GenePrediction:GLEAN_1003 Details

Name: GLEAN_1003
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:408577..409543 (+ strand)
Length: 967
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:408577..408640 (+ strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_146:408960..409543 (+ strand)
Length: 584
>GLEAN_1003 class=GenePrediction position=GCSC_146:408577..409543 (+ strand)
ATGATATATGACAATGATGGTGCGTCTCCGGCCCAAGATGCGTCACAGGAGAAGTTGATTGCAGGTGAGTCTCTCTCAAA
TGTGTCAAACGCAGCTTCATGCACAAATCTGATCGATATTTTCATAATGAAGACCTGGGCATTGTTGCAACAGCAGTGGT
AGCTGGAGAATGGACAGTGGACAAAGCTGTGAACATGATACCAACCGGAAAACCCGAGGGGGGGTCACTATCCGCTGTAC
CTTATTTTCACATTCTCGAGCGGCTGAAGACAACAAAGAGGGAGGGGTGGCGGAGATTTGGAATTATCCAGTGAGCCGAT
GAAACAATTGTTCTGTTCAAGATGATTATGATCTGACCCTTCTAAGTGGTGAATCCATTGCAGATCACATGTACCGCATG
TCTCTTATTACCATGCTAGCCCCCCCATCGCTCTCTTCGCGACTTGACATGACCAGGTGTATGAAGATGTGTCTCATACA
TGACATGGCCGAATCACTGGTTGGCGATATCACCCCAGTTGACGGCGTACCGAAGCCAGAGAAAAGCCGCAGAGAATCCT
CCACTATGGATTATATCACCGAAACGTTACTTGGTAACGTCGGTGGTGGCAACCCGGGCCGGGAAATGCGCCACATTTGG
CAAGAATACGAAGATTCGAGGACACCAGAAAGCATTTTCGTGCACGATGTCGACAAAATCGAACTTCTCTTACAGATGGC
CGAATATGAGAAGCGTGGCGATGGTCGTATCGACCTAAGCGAATTTGCCTATGTGGCCACCAAATTGTCACTTCCGGAAA
CAAACGAGTGGGCAGAGCAAATTCTCCGAGAACGCGACGAGTTTTGGGGTAGCCGCCTACACGTCCAGAATGACCAAGGT
GTTGATGGTGGTGTCTCTACAGACCGCAACGAAATGCGAAACGCGTACTACACACAGAACGGCGAGGCCAGGAGCGATAA
TGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62