GenePrediction:GLEAN_1011 Details

Name: GLEAN_1011
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:56877..59025 (+ strand)
Length: 2149
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:56877..57786 (+ strand)
Length: 910
Type: CDS
Source: GLEAN
Position: GCSC_173:57854..59025 (+ strand)
Length: 1172
>GLEAN_1011 class=GenePrediction position=GCSC_173:56877..59025 (+ strand)
ATGTACAACCAAAATCACCAACAGGGCCATGGCTCCCGTCTGAACGGTAACCCAACCGGGCGCGGCATGCCCATGCTGTA
CAGCTTCCAGCAGCCCGGAAACCACCAGCACCAGGCCATTCCCCAGCACCATCAGGTCTTGCAAGCTGCCGACCAAGTCA
CCCACAATGCTTCATCTGCCCTTGCCCATCACTCGGCCTACTCTGCCGGCGTCATGTCAAACGTCGGTCCGTTCTCAAAC
GGCCTGCAGAACGGCCACAGCGCAGCTATGCGAGCCGCACAGCAGACCCCAATGAACGAGCACTGGGCCGAGCAGCTTCG
AATGCACAAGGAGGCCGAGACCGCCAACATTGCCATGGTCGAGCAGAACCAGGCCAACTACTACGCCCGCCTGAAAGCAA
GCGAAAATAAAGGCATCGGTGGCCCGTCGCCAATATTGAATAACTCGTCCCTTAACGTGGACGGCGACGCAGAAGATGTC
CGGAGAACCTGGACTATCGAAAAGAAGTCCAACAGGCGACAGGACTGGCACAACCTGGACCTCAGCGGCCAAGGCTTGCG
TGCCTTGTCACCCCAACTGTTTCACTACGACTTTTTGCAGGAGCTTTACATTGCTTCGAACAAGCTGACGGTCCTACCAG
CCGCAATCGGTAGCCTACGACAGCTTCGGCTGCTGGAAGCTTCCAACAACCAAATATCCGAACTGCCAGTGGAGCTGGGG
ATGTGCACCTTTCTCAAGCAGCTGCTCTTGTTCAACAACAACATTCGGACACTTCCTTACGAACTTGGTTCCCTTCACAT
GCTTGAGATGCTCGGTATCGAAGGCAACCCTCTCGACCCAGAACTGAAAAAAGAAATAATAGAGAAGGGCACCAAGTCCC
TGATCGTCTATCTCCGAGAGCAGCCACCGAGTATGTATCTGTTATTCCGTCCCTTTCCGATGTGAGGAGAGTCTTGCTGA
CAGCGAATTTCTTGCAGTTCCACCGCCGCCGAATGATCGAAAACTTGTTGTCGTCCAGGAAGATGTATCGCCGGCCCTTG
AGCATATCAAGGTCTTCTCCTGGAACATTCTAGGCGAAAGATACGCTACACCTCAAGTGTTTAGCTATACTCCGTCTGGA
GCACTGGCATGGGACTATCGCAAAGAGAAGATCATGGATGAAATCCGCTACCGTAATGCAGATTTTGTATGCCTGCAGGA
GATCACCACCGATGCGCTGCGTGAAACATTTGGACCAGAGCTGGCCCAGGCCGACTATAGATCGATACACTACCCTCGAT
CAAAAGCGCGCACGATGACAGAGAAGGATGCAGCCACCGTTGACGGATGCGCCATATTTTACAAGGGAAGCAAGTTTGTC
TTGCTAGACAAGCAACTTATCGATTTTCAGGCCATCGCCATCAACCGGCCGGACATGAAGACACAGCACGACATATTCAA
CCGAGTCATGCCCAAGGACAACATCGCCATAGTAGGCTTCTTCGAGAGCCGCCGAACCGGTGCCCGCATGATCGTCGTCA
GTGCGCACCTGTGCTGGGAGGGCACTCTCGCCGATGTCAAGATTGTGCAAACGGCCTTAATCATGGAGTTCGTGACAAAA
CAGGCTGAGAAATATGCCCGCTGGCCAGCCTTGAAGGACAAAAAGGCGATTGAAATACCGGGCACAGCCGGGGCTGACCC
AGTCCAAGTCGAATGTGCGCCCTCCCAAGAATACCGCAGCAACACAGATTTACCATTATTCCTGTGTGGCGACTACAATT
CGACAGCCGATAGCGGTGTCATAGAACTGCTTCGCGAGGGTCGGCTGCCGCGGGACCATCACGAGCTTGGCAAATACCAG
TACGGAAACTTCACGCGAGATGGCATCGAGCATCCCTTCAGTCTCAAGTCTGCTTATCAGCATCTTGCCAGTACTCCGGA
CGAGCTTCCTTTCACCAATTACACACCCGGATTTGCCAACGTAATCGACTATATCTGGTACACGACCAACACGTTGGAAG
TGGTGGAGGTACTTGGTCGCCCAGATGCGGAATATCTCAAGCGCGTACCTGGTTTCCCCAATTATCACTTTCCTGCCGAC
CACATCCAAATCATGGCCGATATTGTGATCAAACCGAGGAAAGACAAAAAGGGTAGCATCACTGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62