACACTTTAACGTAATATATATAACCTAAGCTACCTAGGATTTCCTATCGATTAAGCCTTGCTGCTTAACC
CTAACTTATTGTCTATAATTAAATATTTGTGCGTTTACTAGATTAACTACCTTTATAACTAGCTTTCTATAGTGCCGACA
AGGCAAAATAAGCTATAAGATAGCAATATAGTCGATACCTTTTTTTAAAAGAAGTATCTTTACTAGCTTAAAGCTCTTAG
TTTTTTTAAGAAGATGCTAAAGAGAGTTATTATAGTAAAGAGGCTAGATAGCTTAGTAAGTATTATCTTCCTTAATACTA
GCAACTAAACTAATTATTTAAAATATATAAAGAATAAGCACTAATAGACTTTGTTTATAATACACACTGGTTTATTCTAT
CTTATAAACATATTATTAAGAATACTTTACTTTAGGCGTATGCGTTAGCACTTGTGTTTAGCCTAGTTTATAGTAAAGTG
CAAGAGCTATTTAAGGCAAAAGAGTTGTAGATTAAAGTAATACTACTTTTAGAATTAAATTAAAGTCTATGCCTTTAAAC
GTTTATAGGCTATAGCAGTTTTGTTTAGTTAGTTATGTTTTTAGCAGATAGTATAAAACTAGCGTTAAGTTCTTTTAATA
ATACTATTAAGGTCTAAGACATAGCCTTAAGGCAGTGTATGCAAACGCTTAAGGGCTATAGCAATTATATTTTGTTAGTT
ATATTTTTAGCAGATAGTATAAAACTAGCGTTAAGTTCTTTTAATAATACTATTAAGGTCTAAAACACGGCTTTAAGGTA
GTGTATATAGACGCTTAAGAGCTATAGCAGTTTTGTTTTTTTAGTTATGTTTTTAGCGGACAGTATACAACTAGCCTTAG
GTTTATATAATAATACTAATAGTATATATAACTATTAGACTATATATAAACTAAGTATAGACACGTTATAAATTATTAAA
AACGAATAAAACGTTCTTTAGTTACCTTTTAAATACTAACCTAAGAATATATATATGTTTAGTTAAAGTGTTAGTGTTAG
TTATACTTTAAGGAAAGTTTTTATAGTTAAGTTTCTATAATAGTAAATTAATATAAATTAATATTTAAACGTACTTATAT
ATTAACTATTTTATAAATCTTTAAGATAAGTAGTAGCTTATAGCTGCTACTTATTTTAAGTACTAATAGTAGATTATATT
ATACTACAATATAATATTTTTTAGCTTATGCTATTCTTACTAGCCTAATAATAAGGATAGTATAGGCTAAAAAATATTAT
ACTCTAAAACTACTTTTTTTAGCTGCTAGCTTTTTATAAGATATAAGTAAGGCACTAACTTATAACCGTTCTCTCTTTAA
AAGATATAACAAAGATACTAAGTAAAAGTTGCTTATATAATGCAATTATATAATACACTTACGCAATACAAATCTACTAT
CTTCTAATAAGATAAGAATAAAAAGCCGAATCTAGTTGCATCTTTAAGCTAGCCTACACAACTTATATGCTACAAACATT
ATAATAGCTTAAGTATAGGCAGAGATACTAGGCGTGCTATAAATAGTAGAAGATTTGCAAAAGCTAGTAAGCCTAAAGGA
TACAAAAAGACCATTTGCATCGCTTAGACCGGCTAAAACGGGCAGGTTTCGGTGTACTTACTAAGAGGACTGCTAGAAAG
TTAGGGCGGACTTGCGACGAATCTAAGAGCATATACGATAGGAGCATAACTAGACGGAGAAAATTAAGGCAAGACGGCGG
GCAAAAGGTAGAGGAGAAGAGAAGGTAGAGAAAGGTCTATAGAGGACTTAGGTGCTATATTAGCGGTTTTTTAAGAAAGG
GCGACAAAGCAAGTATTTTAAAGTAGCACGCAGGCAGACGGTAGAGAGTATAACGGCGAATGCAAGACTAGCTAAGACTA
GCGAAGAAGAAGCGATAAAGGCATTCAAGGCACCGCTATTGCTAGCAAAAAGAAAAGAGGCGGAGCGAATTAAAGAGGAA
GACGAATATGCGGCGAATGCATGGCTGCGGCGACTAGGGTCTGTGCCGCATTTGCAAAAGTTTTCAGGATAGAAAGAATT
TCTGCGGAGTCTAATGCAGACAGAGTACAAGGTGGACAGTGACGAGCAGCAAGACGAAAACGACAAAGCACTAAAGGAAA
TCTACGCGGCGCTAGAGCGGGTGGTAGGAAAGGCTAAGGCGGCTGCGCAGCCCGAGGTAGTGTTATAGAACACGGTGTTT
GAAATACACTAAAAAGAGGCAGACTAGAAGGACGTTCGACCGTTCCATTTCCGGCATACGAAGCAAACGCAAAAGAGATA
TATAGGGATATACCAACAGTTGCTGTCGTACATTGTGCGGTGCTAGTCGATGGAGACAAAGTTGGAGCGGGCAGGATTCC
GACTAACAGCGGTGCAAACACAAGGGTGCGAGTAGGCAATATACAAGGTGGAAACGTTAGTAGACGTAAGACAAGACGGC
TTAAGCGGGACAGTGGAAGAGGTGCGTGCGCAAGAGGAGAAAGTAGAAGAGGCGGTAACAAGGCTTTGTATAGCCATGCT
AGACCACGTTATGCGGACGACAGAGTACGACAGCGTAATGGTCAGCTTTATTACGGTGCTAAGCGTGCAAGAGGATGGTA
GTTAGGAGCACTACAGCAACTTTACACTCAAGCTGAGCGCGCTGGTGGCAGTATTACGGCTGCTTGTAGTGTGGTATGCA
GTGCAACAGCGAGAAGAATCGGTGAGGCGAAAGGTGCAGCATGGGATAGGACAAGAGGAGGCAGAGGAGACGAGCGCAGG
ATACTTTGAGCTGACGTCGTCGATGGTGCGGCGTTTTTTTTGTCAAGGGATAAGCGGATGGGGTGCAACGCCGATGCAGT
TTAAATGAGCAAAGAGAGGGAGGAAGAGGAATAGTAAGAGTAGAAGGAGAATAGTAAGAGTAGAAGGAGAATAGTAAGAG
TAGAAGGAGAATAGTAAGAGTAGAAGGAGAATAGTAAGAGTAGAAGGAGAATAGTAAGAGTAGAAGGAGAATAGTAAGAG
TAGAAGGAGAATAGTAAGAGTAGAAGGAGAATAGTAAGAGTAGAAGGAGAATAGTAAGAGTAGAAGGAGAATAGTAAGAG
TGAAGCCGCTAAGAGCGGCCACGGCCACGGCCACCGCCAAGGGTCAGGGTCAGGGTCAGGGTTAGGGTTAGGGTTAGGGT
TAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62