GenePrediction:GLEAN_1010 Details

Name: GLEAN_1010
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:34099..37353 (+ strand)
Length: 3255
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:34099..34119 (+ strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_173:34217..34367 (+ strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_173:34686..34766 (+ strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_173:35292..35417 (+ strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_173:35500..37196 (+ strand)
Length: 1697
Type: CDS
Source: GLEAN
Position: GCSC_173:37285..37353 (+ strand)
Length: 69
>GLEAN_1010 class=GenePrediction position=GCSC_173:34099..37353 (+ strand)
ATGGATAGCACCGTTCAAGCGGTATGTTGCTTGAAGACGGAAGTCCTCTTGACGCTCCTCTGCAGTCTAGGCTGTCTCTT
CCTTTGGCTATGTGTTTCGCTAACCGGAACACTTGTAGGGCACTCTCAAGTCAAAAATACCTTACCCGAAGCTCGCCGCA
GCTTCCCATCTACAAGAGATGACCGAATCGCAACACAACACCCGTTCTCAATCCTCCTTGACGAGAATCCCAGCACAGTC
AGGACTAAAGCGATCTGCCTCGGAGCCTCGTTAGTCTACCTTCCGCTCCCACCTCTGGAGCTCCTAAAATTAGGATTCTT
GCTCATACTCGGAGTTTTCACACATTTACGATAAAATGGTCACTGATACGCAGCTTTAGAATCACAACCGGGAGCAAAAC
GTCCAACGCCTGCGAGTTACAATGGCGAACATGGAAAGCGTCTCGTTACCAGTTCTGGTTCAGCTGCTCTGATCGGCAAA
TCCATTCCTGCTTTCGCTCCTAAAGTTAGTCCTACTTGCGATCCTCCATGCATCTGACTGTGATAGCACGATGTGCGACT
TACATGACAGCTAACAATGTGTTGTAGAGCTCGAAGCACACAACATATTCGGTTGGCACGCACTCGACCCCAGCGCAACT
AACCGAGATGGGGCGTCGGCAACAGGGAGTCCGTCCAAGGCCGGCCACTTCACTCAATCAATACAGCGGAGGGAGACCTC
AAAGTGGGCGGCCCAATGTTGGCCTACCTAAAAATGGTACTGTAGCACTATATTTTCTTTGCAATCGTCAACCCCGAGGC
GCAGATTGGGAAGAAATGCCGGTGCCAGACAGATATCCATCTCAAAAAGCAGCTGGAAGTTGTTGCATGATTCTAGTGGG
GATATGATTGCACAAACCATATGTCTAGGCACAACAAGCGTGTCGCCCAAGCGATTCTTGTCAGTGACGAATCGCATTTT
CAGAGAATCCAGGCACGTCCTTGTGCAGTTAGACGGGGGCCATTTAAGTTGTGATCAGAGACTTACACGGTCCCATGTTA
GACAAGCATGAAGGAATGAGTCTGGGTACTATCAGAGTCCACTGGGGTGATGGCACGGTTAGGCACATACGAGAGCATAG
GTTTAGGAACACTTTTGTTTCAAGATATACATTTTAGTTACAGGGAAAGTTTCTAACATCCGGTGGTTTCCAGATCTGAA
TGTCGATGAACGCCTTCGGGAAGTCGAGTCCCAATTCGTTGGCTTGAAGGACGTGATGAGCCAGACACTCGCCGAGCGGA
