GenePrediction:GLEAN_1021 Details

Name: GLEAN_1021
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:101343..102578 (+ strand)
Length: 1236
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:101343..101706 (+ strand)
Length: 364
Type: CDS
Source: GLEAN
Position: GCSC_173:101770..102578 (+ strand)
Length: 809
>GLEAN_1021 class=GenePrediction position=GCSC_173:101343..102578 (+ strand)
ATGGCCTCACATTGGAACACGTACGGTGGCGAGGCCTCTGGCCAGAGCCCACCGCTACCGCCAAGACCTCAACAACAACA
ACAGCGACAGCAACAACAAACACAACAACCCTTTTATCCACCGCCACCTTCGGCACCGACCCAGTACAACCAGTATGGCA
GCGCACCCAATCAGTACGGCAGCACGCCTTACCAGACTACCCCCCCGCCTAGTCCGGGCATGCGTGACCGTCTGTACCAG
CTGAGCATAAAGGCCGGTGGGCCGATCAACCGGCTCACCCACAAGCTGGGCTCCGAGGCATTCTGGCCGTCGTCCCTCGA
CCAGGAGAGCAACAAGGCAGCTCGGATACTGAGGTCGTTTTGTCGTATGCTGTGGCCCTTACCAGCCCCTCGTCATTGCC
CGCGCTGACTAGGAACAACTCCTGCAGACGACGGCTTCTACACGGACAGGCCGGAGGATGGTGCGGCGCCTGGGCCCAAG
GGCAAGCCGACCAAGACGCTGGTCAAGATCCCGGCCTCCGTGATCCGGTCGGCCGCCGGTCTGGCCATTTTCACCACCTT
CCGCAGCGCTCTGCACCTCTCCGGTGCCGGTGGCTCTGGCATCGTGGTCGCCCGTCTGCCAGACGGCAGCTGGTCGCCGC
CCTCGGGCTTCCTCGTCCATACACTAGGCGCTGGCTTCATGATCGGCCTCGACATCTACGACTGCGTCTGTGTACTGCGC
ACTCCGGCTGCCGTGCAGGCCTTCACGCACCCACGCCTGTCGCTCGGCGGCGAGATCGGCCTCGTGGCCGGGCCTGTCGG
TGCTGGCGGCGCCGTGGAGGCTGCTCTCGCCAAGGCTGGCGCTAGGCCCATCTTCTGCTACATGAAGAGCCGCGGCCTCT
ATGTCGGCATCCAGGCCGACGGCACCATCATCGTCGGCCGTCCCGATGCTAACGCTGAGTTCTACGGCCAGCGCGGAATC
TCCGTCGACCAGATCCTTTCTGGCCGCGTGCCCTGGCCGCAGCAGCCGCCGTCTGGCTTTGCTGTCAATAGCACCGGGGC
TTCCACCATCCCCCCTTGGCCAGTTGCTGTCCGCCAGCTCATGGAGGTCCTCAAGGCCGCAGAGGGCCGCCAGGACATCG
ACTACGGCCTGCTGCGGGATGTCGGCGCTGGCCCCACGCCAGGTGATCTCGGCCTGGCCGATTCAGACCACTACGAACAT
CCTCCTGCTGGCGAGTACAAGGGCAGATGGGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62