GenePrediction:GLEAN_1008 Details

Name: GLEAN_1008
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:28992..29883 (+ strand)
Length: 892
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:28992..29132 (+ strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_173:29356..29487 (+ strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_173:29710..29883 (+ strand)
Length: 174
>GLEAN_1008 class=GenePrediction position=GCSC_173:28992..29883 (+ strand)
ATGAACTATCAGCGCGCTGCCATAAGGCTCTGCCAGATGATGGCGAGCCAACCATGCCTTCAAGTATCGAGGTTTTCGAG
CAGTGCGACGCTTAGCCGCCCTGTTGCGTCTGTACCAATGCCTTACATCACTGAGGTCACGGTAAGATTTCACCTGACTG
TAATTTAGCTGAAACACATGCTGACAATATAGGCGGGGGGCTGGAGAACATGTTCGTTTCCCGCCTGCTCGTACTGCTCC
TGTAAAGCCAGCTGACACAAATTGGACAGCTGATGTGTTTTCAAAATTGCTACAAGTATGTACGAGCACGAAACACAGCC
AGTCTGTCCAACCTGGGCCTAACCGAGGATTTACGACGACATAGGAGCGAATAATTTGCCTCAACGGTCCTGTCGACGAT
ACGGTTTCGGCTGCCATCGTAGCGCAGTTGCTATGGCTCGAGTCAGACGCGCCCGAGAAACCTATCACAATGTACATAAA
CTCCCCTGGTGGTGAAGTAAGCTCGGGACTAGCGATATACGACACTATGTCTTATATCAAGTCTCCAGTGTCAACTGTAT
GCGTTGGAACAGCGGCATCTATGGCAGCTATTCTGCTTATAGGAGGGGAAGCAGGCAAACGATTTGCTCTTCCGCACAGT
TCAATTATGGTCCACCAGCCACTCGGCGGGACAAGAGGCCCCGCAGCCGACATTCTGATATACGCAAACCAAATTCAGCG
GATTCGCGGCCAAGTAAATGAGATTGTTAGGAGTCATCTGAACAAAGCCTTTGGGCACGAGAAATACGACCTGCAAAGTA
TCAACGATATGATGGAGCGGGACAACTATTTGACCGCAGAGGAGTCCAAAGAGCATGGAATTGTGGACGAAATATTGGTT
AAAAGGCCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62