GenePrediction:GLEAN_1012 Details

Name: GLEAN_1012
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:64964..66816 (+ strand)
Length: 1853
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:64964..65631 (+ strand)
Length: 668
Type: CDS
Source: GLEAN
Position: GCSC_173:65697..66816 (+ strand)
Length: 1120
>GLEAN_1012 class=GenePrediction position=GCSC_173:64964..66816 (+ strand)
ATGAAGCTGCTCGGCTCATCCCGGAAGGGCAAAGAACACGCGAGCAACGCACCGCTTCGAAGCCAGACCCTTAATTATGC
AGCTGGACCTGCGACTGTTCCAGCTTGGCATATCCAGGACACGCCATATTATCTACCGCCTCAGCCTCCTTCGGTTGTTG
TAAATCAACATTACTACATCAATGCGCCTTCAAGTTCTCCTGGTATTGCTAGCCCAAGAAAGCTCCTCGCCGGCAGTACT
GGTTGCATCGCCAAGCTGAACCTGGGCTCGGTGGCCAACCTAGCCACAGATCTGCTCCCCATGGACATGCCACATATTTT
CGACGACCGACCATCAGCTATTCAAGCCCCTGGTCCGACATTCGTCCACAAGGGTATGACGCTGTATGATCAACTGTCGT
CCGGATTCGACAGCGTGCTCACATCGATCGACCACGGCTTGGACACGGGCAGAGAAGGCTACCCGTTACATGGTTTAGTG
CCTTACCCGCAGACTTCTCCATACCTGCAAAACGAAGCGACACCTGTATATGATGGGGGTGGGGATGGCCCAACATTGAA
GATTCAGCCTGCTGCGACTTCGTTGCCGTCGATCTCTGCAAACTACTTTGCAAAGGTGGACATGTATGCAAATTCAAAGC
TCAACTCCAAACTGCCACCTCTAAGATTGTAAGAGTAGCACACCTGCCACCGTGTTTTTTGTTTCTCATTCTAACGCCAC
ACTGCCACTTCAGATATGTAAACACGTATCCGCTTCTTTGCCTGGCTGCAAAGTACTCGGATTGCGTATATGAGCAGCCA
CGAGGGGCTGAGCGGTATTTTCACGTCAATGCAGACTGGCGCACTGGTACCAAAGCCATGGTTATCAGATCTGTTCCCAT
GGATCATACCAAAACAATCGTCTTCGCCATTCGCGGAACGGCCACATTTATGGACTGGGCCGTAAACATGAATGTAGCGC
CGACTTCACCAGCCGGCTTTCTTGACGACCCGGGCAACCTCTGTCATGCCGGTTTCCTTTCTGTGGCGCGCAATATGATT
CAACCCGTTGCCAAGCGGCTCCGCGAACTCCTGCAAGAGGGGCGTACCTCCTACTCCCTTCTGATCACGGGGCACTCGGC
CGGTGGTGCCGTTGCGGCGTTGCTTTATTCGCACATGCTGGCTATCTCACAACAGGCCAGCTCGGAGCTCAACTCTCTTG
CTGGTCGGTTCCGTCGGATCCACTGCATCACTTTCGGGACGCCACCTGTATCGCTGCTGCCCTTGGCCAATCCGGACCGA
AAAGGCCTGAACAAATATCTTTTTCTAAGTATTATCAACGAAGGAGACCCGGTAGCAAGGGCCGACAAAGCATACGTGAA
GAGCTTGCTTGAGCTATTCGTCAGCCCAATATCCAAAACAACACCAAATGACCAAGGAAACTCCGGGGTTGGTATCAAAG
ACCTGAGAACAGAAACTGCGGCGAGTCCACTGCGGCCATGTCGGCCATTTAAGCTTAACAAGCACCACCAGTATGCGAAG
TGCAATGATGCTCACCACACCAACCAACTTGTTTACGATATTCGCAGATCTCGCGGACTGAAACCAGTGTGGAAGGTACC
ACAATCAACGCTGAGTAACCCTGGTCGTTTGATCGTGCTACGCGCAGGATGTCCAGCCCAGACAATAGGTCAGGGACACA
GATCCATCGAAGAATTGCTGGACGACGGCGTTGTGGCACAGTTGACAACAGACGAGCAGCTGCGGGAAGTTATCTGGGGC
GACCCGACGTACCATACCATGAAACTCTATGCCGGGCGCATCGAGACTCTTGCTATTGGTGCAGTCACGGCAAATGGCTG
CGACTCTCTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62