GenePrediction:GLEAN_1019 Details

Name: GLEAN_1019
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:96391..99175 (+ strand)
Length: 2785
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:96391..97266 (+ strand)
Length: 876
Type: CDS
Source: GLEAN
Position: GCSC_173:97385..98110 (+ strand)
Length: 726
Type: CDS
Source: GLEAN
Position: GCSC_173:98363..99175 (+ strand)
Length: 813
>GLEAN_1019 class=GenePrediction position=GCSC_173:96391..99175 (+ strand)
ATGGCGTCGCCGCATCCCATCCACCCTCCTCCGAGTAGCCGCCCCCAGCGACGACAGCAAGCACCGTCACTTGACGTCAT
GACGGCCCAAGGCACGCCCTCTGCCCTACGGGCTGAGGATACCGACCTTTCTACTGCAGTGGCTATGCAGGAGTCCCGAT
CATCTTCGTCGACGAACTCGCCGGCTCCCAACGATATCGAGGAGTCTGACTTCTTTCTCGTCCCAAATGACTCCCAGTCG
TCCCTAGGTGTCCCAAACATTCAGGACATGCAGGTCAATGATGATGATAATGTCGATTCCGATACCAGCCGCCTTGACGA
AGTCGACCCATGCATTCCTCCGGTCAACCGACTACCCAACGAGATCCTAATTTCGGTCTTTGCGAGACTCGGTTCCGCGT
CGGATCAGCTCCACTGCATGCTCACCTGCAAGCGCTGGGCTCGCAACGCCGTCGACCTATTGTGGCATCGTCCTGCGTGC
ACAAATTGGCCAAGGCACGAGTCGATCTGCCAGACCCTGATCATTCCGACGCCCTACTTCTCCTACAAGGATTTCATAAA
ACGACTGAACTTAGCCTCTATTGCCGACCAAGTCAGCGACGGCAGCGTCACGCCTTTGGCCATGTGCAACCGCATAGAGC
GCCTAACCTTGACCAACTGCAAGCGTCTGACTGACACCGGCCTGATTGCCCTCGTCGAGAACAGTAACCATCTTCTTGCT
CTTGACATGTCCGGTGACGACCAGGTCACTGAGGCTACCATCTTTACTATTGCTGAACACTGCAAGCGGCTGCAAGGCCT
GAACGTGTCTGGTTGTACCAGGATCTCCAACGAGGGCATGATTCGACTGGCTGAGAGTTGCAAGTACATTAAACGAGTAC
GTCACAGTATTCTTTTGCTACTGATTAGCCCCTCCTGGAGAGAGTCTGTCTCATCTCGACAGCGCCTAAATCTACTGTTC
GGGCGTTATATGGCTCATACTAATTCCTACCCAGATCAAGTTGAACGACTGTAGCCAGCTGACAGATGACGCTGTACTTG
CCTTTGCTCGACACTGCCCGAACATCTTGGAGATCGACCTACACCAGTGTAGGCAGGTTACAAATCAGTCTGTGACCGAG
CTCTTAGCAAAAGGCCAGGCTCTGCGCGAGCTGCGCCTCGCAAACTGCGAACTCATCGATGACAACGCATTTCTCTCTCT
GGCTCCCGAGCGTGTGTTTGAACACTTGCGCATCCTCGACCTCACATCGTGTGTTCGCCTGACCGACCGCGCCGTCCAGA
AAATCATTGACGTCGCCCCTCGTCTGCGCAATCTTGTTCTGGCGAAGTGCAGGAACATCACTGATGCTGCTGTACAGTCT
ATTGCCCGCCTCGGCAAGAATTTGCATTATGTCCATCTAGGCCACTGTGGCCATATCACGGACGACGCCGTCAAGAAGCT
TGTCCACAGCTGCAACCGCATTCGGTATATCGATCTCGGCTGCTGTACCCACCTGACAGATGAATCTGTTACTCGCCTCG
CCACGCTTCCCAAACTGAAGCGGATCGGCCTTGTCAAGTGCAGCAATATCACTGACGAAAGTGTCTATGCTTTGGCAAAA
GCGAATCAGAGAAGCAGACTGCGGAGAGATGCCGATGGGAATATTATGGAGAACCGGTATCACAGCTACAGCAGCCTGGA
ACGTGTCCACCTCAGCTACTGCACAAATCTAGGCATCCGGGTCAGTTCAATCAGAACTCAACATTCATAGTCGGTATACT
GACCAATCCTTGTTTTTCTAGAGTATCATTCGGCTGCTTGATTCATGCCCTCGCCTTACTCACTTGAGTCTTACTGGTGT
GCCAGCATTCCTCAGAGAGGACTTGAGCCAGTTTTGTCGTAGCCCGCCCCTGGGTATGTTGCTTTCCTGAGTAGAGGACG
GATTGTTTGCATGGGCTTCGCTGACATCCGCATAGAGTTCACACTTCATCAGCGTGACGTTTTTTGCGTTTTCTCTGGCG
ACGGTGTCACCGGTTTGCGTGAGCATCTGAACAGAGACCCAGTTTATGCCATTTTCAGAGACCGTGCAACAATTACGACT
GTCTCGATGAACCGACGGCCACCACCTTCTACAGGCATTGAGACGATAGACGACACGGCCCCCCAACAGCAACCAACTTT
TGGAACCCCGGAGCCTTTTATTGCTGACGACGACGACGACGGCATGGAAGATCTCAGCGAGATGGCTGTTGATACCGAGC
TGCCTAATCAGGGCATGCTTCTCATGCATGGAACTCACTCGTTGCCTTCGCCTATTCCGATTCCGGGGCCTTCAACAACA
ACGGCGTCCACCTTGGTACCAACTGCACCACCGTTTACCCCGGCTGCATTTCTCCATTCTTCTCGGTTTCCAGTAGTTCA
GCCAGGTATCCTCCCGCCGATAACATCCATTGAAGACAGTGATGGAACCCCCGACCTGAGGCACTATAACTCAGATGCGA
TGCAGCCTCCTGCAAGCGCTGCCCCAGTTGGCATGTCCTTTTACATGGGCGAAATGCAGCCAGGACCGAGTACAGCCACA
GGCTCCACTCGATCCATTCACGCGAGTGGTAGCGGTGCAACAGCTACCGGAGTGATTGTGGCACAAGGGGCCAGCAGAGC
GCCGCTTGGTATGGGAGGCGTCTCTGGACCAGGCACCGTCCAGCACGGTGGGCCGTCCAATGCAGCGCCACCGGTCCAGT
TACATGATGCAAATACCTTGAATGATGCCTCCAGCAGTCGAAGCAGCACATCAGGCGATCCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62