GenePrediction:GLEAN_1022 Details

Name: GLEAN_1022
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:105233..106098 (+ strand)
Length: 866
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:105233..105493 (+ strand)
Length: 261
Type: CDS
Source: GLEAN
Position: GCSC_173:105563..105834 (+ strand)
Length: 272
Type: CDS
Source: GLEAN
Position: GCSC_173:105924..106098 (+ strand)
Length: 175
>GLEAN_1022 class=GenePrediction position=GCSC_173:105233..106098 (+ strand)
ATGACCTCTACCAGGGAGCGCCGTATTGCGAAGGAGCTGCACGACATTAACCAGGACAAGGACAAGTCTGGTGTCTTTGC
GGCTCCGGTCGATGCCAGCAACCTGACCCATCTCAAGGGCACTTTTCCGGCGCCGCCTGACACCCCTTACGCTGGCGGAA
CATACACCGTGGACATTCAGATTCCCGACATGTATCCGTTCAAATCGCCTATCATCAAGTTTGACACCCGGATATGGCAT
CCCAACATTAGCAGCCAAACAGTAAGACTGAACCGCATTTACGTGGCGCTAAAGACGAAAGCATGAGGGGCTAACATACC
GTTCCTGTAGGGTGCTATCTGTCTCGATACGCTAGGAACCGGCTGGTCTCCTGTGGGTACAATAAAAATGGCGCTCATGT
CACTTCGAATGCTCCTTGAATCGCCGAATCCCAAAGACCCTCAAGATGCCGAGGTCGCCAAGATGTTGATGGACGATCCC
GAATATTTCAACGTCGTTGCCCACGACTGGGCCGTCAGGTATGCAGGTGCTCCACGACGACAAGGTCCGCCAGGCCAGTT
CATCCGTAAGAAGGTAGAAAGGCAACCAGACGATCCAGCTAGGTATGTTGTTATCTGTCTGCTTGACAACGTCGACGGCG
CTCCAGAATTTCCTTCCAGCTGTTTGGCTGACCAAGACCTTTCTCACTTAGATATCAAGGCTATAACAAAGATCTGATTG
ATCGGTTCGTCAACATGGGGTTTGAGCTTGATGCCGTGGTAGAGGCCTTTAATTTTGTTGGCATCGACCGAAACGGCGGA
GAAGACTACGAGCTGGAGGAAGCATATATGGGCGATATCACTGCCCGGTTGCTTGGCGAGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62