GenePrediction:GLEAN_1013 Details

Name: GLEAN_1013
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:69555..71704 (+ strand)
Length: 2150
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:69555..69803 (+ strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_173:69877..69912 (+ strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_173:69992..70041 (+ strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_173:70106..70147 (+ strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_173:70200..70332 (+ strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_173:70463..70881 (+ strand)
Length: 419
Type: CDS
Source: GLEAN
Position: GCSC_173:70944..71239 (+ strand)
Length: 296
Type: CDS
Source: GLEAN
Position: GCSC_173:71301..71357 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_173:71430..71704 (+ strand)
Length: 275
>GLEAN_1013 class=GenePrediction position=GCSC_173:69555..71704 (+ strand)
ATGGAAAGCTTGAAGGACGAAAAGTCACGCGACAACACCGTCGACATCGACACCGAGGCTGCAGTCCCCAGAAGTCATGC
TGCCTGGTTCGGTGGCAACGGAGTCTACGTTGGCCCTCGCATCGGTCCCGTCATCAATGGAAGCGCCTCCGATTCCGACA
CGGATGACAGTAGTTCTGCCATCCTCAACAAGCAGCTTGCCCAAGAAGACGGATGTGCCATACAATACCGCACCTGCAGC
TGGCAGAAGGTCTGCGCACCACAACCAATACCACGGGGTGTATTACATCCTAGTTGCTGATCACCTGCCATTCTCTCTAC
AGACTGCCGCTCTGCTGTTCTCCGAGTATATCTGCCTTGTAAGTGCTGATTATCCTTGCTTTCTCGCCTTTGTGACAACT
CTCAATGATGACCATGTTCCTCTTGACATCTTAAAAGGCCATAATGAGCTTTCCATGGTCCTATAGTGTCCTTGGACTTG
TGCCTGGGTAAGCGTTACATGGCCACATAGCCCTCCCATCGCACTTGGCCGTCCGTACTAACTGCCTGCAGCCTGATCTT
AACTGTTGTGGTTGCTGCCTTTGTCCTCTACACGTGAGTTACCGCACCCAACATCTCTTGCACATAATTGTTTAACGATG
TGCAGGTCTCTTGTGCTTTGGCAGTTCTGTCTGCGTCACCCCGAGGTTCGCGACGTGTGCGACATTGGCCAGATGCTGTT
TTGGAACAAGAAGTGGGCCTGGTATGCTACGGCTTTCATGTTCTTGTTAAACAATACTGTAAGCTTTTGAATGTTTCATG
TGTGACAGCTTATCGTCCCTGCTTCCTGGCTAACACCTCCGCAGTTCATCCAGGTACGGACACGCTTTTCTGCCTCCACG
CGCCCCATCCGTCAACTAACCAGGACAGGGCCTCCATGTGCTTGTTGGTGCTAAGTACCTGAACACCATGACCGAGTCCG
ACAGCATTGCCTGCCGCACCGTCAGCTTTGGAGTGGTCATGTTTCTTCTCTGCTGGCTGTGCTCGCTGCCTCGGACCTTT
AGCATGTTGTCCAAGCTAGGAACTGCTTCTGCTCTGTTTACTTTCGTGTCTGTTCTGCTGGCCACCATCTTTGCCGGCAT
TGAGAAGCACCCTGCGGGCTACGACCCACGCCCATCTTTCACTGCCGCTGATGGCACGAAGGCCGTTGGGGGTAATCCTA
TCGTCACGGCCATTCCTGTAGCCGGTACCACTTTTGTGGCTGGTCTCAATGCCTTTATGAACATCAGCTACACGTTCATC
GGACAGATCACCCTCCCCAGCTTTATCGCCGAGATGAAGAACCCCAGGTAAGACGTAATGGCGCATCAATGTTTATATAA
TCGCAAATTGCTAATACTCATCTCCTCAGAGAATTTCCCAAGGCACTATGGGCCTGTACTATTGCCGAAATCATCGTCTT
CAGCATAGTCGGCAGCGTTGTCTATGCATATACCGGAAACCAGTATATGACCGCACCAGCCTTTGGTTCCCTGGAGCCGC
TCTACAAGAAGGTCGCCTTCTCCTTTATGATTCCGACGCTTATCTTCCTGGGCGTGCTCTATGCCTCTGTGTCTGCTCGA
TTTGTCTTTTTCCGAATCTTTGACAACACTCGCCACAAGAGCGAGCACACTGTTCTTGGCTGGTCCGTCTGGGCCCTCAT
TCTGCGTACGTCATATTCAACTGGTATCTCACTCCCTTTGATCGAGCGCACTAACACAGCTTTTAGTGGCTACCTGGATC
CTTGCATTTATCATTGCAGAAGTCATTCCCTTTTTTTCGGATCGTACGTGATGACCTCTTCCATCGGTGTTTTTGGACGC
CCTAACACCTTTGTGCTGACTCTTTCGGTATCTAGTTCTGTCGCTTATGTCGTCCTTGTTCGACAGCTTTTTTGGTTTTA
TTTTTTGGGGCGTGGCCTACCTACGCATGCGCAAAGTTGACGGCGGCTTGGATTTCGTCAAGGAACGGAATGTCAGCGGA
ATACTGCTCGCCGCTCTGAACGTTTTCATCATTTTGATCGGCTTATTTTTCCTCACTGCAGGAACGTATGCAAGTGTACA
GAGCATCGTTGACGCGTTTGATGCGGGTCAAGTAGGCGGCGTCTTTAGTTGTGCCAGCAATGGACTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62