GenePrediction:GLEAN_1025 Details

Name: GLEAN_1025
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:116544..118279 (+ strand)
Length: 1736
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:116544..116565 (+ strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_173:116635..116705 (+ strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_173:116782..116912 (+ strand)
Length: 131
Type: CDS
Source: GLEAN
Position: GCSC_173:116962..117940 (+ strand)
Length: 979
Type: CDS
Source: GLEAN
Position: GCSC_173:118046..118279 (+ strand)
Length: 234
>GLEAN_1025 class=GenePrediction position=GCSC_173:116544..118279 (+ strand)
ATGCAGTACGACGCAAAGCAGCGTAGGCCTCCCCCTGGAGCGACGTTCACGTTATGACTTCCAGTCGTCCTGTGCAGTAC
TGACAAGACAGGCGGCTATTCAACGGCCGACAAGACGTCATTTGCGTGGCAGACCGCTCGGGTCCGTTGGCCAGTGATCA
TCGTGAGTGGTCCCGAGAGCGCGGTCAGGGGCTGGCACTACGCATCCGACCCGATCTGACTCTTGTACCCCATGGTAGAC
CCAGGCCATCGACGATGTGTATCGGTCTGTGCACCTGAGCAGCGACCCGGCCAAGGCGGATGAGGGCAAGAAGATTGTCG
AGGAGCTTGCACAGCTGAAATACGAGGTGCAGCATGACCGACCACTAGTGTTCGTTTTGCTTGTCTCTCTCCTTTCACAG
ACCCTGACTGACAAACAGGCCGATTTGCGATGACGGAGAATCAGATGTGGCCGGCTACAACGCAGAGCTCGAGCAGCTCG
GCCAGCCATCGTGGCTCAGCCTGCCATGGCTCTATGCCGAGTGCTATCTGTTTCGGCGCATGAGCACCTCTTTCCGGCTG
TCGACGCACTGGAGGGGCTACGATGTATTTGCGCGCCAGAAGATCCGCACCTTTCGCTCGTCGAGGCCGGCAGTTCTGGA
GCTTGCAGGCCGTTACGCGCAGCTGACACGACAGATGGACAGCAATAGCAGCAGCAGCAGCAGCAGCGACAACGCAGCCG
AGGAAGCGCTCTTTGAAGAGATGTGCGAGATCTGCCTCTGGGGCAATGCCACGGACCTCTCGCTGCTGACCAATCTGACG
TACGACGACATCCAAAAGCTGCAGGGCTCTGAGGCCCGGCGCAAGGCCGAGGCCAACATCCTAGTCAACGACCTGCCCAA
GGTATATGCGGCCCTCAAGGCTGCCCGTGCCGCCAAGCCCAAGTCCGAGCGCCGCGTCGACATTGTGCTCGACAACGCCG
GCTTCGAGCTCTACGTCGACCTCATCCTGGCCGGTTTCCTGCTGCGCGCCGGCCTGGCCACCGTCGTCGTGCTGCATCCC
AAGAACATCCCCTGGTTTGTGTCGGACGTGCTGCCCAGCGACTTTGGCGCCCTGCTCAACGCTCTGGCCAACCCCAAGCC
TTTCTTCGAGACGCCTTCCGACGAGGAGATTCACCAGGATCTGCCGGCCCCAGCCAAGCTGACCGACGCTGAGCTCCAGG
ACCTCGCCTTCCTCTTCCAGGAATGGAGCATGATGTACGCCGAAGGCCAGGTCGTCCTGCGGCCCAACGTGTTCTGGACA
CTTCCTGGAAGCTATTGGCGCCTGCCACACGACGCCCCATCCTTGATGACCGACCTGCAGTCGAGTGAGCTTGTCATCTT
CAAGGGCGACCTGAACTACCGGAAGCTCACTGCTGATGTACGTCGTCTGTCTTCGTGTTCCCCCCCTTTTTGTGTTTTCT
CATCCCCCGTGTGCTTCATCCACACACCTGCATCCAATCTTTCTCCTTTCTGACGCAACTAGGCCGAATGGGACCCGACA
ACACCATTCACCGAAGCGATCGGTCCTCTGGGTCCCGGGTCCGGAGTTAACGTGCTCGCGCTGCGGACTTGCAAAGCCGA
TGTCGTGGTAGGCCTACCGGCAGGCAAGGACGAGGAGCTAAGGTTGGCCGAAGGTGGTGGCGGCGCATCTGGGGCACGCG
AGTGGGCCTGGAATGGCAAGTGGGCAGTGGTGTCGTTTTCAGAGGGAAAGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62