GenePrediction:GLEAN_1002 Details

Name: GLEAN_1002
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:397795..400437 (+ strand)
Length: 2643
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:397795..397956 (+ strand)
Length: 162
Type: CDS
Source: GLEAN
Position: GCSC_146:398015..398542 (+ strand)
Length: 528
Type: CDS
Source: GLEAN
Position: GCSC_146:398618..398997 (+ strand)
Length: 380
Type: CDS
Source: GLEAN
Position: GCSC_146:399039..399598 (+ strand)
Length: 560
Type: CDS
Source: GLEAN
Position: GCSC_146:399692..400437 (+ strand)
Length: 746
>GLEAN_1002 class=GenePrediction position=GCSC_146:397795..400437 (+ strand)
ATGCGGACAGGAAGGCTTCTTTTTCTCGGACGGTTCGTAGTGGCAGCAGCGGCGACGCAGCCATGGCTGGACGAATCACT
AGACACGGAGCTGCGGCTGCAAATGTTTCTGGGCCAGCTCAACGAGACGCAGATCTTCGCCATGGTGCAGGGTGACACAG
TGGTAAGTGAAGTGGACATGTGCCGGTGCTGTGGATCTGGACGATGGCGCTGACGAGCAGCTCGACGACAACGGGACGGG
TGTCAACGCCTGCATCGGGCACATCTCAGGCAACGAGACATTGGGAATGCCGGCAATCTGCATGGGAGACGGTCCTGCTG
GTGTGGGCAACAGCATGAACAACGTGACGACGTTTCCGGCACCGGTGACAGCAGCGGCAGCACGGAACACGACGCTGCAG
TATGCGTACGGACAGGCGCTGGCGCAGGAGCACCTGGCCAAGGGCCGCAACGTGGTTCTGTCGCCGACGATCAACATTGT
GCGGTCGCCGTCGTGGGGACGAGCAGCCGAGTCCTTCTCGGAGGACGCCTGGCTGACGGCACGCATGGCCGTAGCACAGG
TGCAGGGCATCCAGAGCCAGCATGCGCTCGCCTGTCCGAAGCACCTGGCCGCATACAATCAGGAGACAAACCGGTTTGGC
CTGGATCCTGGCTGGACGGCCGTCGATGCCGTCGTTGACCGTCGTGCTCTTCACGAACTGTATCTGCCGGCCTTCAAGGC
GACCGTGCAGGAGGCGGCTGCGGCGGCCGTCATGTGCAGCTACAACCGGCTCAACGGAGCGTACACGTGCGAGAACGAGT
GACTGCTCAACTCCACGCTCAAGAACGACTGGGGCTTTGCCGGCTTCGTCGTCGCCGATTGGTATTTTGCCCATCGCTCA
ACTGTTGCTGCGGCCAACAACGGGCTCGACCTCAGCATGCCGGGCGGCTCGCTCGAGGACTCTTACGGCTTCCCGGCCTA
CTACGGCGACCTTCTCGTCGATGCCGTGCGCAATGGCTCTGTCGCCTGGTCGCGCGTCCGTGATATGGCTGCCCGCATCT
GGCGACCCATGTTTGCCGTCGGCGCTGTCGACCATCCCGTCACGGGCAACGCCACCGCCGTTGCCCGCACGTCTGCGCAC
CTTCAGATTGCCCAGCAGATCGCCGAGGAGGGCATGGTGCTGCTCAAGAACCGCGACAGCCTGCTGCCGCTGTCCGCCCG
CAAGTATGGCCGCATCGCCGTCTTCGGCCGGGGACCGTCGACAGTCACGTGACCGAACTACACGGCGGCTTTGTCATCGA
CTCGACCCGCGTCACCGAGCCCCCTTACGACTATCTGGCACGTCACGGCGCCGCCGAGGGCATTGACTTCCGCTATGCCG
AGGCCTTTCCGGGAACGGATGCCTATGAGACGGCACCGTCCAGCATGTTCCGCGAGCTCAACGCCACGTACTGGACCACG
ACGGACTTCTCCGGCCCTGCCAACCAGACGGTGGCCATCGACAACATCACCATCGCATCGTATCCGGCCGCCCTCTGGAC
TGCGTGGCCCGACGTCTTCTCGGAGCAGTACCGCGGCCTGTTCCTGCCCAACACCACCGGCCTCTACCGCTTCTCGCTCT
ACGGTCAGGGCGACGCCAATCTGACGCTGGACGGCCAGCCCATCGTCGCCATGACGAAGCAGAACTTTGGCAACCCTGTT
CTGGGCAGTGTGCGTCTGACGGCCGGCCGGCCTGTTGATCTACGCCTCGACTTCTCCATGGGCTACTCGCTATCGACCGG
AAATTACGGCGTGACACTGGGCGTCGACATGGCCAATGCCACACGTGAGAACGAGATCGACTCTGCCTCTCGTTGGGCCG
ATCTCAGCATCGTCGTCGTCAACGACGCCTAGTCCGAGGGCGCTAACAACAACCTAGACCTGACTCTGCCGGCTGGCCAG
GACGATCTCGTGGCCCAGGTCGCGCGTGCCTCCGCCAAGACTCTCGTGCTGCTGGGCTCCAACTCGGCCGTCCACATGCC
CTGGCTGCATGCCGTCGATGGCCTGCTCGAGACCTGGTATCCGGGGCAGCAGGTCGGCGCCGCTCTCGAACGCCTGCTGT
ACGGTGATGTCAGCCCCAGCGGCAAGCTACCCGTGACTTTTCCCGGCATTGATGACGATGTTAGCATCAAGAACAGAAAC
GCTGTCTCTCTCCCCCAAATCCAAGCCGACCTGACCGCCAACTTCAGCGAGAGCCTCCTGGTCGGCTACAAGTGGTTCGA
CCAGCACCGCGTCGAGCCGCTGTTCCCCTTCGGCTTCGGCCTCACCTACTCCCAATTTGCGCTCCACGACTTCTCCGTCA
GCGAAGCCGCCACTACCAACACCACCTTCCACTGCCACGCCACCCTCGCCAACATCGGTAACGCAACCGCCAAGCAGGTC
GTCCAGCTCTATGTTGCCTATCCGCCGCACGCCCGCGAGCCACCTAAGCTGCTCAGGGGCTTTGCCAAGGTCGAGCTAGC
CGCCGGCACCGCCAAGGCCGTCGCCATAGATGTCGCGAAAAGCGACTTGCAGATCTGGGACGACGTTGCCGAGGACTGGG
CGCTGGTGCCGGGCGTGTACGAGTTTCTAGTCGGCTTCTCGTCGCGAGACATTGTGGCCCGCCAGACCGTCTATATTGGG
TAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62