GenePrediction:GLEAN_1018 Details

Name: GLEAN_1018
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:92831..93207 (+ strand)
Length: 377
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:92831..92981 (+ strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_173:93047..93207 (+ strand)
Length: 161
>GLEAN_1018 class=GenePrediction position=GCSC_173:92831..93207 (+ strand)
ATGGAAGCCGCACAGAAGAAAGCCCAGCAGCTTATTGACGACAACGCTGTCGTCGTCTTCAGCAAGTCATACTGCCCGTA
CTGCCGCAATGCGAAGCGGACGCTCGATAGCTTTGGTGCTAAATATGTTCCGTATGAGCTTGATATAGAGTGTGCGTTGC
ATTGCCTGCATATTTTCTGCGCCTCCCGCCTCACCCACTGATGCTGACGACCACAGCCGATGGCAGCGCTGTCCAGGATG
CCCTGGAGAAGCTGACCGGCCAGCGCACTGTCCCTAACATCTTCATTGCGAAGGAACATATTGGTGGCAACTCGGATCTC
GAGGCCCGGAAGAACAAGGATCTCTCCAAGCTCCTCACGAGCGCTGGTGCGGTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62