GenePrediction:GLEAN_1024 Details

Name: GLEAN_1024
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:113586..115023 (+ strand)
Length: 1438
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:113586..113776 (+ strand)
Length: 191
Type: CDS
Source: GLEAN
Position: GCSC_173:113840..114083 (+ strand)
Length: 244
Type: CDS
Source: GLEAN
Position: GCSC_173:114140..114588 (+ strand)
Length: 449
Type: CDS
Source: GLEAN
Position: GCSC_173:114648..114803 (+ strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_173:114867..115023 (+ strand)
Length: 157
>GLEAN_1024 class=GenePrediction position=GCSC_173:113586..115023 (+ strand)
ATGGCTACAGAGGTGCGCCAGAGGGTTAAACCCAATGCAGCCGCTTTGCCAACCGACTCGATCGCATCCACTCCCTTGAC
CATTACCGTCAACGGCAAGCCTGCGGCTGCTCCCCATCCGTCTGGAAGGGAAAAGCACGGACGCGTGATCCAGATCTTGC
GGGGCGTCTCGCTAATTATGTTCTTCTTCACGTGTGCCACCACGTATGAATGTCCCCCAGACAGCTTCTCATTGCCTGCT
TGCTGACCGTACAGAATCCAAATCACGCAATGTATCGGCGCGCCTCTCTACCTGATCAACCGGCGTCTGTTTTACGACTA
CATGGCCGTCACCAAGCAGTCCTTTGGCCTGGTCATCACCACCATGACATACTGGTGGGGACCGACCACAATTCGCATCA
GCGGCGATGCGTCGGTGGCCGGCCAGATCAAGTCTCTGTCTGATGGACGCGTGGAATTCAACTTTCCCGAACGATTGGTT
CTTATTGCAAACCACCAGGTACGAGGAGGAAGTGCCGAGAAAGCAAGACGAGCTCAGTTCCTAACATCTGCCAGATATAC
ACCGACTGGCTGTACCTGTGGTGGGTCGGCTATGCCAACAAACCGAGATCCCACGGAAGCATCTACATTATTCTGAAGGA
GTCGCTCAAATACATTCCCATCATCGGCCCCGGTATGATGTTCTACGGCTTTATCTTCATGTCGCGCAAGATGGCCATCG
ATCGACCGCGCATGGCGCACCGTCTTCAGAAGCTGAGAGCTGAGCACCTCGACCCCAGCGGAAACGTTTACTACGACCCC
ATGTGGCTGCTTCTATTCCCCGAGGGCACCAACTCGTCGAATAACGGGCGCGTGAAGTCAGCCAAATGGGCAGAGAAGAC
CGGAATCAAAGACACCGAGCACGTTCTCCTTCCTCGGAGCACCGGCATGTATTACTGCCTGTCCGAACTGAAGGGTTCTG
TCGATTACGTCTATGATTGTACTGTTGCCTACGAAGGTGTAAAGTACGTACCCTGTCCTTGATCTTATCCCGTTTGTCGT
TTTCCTGACTGACAGTCCTTAGGCGAGGCGAGTTTGGAGAACAGCACTTCACTCTGGCCGGGACCTACCTCCAGGGCCAG
CCGCCAAAATCTGTCAACTTCTACTGGCGCCGGTTTCGTGTGGACAATATCCCCCTGGACAATGCCGAGCTGTTTGACAC
CTGGCTGCGCGAGAGGTGGTATGAGAAAGACGCCATAATGGACACCTTTCTCACCACTGGACGCCTACCACCTTCTCCCA
GTGCAGCAGACAGCAAGGATGGCCCCTACATCGAGACAGCAGTCCGTACGCGGTATACTTTTGAGATTGCCCAAATGTTT
GCCGTTCCTACTACCCTGTTAATGCTTTGCAATATTGGCATCATCTACTGGCGTCGGTTTTCTGCTGGGGCAGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62