GenePrediction:GLEAN_1015 Details

Name: GLEAN_1015
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:77476..78793 (+ strand)
Length: 1318
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:77476..78583 (+ strand)
Length: 1108
Type: CDS
Source: GLEAN
Position: GCSC_173:78651..78793 (+ strand)
Length: 143
>GLEAN_1015 class=GenePrediction position=GCSC_173:77476..78793 (+ strand)
ATGTTTCGTCCAATAGACCCAGCCGTTGGGGCAGCCCATGTCGATGTCGATATCGATGTCGGCACCAGCTCGCTGAATCG
AAGCATGGCCAACTGGCAGCGCGAGCTTCAGACCGTCTGCGATCAGTCCGACGCCTTGTTGAAGCCAGCCGCCGAGACAC
TGCGCCGTCTCGTCACAGACTTTTACGCCAGGAAAGCCGCCGTGCTTTCTCGAATGGTTCTGTTCGAAGGCGAGCAAAGG
GCTGCTCAGATGCGAGCCCTTGGTCTGGACGACATGGTTCCCACTGATCTTCGCCAGATCCTAGTGCTCGCTGGCAACGG
ACCTGCCTCGCGTACAAACCCCCAGACAGTCCCGAGCACTGCCGACAACAGAAAGAGTGACGATGTCATGGACTATGAGA
GCACCCAAGAGCGAGCCGAGACAGCCCCGGTCAATCGCCAGGCCCAGGAGCCCAGTACGGCTTCTTTCACGCCTGCAGTT
GTGCAGAGACCCGGTCGAAGCCTTTCCAACCACCTGCCTGTATCCGGAAAGAAGCCGACCAGAAGGCAGCCAGAACTGGC
CAGACGACAGTCTACCATGTCGGCATTTCTGGCGCCCAAGTCATCCCCTTCTGCTGGACAGGTGGCCATTCCGTCAGCTG
CTTATCGGCCAGACATTTTGTCGCACGAACCCCAGGACATCAAGCCGACTGTTGTTCAGTCTGCCGTCGAGCAGCAGGTC
ATCCCACCGGCTGCCTTTCGACCGATGCCTGCACCGCGACAATCCCAGAGCATCCAGCCGGCCGCTGTTCCTTCTGTCTT
TCCCGCGGTCCCGTCTCTGGCCTCTGCTCCCATGGCCATGCCACACGGCCACCTGCAGCCAAAGAGACCTCCCATCAGCT
CCTGGGAGGTGCAGGGTGACGAGTTCATCTTCCAGCACCATCTTCTCGGACCGGGATGGTTCGTGCTTCGTTGCGACCGT
GGCTCTGACCTCAGGGCTGTGACCTTCCGTGCCCATCCTTTCCATAACAGGCGGGCCTGGAACCATTTCAACACCGGCGG
CTGCAAATACCACGACCGTTGGCGAACCTACACCGACGAAGACCTGCTGGAACACTTTGCACGACGAGGTAGGAAATCTT
CAAAGAGAACTTGCCGGTCATCGGCCATGCTAACACCGGTCTTCGGTTGTCGCAGTGGTCGACAGCAATGACGAAAATTT
CACCGACGACTGGGCGCAGCAGTCCAACGAGATGATCGAAGAGAAGAAGAAGAAGCACAAAACGTCGAGGCCCAGGCCTA
GACGCACAATCGAAGACTCCATGGAACCCGACTCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62