GenePrediction:GLEAN_1014 Details

Name: GLEAN_1014
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:76711..77305 (+ strand)
Length: 595
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:76711..76946 (+ strand)
Length: 236
Type: CDS
Source: GLEAN
Position: GCSC_173:77017..77305 (+ strand)
Length: 289
>GLEAN_1014 class=GenePrediction position=GCSC_173:76711..77305 (+ strand)
ATGTGTGGCGGAGACATCTTGGCCCAGGACTGCAGTGACCGGTTTGGTGCCCTCGCAGTGCTGAGCCCATTGTCTGAAAC
CTCACCACGGAGCCCGGCTGGCCAGCAAGGCTTTTCTGGAAGCATCGTCTTCTTCAACGATGCCGACCACGACTGCCAGC
TGGCGACGCACTTACGGTTCTCGCCGTCCGAATCGCTGGCCGGTGAACAGGGCTGCCGTCTGTTTGTGAACATCCAGTAA
GCAGTCATTTTTCCGGACACAAGGGCACCGTGGCATCTCGCTGCTGACAGGCACGTCCGCTCACAGCGAGTTTGGCGACC
TCAGCACGCCACATGTCTGCAGCGGTCATAGTGTCGGTGCCATTGCGCTGTGGCCGGAATCCAGCCTGGCTGACCGGCCC
GTCTCTGCTCGGCATGTCCCCGTCACCCGGCAGCTAGAGCAGCCGCTGTATCTGCATGTCGGACACGACCGACACGGAAA
CAACGGCATCATCGGCCGTCGAGTTACTGTGTGCTGTGCTTCGGCGGAAGATGGCCAGATGGCCTCCACTGCAGTGTTGG
CCGAGGGCATCGTTGGCTATAATTCAAACTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62