GenePrediction:GLEAN_1017 Details

Name: GLEAN_1017
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:87490..88212 (+ strand)
Length: 723
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:87490..87720 (+ strand)
Length: 231
Type: CDS
Source: GLEAN
Position: GCSC_173:87801..87830 (+ strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_173:87914..87984 (+ strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_173:88047..88212 (+ strand)
Length: 166
>GLEAN_1017 class=GenePrediction position=GCSC_173:87490..88212 (+ strand)
ATGCAGATCTGTGACAACTTCCTCACACGACTGCTATGCCAGCTAGAAGAACATTTGCAGTGGCTGGCACGTGGAAACGG
GACCGATCTGCCGCCTCAATGGGGCCACATAACAACACGTCGTGAACCCGCCGGCAATACTGCCCACGGGTTTGTTCTGC
ATATCAACGGACCAGGAGAAGGCGAGATGTTTACCATCATGGTGGATGGAGACGAGGCAGCATCTGCATTGGTAATTTGA
CACTACGTCTTCGCGCTTATCCCAATCCTGGTCCACTTCTTTGATGTAGCCATGTTCACGCTATGACACAGGAGGCCAAA
ATGCAAGACTACGACAAGATGGTAAGCTAGCGAATTTGATCAGGACCAAAAATCTACGAGGAAGAATTTACTAAATCCAG
AACATCATCTCGTCCCTTCCCCAGAGTCTTGCACTTGCTCGAGCCGTTACCCAAGCGTCAAGCCTATTTCAGCTCCAGCA
GACACCTAATCACATGTAAGAGAGCAGGCAAGCGGTCTCATAGTTGTAATGGCCATTGACCTGACTTCATCGCACAGAAC
ATCTACAGACAAGGCTGCCCAGGCTCACATTGCTTTGCTGAAGCGTTACAACGACGTCCGTGATGTAAGCCAGCAGCTCA
TTGGTATCATCGCCGACAGCAGAGGCCTGTCCGTTCGGGCCCTTTACGAAAATGACGCCTATGGTGTGGGCATAGACGAT
TAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62