GenePrediction:GLEAN_1023 Details

Name: GLEAN_1023
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:108788..110590 (+ strand)
Length: 1803
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:108788..109085 (+ strand)
Length: 298
Type: CDS
Source: GLEAN
Position: GCSC_173:109162..109251 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_173:109359..110590 (+ strand)
Length: 1232
>GLEAN_1023 class=GenePrediction position=GCSC_173:108788..110590 (+ strand)
ATGGCTACATCCACGGTGACAGAAACCGTATCGAAGCGGGGCAAAGAAACGTTGCCGCCCGAGAACGAGCGCTTTCTTCG
GTGCTGTGCTGATATCGCCCATGCGCTCATCGAAGACTTTGAAGAGGCTGCCAAGAACCCGAAGCGTGCGCAACGCGACA
TCAATCTGAACAGCCTCCGATCTAAATATGCCCGGAAACACAAGGTCAACGGCGTGCCACCGTTGACGGCAATCATTGCT
GCCGTTCCGGAACACTACAAGAAATACATCTTGCCGAAACTGGTGGCCAAGCCAATTCGTGAGTGGCATATAGCGACTAC
GGAGGCGCATCTAATTAAACCGGACTGAAGTTCTGACCGAACTTCGACATATAGGAACCTCTTCCGGTATTGCGGTTGTG
GCTGTCATGTGCAAGCCGCATCGGTGTCCACACATCGCCTACACAGGCAACATCTGCGTCTACTGTCCAGGCGGGCCCGA
CTCAGACTTCGAGTACAGCACCCAGTCATATACAGGCTACGAGCCCACGTCCATGCGGGCTATTAGGGCACGATATGACC
CGTTTGAACAGGCCCGGGGGCGGGGTCGGACCAGCTTAAGGCGCTCGGCCACTCGGTCGACAAGGTTGAGTACATCATCA
TGGGCGGCACGTTTATGTCTCTGCCCGAGTCCTACCGAGAGGGCTTTATCGCGCAGCTGCACAATGCGCTGAGCGGTTAC
CAGACGTCCAACGTGGACGAAGCCGTGTCGGCGGGTGAGATGAGCAACACAAAGTGCGTGGGGATCACGATTGAGACACG
GCCCGACTACTGCCTGCAGCCACATCTGTCGAGCATGCTCCGGTACGGCTGCACGCGTCTGGAGATCGGCGTGCAGTCGC
TGTACGAAGACGTTGCGCGTGACACCAACCGGGGCCACACGGTGGCAGCAGTGGCGGAGACATTCTGCTTGGCCAAGGAT
GCTGGGTACAAAGTGGTGAGCCACATGATGCCGGACTTGCCCAATGTCGGCATGGAGCGCGACCTCGACCAGTTCCGGGA
GTACTTTGAGAACCCAGCCTTTCGGACCGACGGACTGAAGATATACCCGACGCTGGTGATTCGCGGCACGGGCCTCTACG
AGCTCTGGCGGACTGGACGGTACCAGAACTACACGCCCAACGGGCTGGTCGATCTTGTGGCACGCATCCTGGCACTGGTG
CCTCCATGGACGCGTATTTACCGGGTGCAACGCGACATTCCGATGCCACTGGTGACGTCAGGCGTGGAGAACGGCAACCT
GCGAGAGCTGGCGCTGGCGCGGATGAAGGACTTTGGCACGACGTGTCGGGACGTGCGCACGCGCGAGGTGGGCATCAACG
AGGTCAAGCACAAGGTGCGGCCGAACCAGGTCGAGCTGGTGCGACGTGACTACACGGCCAACGGCGGGTGGGAGACGTTC
CTCGCGTACGAAGATCCGAAGCAGGACATTCTGGTCGGACTGCTGCGGCTGCGCAAGTGCTCGGAAAAGTACACGTTCCG
GGAGGAGCTTGTGGGCCAGCCGACCAGTCTTGTGCGCGAGCTTCACGTCTACGGCACGGCGGTGCCTGTGCATGCGCGCG
ACCCCAAGAAGTTTCAGCACCAGGGTTTCGGCACGCTGCTCATGGAGGAGGCTGAGCGGATCGCGCGCGACGAGCATGGC
AGCGACAAGATCAGCGTCATTTCGGGCGTAGGCGTCCGCAGCTACTATGCCAAGCTGGGCTACTGGCTTGACGGGCCGTA
CATGAGCAAATGGCTGGACGGGCGGCCAGGACCTTCGCCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62