GenePrediction:GLEAN_1020 Details

Name: GLEAN_1020
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:100209..100684 (+ strand)
Length: 476
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:100209..100250 (+ strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_173:100313..100580 (+ strand)
Length: 268
Type: CDS
Source: GLEAN
Position: GCSC_173:100644..100684 (+ strand)
Length: 41
>GLEAN_1020 class=GenePrediction position=GCSC_173:100209..100684 (+ strand)
ATGTCTTACCAGAAGGGCGAGAAGGATTTCGCTGAGCAGCCGGTACGTCAATGTTTCCCTGAGGCTAAGATGAAGAAAGT
GGCAGGATCTAACAACCACCACAGAAGGCTCACCGTATCCGTATTACTCTGACGAGCCGCAAGGTCGAGTCTCTGGAGCG
CGTCTGCTCCGAGCTGATCGAGCGTGCCCGCTCGAAGGACCTCACGGTCAAGGGCCCTGTCCGCCTGCCTACCAAGAATC
TGAAGATCACGACCCGCAAGACGCCTTGCGGTGAGGGTAGCAAGACCTGGGACATGTACGAGCTGCGCATCCACAAGCGC
CTGATCGACCTGCACGCCCCCACCGAGGTTGTCAAGTCTGTCATTGTCAACAGTAAGGAGAACCGCCATCCACGATCACC
AGGTGTATTGTCCATGTGCTAACACGATATTCTAGTCGAGGCCGGCGTCGAGGTTGAGGTCACGATTGCTGCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62