GenePrediction:GLEAN_1004 Details

Name: GLEAN_1004
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:488012..492131 (+ strand)
Length: 4120
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:488012..490867 (+ strand)
Length: 2856
Type: CDS
Source: GLEAN
Position: GCSC_146:490942..491326 (+ strand)
Length: 385
Type: CDS
Source: GLEAN
Position: GCSC_146:491413..492131 (+ strand)
Length: 719
>GLEAN_1004 class=GenePrediction position=GCSC_146:488012..492131 (+ strand)
ATGCCGACGATTGTCAAAGATGGGCCTGACGACACGCACTTTTTTAATGTACCGCAAAAACCGACGGCGACGAAAAGTGA
GGGCACCTCAGAGAATGATATTCTCAGACATAACACGTCTCCCCAGCAGCCGGCGTTTTCTGTTCCAGCACCGTCCCAAA
TCCCAGCAGTCTCTAGCTCAGATAACAACATAGAGCGCGCTTCGGAGAACTCTTCGTGTGCGTATGAGGATAGACCGAAG
GAAAGTTCCACTAGTCAACAAAACCCGACAAGTCCATCACTACATAATGCTTCATCGGTGTTCCCGCAACATAATAGCCA
GAATCCCGACTCAGAACGGGGCATATCGCAAGATGGGACGAGCAGCGGACTTCGCTTTGGGAAACGCCCAAGATTCCTCA
AGAGTCGGAATGCAAGTCAGAGGTCTTCTGCATCATCTGTAACCAATCCGGATTCTCACGATGATGTCGATAGCGATGTC
ACCATCGGTCTCGGAACGGACTACGCTCTACAGTCAGGGGGCGCGGTGTCTACGCTGTACACAAAACATAGTGCGAGCGA
TGCACTTTCACGCTCTGCCAGTATCATGAGTGTGGCTTCGACTGTAGACGGCTTCCAGAATTCCGCCGACCATCTGGAGG
CCTTGGCTGGAGCTGGAAACCAAAAAGTCACGACTTCAGGAAGAGGCGATGAATATATGCAAACCCCCAAAGCGAAGCAG
CCTTTGGCACCACCTACGGACACCGTCCTAGCACGTCGTGTTATGGATGTCCAAGTTCCGGAATCGTTGGCAAGAGAATA
CAAATCGAAGGGCGGTCTCACGACACCTAGGAAGGACTTCGGCGTGGGTGGTGCGCAGCGACCGGGACGAAATATGACGT
TGAAAGAGCAGAGCAGCACGATCGAACGATTATCCAAAGAAAACTTTGACCTAAAGCTCAAAGTCATGTTTCTGAGTGAC
CGGCTGGACAAATTATCAGAGGACGGCATTAAAGAAATGATTCAAGAGAACGTTGAATTCCGTACCAATATTGCTGTCAT
GCAGCGGGACAACAAGGCGCTGCGACGTCGTGTCAAAGAGTTGGAGAAAAAAATTCAAGATGAGAATGATAGGCCCGGCA
CGTCACGAAGTGCGACTTCGTCTAGTGGCCAGGCGGATGCTCTAGATGCTGATTTGCAGGATAAAGAGGAGGAAATCACA
TATCTACGCGAGCGTGTCGAGGAGTATACTACAGTAATCGAACGGCTTCGCGCAGACCTCTTTTCACAGGAAACAGACAA
GCGGCGTATGGCTGACCTAGTCAAGTCTTTACAATCGATCGGCGAAAAGAACGTCGGTGATAGTTTGGGTCGACAAGAAG
AAGAAGACGTCTGGAAAGATTTACTTGAGCAGGAAACAGGAAGGCGGGAGCAGGCCGATGAAGAGAATAGGAAGTTGCGG
GATGACATTTTTCGCTTGAAGCAAGACTTCCACATCGCAGGCAACAATGGTAGCGGAAACCTTCACCGCTCCACAAGCAT
ATACAGCATGTACAAGAAGCCAAGCAACGAGCCACAAGCACAGTTTTCAAGTGCCCACGCGGACACCATGGGAAGCACAA
CGAGTGGTGCTGACACACTTGTCGAGGAGCTTCGACGAGAGAGCGAGCAGCTGCGACACGAAAATGCAGAGCTACGCAAA
GAAGTCGGAGCGCAAACATCGATGTTGACGTCACGCAACAAGGAAAAGGAACGTCTTTACTTGGAAATTGAAGACCTGAA
GATGGCCCAGCGTAGGGGTGGGGGCCCAGCGCCATCTACAGTGGACAGTTTTCTGGACCGGTCGGCTTCTCAAATTGGTG
