GenePrediction:GLEAN_1026 Details

Name: GLEAN_1026
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:127136..132282 (+ strand)
Length: 5147
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:127136..127333 (+ strand)
Length: 198
Type: CDS
Source: GLEAN
Position: GCSC_173:127613..127772 (+ strand)
Length: 160
Type: CDS
Source: GLEAN
Position: GCSC_173:127857..127927 (+ strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_173:128174..129553 (+ strand)
Length: 1380
Type: CDS
Source: GLEAN
Position: GCSC_173:129623..130174 (+ strand)
Length: 552
Type: CDS
Source: GLEAN
Position: GCSC_173:130437..130667 (+ strand)
Length: 231
Type: CDS
Source: GLEAN
Position: GCSC_173:130729..130981 (+ strand)
Length: 253
Type: CDS
Source: GLEAN
Position: GCSC_173:131693..132282 (+ strand)
Length: 590
>GLEAN_1026 class=GenePrediction position=GCSC_173:127136..132282 (+ strand)
ATGCTTTCGAGCCTGCTCAATCCCAGATCTGCTTCACCGGTAGACCGCAAGATTGGCGGCCGAGTCCAGACGTGGGCTGA
TTCTCCAAAGAAGGGCTTCTCGGGCGCCTGCGCCCGCGAGCACCGGTACGGAGTATATGTGGACAGCGGCTGCCCAACCG
AAGCGCTGCCGTCTGCGGGTTGGACGAGTCGAGAGCGGGTGAGTGAATAAATGGTCTGCGTGGGGACCTATCCATCTGGG
CTGGCCCCATCCCCATCACAAATCTGCCGTTGCAACGGCACCCACCCGGGCATTCTACTATCTGTTGTTCGCTTCTATAT
TTTGGCCCAATCTCGCTTCGACCGTACTCTTCTTGCGCTTTTTCTAGACTGTAATCACCAATCACCTCTTGCTCTCGCTC
GCTCCTCTCTGGCTGTCTTGTTTTGCCGGCCGTCTGCCACTCTTCCTGTCTCATCGTGAATTTTGCTGATCAGACAGCCT
TCTGCAAACTCGGTCTCGCGCCGGCTCTTGGCCCCCCGCTCCCGATTGTCAGCAACCCCAAGAGATCTGGAGATCGAAAA
CACGGCAGGGGCTGGGCCAGACGAACAGCAGCCTGTCGAACGTCTCACCCACACCGACTCTCTTCGCCGGTGGAACTGTG
TCTTCAACCCGATGCTGTCGCAGCAACAGCAGGCCGGTGAACCATTTTAGCTGCCCCATCGAACTAGACGACAAGCGACA
GATCAATCACGGCTTGCCGCTGCTGCCGTAGGAATGGAACACGTCTCGAGGCCCGCCGCTCCTTCACGGGATGTAAGTCA
TCCAAAATGTGCTACGGTCAACTAGCTTGCTTCCTTGGGCCATCCTCGTGCCCCTCCTTCTCCATCTGCCCCCCCCCTCT
TCAACCTCTTGGTTCATTTCTTTTTCTGCTTTCTTCCGATCGAACTGTCACTTAGCTAGTCTGCGGTGGCCTGCGAATCC
ACGCGTGAAAGTGTCATCACAACGCTTCGACCTACCGCAAATTGACACCCGTTCCACGAGCTCTAACATCGTTCACAGGG
CTCCCGTGACACTCGGGACATCAGATCAGCCAACCACTCTCACAGAAGCTCCGGCGCTTACCAGTATGACACTACCAGGA