AATCCCAAGAACAGATGGTAGAACTAGCACAAACAAGAGGTAATATATCTCAAGCATAACAGCATATCGCGGTGTTTCGA
TACATGATGAGCATAACTAACACTCTTTTCCCTGTATCCAGCGAACGAATTACAACGGCAGCGGGACCAGCTCGAAGAGA
AGAATCTGGCACTCCAAACGGATTTGGAGTCGATGAAATTACAGCTCCAGTCTGAAACCGTGGCGACCGAGAGGGAGCGC
AGAGAAAAAAAGTATCAACTCGAGGACCAGACGCGCCAACACCAGCGAGAAGTACACGACCTACGCAGGGAACTAACTGA
CAGTACGGAAAAATTACGACGGGTATACGAGAACGAACTAGAAGACGTGAAGAAAAAGCACAGAGCCGAGCTCGAGGAAG
AAAAAAGGCGTACATTGCATCTGATGGACGATATCAAGGCTAAACTTGACTCGGAACAGCAAGACCTACAATTGGTGATT
CAAGAAAAAGACCAGAACTTACGAAAATTCGAGGCAGCATTGGACGAGCTGCAGTTGGACTTGGGCCGGGAAAAGTCTTT
GCAGACCGCGTTGCGGGGGCAGCTGGCGGTTGAATCAACGACGAGAGTGGAGCTGGAAGAACGTGTGCGTGCGCTTCAGG
CGCAAGTTGACTTTCTGAAGTCGGGCAGCAAGCAGCAGTCTGACCAGTTTTCCACGATGGAGGCGCGCATGCAGCAAGCC
CTGAAGCTGGCTGATGAGGCACGTCAGAAACTAGTCAAGGAGGAAACAGAGCGGCGTATCTTGTTCAACAAATACCAGGA
ACTCAAAGGCAATATACGCGTCATGTGTCGCGTTCGACCTACGGATGAGAAAGCCAGGAAAGAGGAGGCAACCATCACGT
ATCCGGATGCGAAATCATCCTCTTCGCAAATTGGAGTGGCAGGACCGGAAGAACGAAGCAGCCTCGGGGTTGTCAGCCGA
AAAACAATACCTTTTGAATTCGACCGGGTCTTCGGGCCCGCCGTACTCAACAGCGAGGTCTTTGACGAGATATCGCAGCT
AGTGCAGAGCGCCCTGGATGGCTACAACGTCTGCATATTTTGCTACGGTCAGACGGGGTCTGGGAAGACATATACTATGT
CGTCCCAAGACGGCATGATTCCCCGAGCTACTCACATGATATACGGGAGAATTAGTCATCTCAGGGAAGTGTCATGGAAT
TACACTATGGAAGGGAGTTTCGTTGAGGTGTATAATGAGGAGCTGCACGACCTTCTTGGCGGTTCAGTGGGCGCGGCAGG
TGGGAGGGACGCCGATGAGAGGAAGAAACTGGAGATACGGCACGACGACATTCGCAAATCGACGACCGTTGTTAACTGCA
AGACTGTGCAGCTCGACTCGGCAGAACGGGTGGAATCTATGCTGCAGCAAGCTCAAAAAAACCGGTCGGTTGCTGCAACA
AAAGCGAACGAGCGTTCATCCAGGTCACATTCGGTCTTCATCCTGAAGCTGGTAGGAGAAAACACGGCTACAGGGGAACG
CTGCGAAGGGACCCTGAACCTTGTAGATCTTGCTGGGTCGGAACGACTAAAGCACAGTGGTGCCGAAGGCGATCGTATGA
AGGAGACGCAAAGTATCAACAAAAGCTTGGCGTGTCTGGGTGACGTCATTGAAGCTCTCAGCAGGGGAGCACCCCATGTT
CCATACCGGAACTCAAAACTCACACACTTGTTGCAGTATTCTTTGGGTGGAAACTCAAAAACTCTCATGTTCGTCATGGT
TAGTCCCATGGAAGCACACCTTAAGGAGACCATCACGAGCTTGCGGTTCGCCACAAAGGTAAGAAACCGAAAGTATAACA
TTATAACTGAACTAAATGGCTGTCAAAGTAGACGGTGTGAGCTGGGCTGACTGTTACTTTTGGTAGGTGAACAACACACA
TATTGGCACTGCTAGTTCGACCAAGAAAATCAAAGACCGAGGGAAGGACGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62