CTCGCGAACGGTCCGCATCTCGAACGAGCGGTGATACAAGGGCCGAAACGGTAGTCGGAGATCAAGAGCGTGAGGATCTT
GAAAACAAAAATGCCACCCTGCGCGACAAGATTAACGAGGTAAAGCTTGAAAATCAGACACTGTTGCAAGAGCTGGACAC
GGTCCTACAGCAGAAGCAAGAAACAGACGACGTGGCTCTGGCATTGCAAAGGGACTACGAGAATGCAATGGCAGACTTGA
TGGCAATGCAAGCCGAGCGTGACGAGCTGATCACAGAGCTGAACGACCTAGAACAGAAGCAAAACGGCCTGCAGGGCGAG
TTCGAAGACTTGCGGGCCGAGGCGCAAGAGGCAATTGATGGCTATGAAGATGAAGCTGATTTACGCGATGCTGAAACGCA
GAGGCTGCAGGCAGAGTTGACTGAGCGAACGGAAAACTTCACCGCTCTGCAAGAAGAGATGCGCAAGCTAAGCGAGGCTC
TTGTCGGTCTCGAAGATGAAACAAACGATAAAGTACACCGCATCCAACATCTTGAGCAGGAACTTGGCGATGCGAACAAG
GAACTGGAGGAGCTTGAAAGCAAACTACTCGAATCCAACGACAAAGCCCCACGACTTCTCGTGCAACAGGAAAACAGCCA
GGGCGAGATTGCCTTCCTTCGAGAAGAGCAAGAGAGCGACAAAATTACCATCAGTCGATTAGAGGTCAATGTCACAAAAG
CCGAGGAGCTACACCGTGATGAACAAGAACGGGTGAAGCAGCTTCAAGCACAAATCATCACAGAACGGGAGCAGAGCGAG
AGCCTTGCCACTAAGGACAAGAAGGAGATGCAGCACTTTGTCAACGAGCTCAGTCGTGAAGCCTCAAATGCAAAAGAGGA
GGCAAGGAAACTACGAAAAAGCCTCACCTCTCGTGAGGTGGAAGCAACGGAGTGGAAGGAAAGACTGATGGAGTTGGAGA
ACAATCTGAGAGAAGCACTCGGCGATCTGAGTGGGACTCGATCCAGTCTTTTGAAAGTAAGTACAGTCTTCGGTGCAACT
CTCCGCCCTTCCCATTTTCAAGTCCTGATCTGACGTTGTACTCTTATTAGTCTATCGCCAAGCTTCAACGCGAGCTGGAA
AACACTGTTCGTGAACTCGACGCAACAAAGGCATCTGCAATGGAAAAAGACCGCCTAATCAAGCAACGTGACGCTCTACT
AGAGTCCCATGGTCTCGAGGCTCGCAAGGTTGCTGAGGCGCTTGACAAAGAGCGTGCAGTTCACCGAAACACAAAACACC
AATTTGAGACATTTCAGAAAACACATCAACATGTCTCTCGGACTGTGTCGAGTCAGGATGCACGAATTGTCGAACTCGAA
ACGACCAAGTCGCAAGACAAGCGACGCATCTCTCAGCTGGAAATCACTTTCAAGGAGCAGCTCAACGAACGGAACAATCT
TCTACTTGTTTTGTGGACCCGGCTATCTGCCCTTTGTGGGTCTGACTGGGCACACGACAATAGCCTTATCAATGGACGGG
GCCCCTGCCCAGCCTGGAAGCTGTTGCAACGATGCTCCCAGGCTTTAGCAGGAACCTTGTGGCTGCCATCAAGCATATTG
AGTCCATCATCAGTGGGTTTAAAGGCCGTATCAAGGGCGTCGAAAAAGACCTCTGGCGTGAATACCACAATTTGGAAAAC
AGTCTTGAGATGCGCATCAAGAAGCTGGACCGCCTGGAGGGCATCGTTCGCAGCGGTCTTGCCTCGGGAACTTTTAGCAG
CACTGAGCTCCAAAACCGCATGATGAGAAAGGAGGACGCTTATCGACAACTGAAGGTGGAAAATACAACCCTGCGGACGG
CGAACGAGGTGCGCGTCAGGGCTGCATATTCGTCGGCAGATGGGGGCCTTGACAATGATCCTGGCCTTACTGGGTCACCA
TCGCCGTCGATTCCAACCGGGCCTCGCGAACGTACTAAAGCCGGAGGCTCTCTTCGTCCGAAGACAGGTAGCCGGAGCGG
TGTGCCCCGACCGACCACATCATCGCGGCCGATGACGGCCGGTGAGCTGGCGCTTCATGATGCAGCAGGTGATGCGGGCT
CTGGAAGCGATGGATATGGCGCTGATCCGCGGGGGATCCTCCGTTTTACGGGGATCTTAGAGAACAAGCTCAAACTCGAG
AGAGAGGGACGTACTATGGATCGGAACGAGGCCGTACGCCGGTTACGCGAGCAAGAAGCTGAGATAAATCGCCGAAATGA
GAGGGACAGGAGAAGTGGGCGAGACGATACCAGCGGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62