CAATGTGCGCCGCTGGTTCAACGCCTCACTTCCCGGCCTTCCTCACTGGAAGGCCTCTAGACGAGCAGTCTTACGACCGC
TCTAGCAAGAAGCCCAGACTGTTTCACCCGCATAGCGGTGCCACTAAGTTGACTGAGGGCTGTAATGTGCGCCTCGGTAC
CGTCCCGACAAACTCGCTAACCCTTCAACTTGGCCGAGAGCCTATCGTGGAAGTCACTGCCGTCCCGCCCAGACAGCCAG
AGCCCACCGGTGTGCCTCACTTTCTCGCCTCCATCTTGGACACAACTCACTCATATGGCTCTACTTTCAATGGTGTGCCC
GCTACCTGGGGCCCGTATAGCCGATCGGTTCATTCGTCGTTACCGGTCATTTCCTCAACATCCGGCGGATCCCTTTCCCG
TCGCGGCTCTGTCAATTCTCTCAGCTCTCCGGCAGTGCCATCTCCTGGTCCTAGTTCCGGAAGTCTGGGCCGTGATGGCA
CCATATTCTCTCATCATACTTCTGACCAAAGCCAAAGTCCTCCCAGCTACACCTTCACGGCTCCACAATCACCACGCCGT
ATGATTGCTGGCGAATCGCCAAGCACCATCGGCGCGTCAACAAACCCCCACGCCTCGCTCCCTCCGGTCTTCCATGCGGT
TTCAGTCCCTGCGGTTTCGGCCCCGCCGATGAGAAGCCAGATGGTGTACCATCAGCCGGGTACATTCTATGGTGCGCATG
CTAGCAGCCTAGCCCAGCCATCACCGTCATCGTACAGCAACAACATATTTTACGGCAGCAGCAATACCAGCAGTACCAGC
AGTAGTAACACAAGTCCGGGCGACATTTACCGGGACGTTGCGAGGACAGCGCCTGCTCCCTTACTCGCACCATTCAGACC
TGTCCGCCAAGAGCTTGAGTACCCTGGCTTCGTCCCGTTTCACCCCCCGGAAAACGATACCAGGCTGGAAGAGGAAGGAG
TTTGGACCAGTCTGCTGGCTGCAGCCGAATCAGACACCTTCACTGAGAATACCACTAGCCGTGCGGCCATTCACACCTCA
CCTGCAGCCTTGCATAACATCATAAATCATGTGGACGATGACCCGTCATTCCAAGTAATCACACTTCGGAATGTTTGCAA
CAATGACCGACAGGAACCAGCGTCTGACGATGCATCAGCAGAGCAAAGTCTCCAGCTCGTGCAGGCGGACAAGGGAGCGC
GACGTCCACGGAGCACCTTCAGCTTCGAGAAGCGACAGGAGACTAGCCAGACCCGCACAATCGGGGCATGCCTTCGCTGC
AAGAGCCAGCGTATTCGTGTAGGTCGCAGTGCCGAGACTGGTAACAGCAGTGAGCAGAGAAAAAGGCTGACCGAAATTCC
TTCTTAGTGCGTTCCGTCACCCGAGGGTCCCAACGGCATCTGTCTTACCTGCGAACAAGTGTCGCAAAACTCGAAAAAGG
TTCTGCATGACATTCACTGTGTTCGCTGGAGGCTGAACGAAATGAGCCTGTATCGCCATGGAGGACTGAATCTCACTAAG
CGATGGTCCGGCACCATGATCAAGGATATTGCCCACTGGAACGCCGACGACATCCACGAAATCGAAATGAAGATTTTCTA
CTCCAGTGCTATGCACAAATACGACTTATGCCCCGTGCCGGTGAAGTTGCGCGTTCGCAGATTCACGCCAGAAGCCAACG
ACGTCTTGGTCCGGAAGTGGTCCAAGCCCTCCATCGACCAGAACGGCGTCACGACGTTCGAGAAGCTTTATGTCGAGCTG
CCGCCCTATGCTCTCCTCGACGCAAACGAAGCAGCCGAATCGCTGAGGGAGTATTTTCTCCAAAATGCCATGCATGCAGT
AACGAATGTTGCCCGCTTTTCCATTCCCGTTGTACGACACCACATGGAAGCCCTCATTAGACACTACTATAGCCTTGCGG
TAAGAATTTTTCGAGTGCTGAGCAGACGTTCATGGGCAATTCAACTTACTCGCTGTTAGGATGGAGACGTCGAAAAGATA
TTCCTTGAGCGTTTCTTCCGGATGTGGTTTTGCATTCGTGAGTCTTCTCTTCCCCAGCAGAATTGCCCCTACATGATTGC
CCTGACCGCTTTGCAAAGGCTTCACAACCGGGTCATCTTATATAAGCGGACCCGACAAGCTCGGCTGCCGCCCTGTCAAT
GATCGGCACTATCCTCTAGAGCATAGAATATCGGTTCCGCGAATGATCACCGCCCAGTGCGATTCAATCATGGTCACTCG
CTTCCTACGACCGCTTGCCTCTGAAGTACTTAATGAGTTTGAGAGATTCTTCCGCGTTGGGAATCCGGACCACTGGTTCT
TGCTTTACGCATGCACCTTCATGCTTCTACACGAAGTATCTTTCTCGTCCCAGGACCGCCACCGCCATGCCATGGAGAAC
TGGATCACAGATGTTCGTAACACGCTTTCCTCCATATATTCTAGAATTACTGAACTAATGTTTTGCTATATAGGCCAGAT
ATTCCGTCAGTGACTTTGTCAAGGAACTTCAGTTTAGCGCCAACATAATCCTTTGTTACTGGCACTATTACCGAACTATG
GATCCCACAGATGATGGATGGGACATATTCTGCCAGATTATTAAACCACACCCCCGACCTCGAGAAAACATCGAGTCAGC
CAAAGGCAAAGGAAAGAAGAAGGTGCACGTCACTCGGGAGCAGTGCGACCTTCTCATGCAACATTGGAACGACATGATAG
AGATGGGTGAGTTCATCGATTGCCTAGCGGAGTCCAAGTTGCTAATCTTCGTCACAGCTAAACAAACGAAAACGCCCAAA
TTATACCTGAATTATGAGCATCCGCTATATTTCGTGTCCCAGATGTATATCAAGGGATGGAAAGTCCTCGAAACGTACGA
TAATACTAAGTAAAGTAGGAGCCATGTGTTATGGATGCATGCCTTGTAAACCCCATTTCATACCCTTTTGCCCGTCCGAA
ATTTACGGACATAAATAAAGCAGCCATTTTAGTGGTCTCTTTATAAGTTAAACTATTGGTACTCTGTACAGAACTCAATT
TCTTTGCTCGTGTGTGCAATGCGACGTAAGAAATTCCTCGCAGTCGGTGGTCTGTGCTTTGATGACTCAGACTCATATGG
GGCCTTGTTTCCACGTGCCTCTCGATAGACCCATCAGATAAGCATTGAGAAGAGCTGGCCTTTATGACTTGGCTTCTTTT
CACCTCGCACCTTTCCGCACCACTCTCAGCCGGCACGCTGCGAAAGCATAGAGTCGCAACACGACGCACTCAACTATTTA
CTGTTTTTTCGTGGCAGACACATACCTAGGAATTAGAGTCACAACCGAAACATATCCGTCGCACGACTTTGTACTGCCTC
TCCGCACCCATTTTGTCCTTTCGAATCACCAACCATGGCCGACCTCGATACATTCACGTTCTATCCTTTGCAGATAGACC
CACAAACAAAGGCTATAAGCAGCACAGAAGCAGCCGGATCGTCGGCCTCAGCACGCGCCATCGCCGCAGAGCTGACGGCC
CTGAACCAGCTGCACCGCGCACTGATCGGCCTTGAGGGAGGTCCGCCGGTGCCGCCGCCGCCAATTCCAGTCAATCCCAA
GCGGACAGCAAACGTGAACAAGCTGCGGGACTCTGGAAATGGTGAGTTCCGCAAGGGGCGCTACGCCGAGGCCATCAAGT
TCTACTCTCTGGGCTTGCAGATGGCGCTGACGCGGCCGCCCTGGGAGCCGTCTCAGCTGGTGAACGAGGAGGTGGCGACT
CTGTACGCAAACCGGGCACAGGCATACATGGCGATACAGAGCTGGCCCGAGGGTGCGCTAGATGCGGAGACCAGCGTGGA
GGCCAAGAAGACGGGCAACGCAAAAGCGTGGTGGCGGCGGGGCAAGTGTCTCCTGGAGATGGGCCGGCTGGAAGAGGCGC
AAGAGTGGGTGCGGCGCGGGCTGGAGATGGAGGGCGAAGAGCACGATCTCCTGGCGCTGCGCGTGGAGATCCAAGGGAGG
CTGGACAAGGCGAAAGAGGCATTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62