GenePrediction:GLEAN_1028 Details

Name: GLEAN_1028
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:150829..153600 (+ strand)
Length: 2772
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:150829..151029 (+ strand)
Length: 201
Type: CDS
Source: GLEAN
Position: GCSC_173:151189..151260 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_173:151332..152215 (+ strand)
Length: 884
Type: CDS
Source: GLEAN
Position: GCSC_173:152289..152499 (+ strand)
Length: 211
Type: CDS
Source: GLEAN
Position: GCSC_173:152554..153600 (+ strand)
Length: 1047
>GLEAN_1028 class=GenePrediction position=GCSC_173:150829..153600 (+ strand)
ATGCCAGATTCCGCATCCAGGCAGATTGCCTTTGACGATGCCGTCCACCCTGCTCGTCAGGACCCGGACCAGAAGAGAGT
AGATGCTGCCGTGTTTGGGTCGGAAAAGGCGCCCAGCATGGCGCCCAGTGGCCACGACATCAACGACGAGGAATGGGCTG
CCAACATTGCCCAACAGGACATGGGCAGCAACCGCAAGCAAGTATGGATCGAGGCTTGAGCCTACCCGGAGATGGGTGCA
TGGGGAGAAGAATCAGAAAAACACACAGCACCAGCACGAGGATGTGCGGGTGCTGGAGGGCGATTGGCGTGGGCTGGCAT
AGCCCAAGAACGGGAATCCGGCTGATTCGGTGATGAGCAGACTTACAGCGGTATGACACTGGCCTGGCTGGCCTTCCAGT
CGACGGGCATCATCTACGGCGACATTGGCACGGTGAGTCTGTCTCTGGTCATTCTGATCTGATCGACTCTGTCCCACGTC
TAACTGGTCTTTTTCTCCGCAAGTCTCCTCTCTACGTCTTCTCCTCCACCTTTTCCGAGTATCCGTCCTGGGACGACCTC
GTGGGCGCGCTCTCGATCATCATCTGGTCGTTGACACTCATCGTGACGGTCAAGTATGCCTTCATCGTGCTGTCGGCCGA
CGACGACGGCCAGGGCGGCACATTTGCCCTGTACTCGCTGCTGGCCCGTTACACGCGCATCACCAGCTATGGACCGGCCG
GCAGCGACAGCGTGCGGATGGAGCGGTATCTGACCAACGAGCTGCCGCCGGCTGGCCGCACCATCCGCAGCGTGATCGAG
AAGTCGCCGGCGATCCAGTCGGTCCTCAAGATTGCCGGCGTCCTGGGCGTGTCCATGGTCATGGCCGACGGCGTCCTGAC
ACCGGCTCAATCGGTTCTGGGTGCCATCCAGGGCATCCTGGTTGTTCGTCCGGATCTGGGCACATCCACCATCGTCGGTG
TCACCTGTGCCATCCTCGTCATCCTCTTCGCCCTCCAACCGTTCGGCACCGCCAAGCTCGGCACCGCCTTTGCCCCCATC
GTCACCGTCTGGCTGATCTTCAACGCCTGTGCCGGCATCTACAACCTGGCCCGACACGACCACTCCGTGCTCAAGGCCTT
CAGCCCGTATTTTGCCTTTGAGTACCTCATCCGCAACGGCGAGCGCGGCTGGCGCAGCCTCGGTGGCCTCCTGCTGGCCT
TCACCGGCGTCGAGGCCCTGTTTGCCGACCTGGGCGCCTTCAGCAAGCGTGCCATCCAGATCTCGTGGCTCTGCCTGGTC
TATCCCTGTCTGCTGCTGGCTTACATCGGCCAGGCAGCCTACATCTCGGCTGACACGGCTCAGGTCGCCTACAAGAACCC
GTTTTTCTACACCGTGCCACCTGGCTCGTTCTACTTTGCGTATGTCTTTTCCTTTTCTCTTCCTTTTCTCTTCTCCTTTT
CTCTCCCCCTAACATGACAGTCTCGTCATCTCTATCCTCGCTGCCATCGTTGCATCCCAGGCCATGATCACCAGCACGTT
CCAGCTCCTGATCCAGGTCATGCGACTGTCCTACTTCCCGCACATCAAGGTGGTGCACACGAGCAAAAAGTTTCACGAGC
AGGTCTACGTGCCCATGGCCAACTGGCTGATGTTGATTGGTACTGTCATCGTCGCGGCCGTCTACAACAACGTAAGTGGT
CTGCACCCAGTCCGACCGACTGCCCCGGCTAATCGTGACATCTAGACTACCTCTCTCGGCAATGCCTACGGTGTCTGTGT
GATTGGGGTGACCTTTCTGACCACCTGCATGGTCACACTCGTGGCACTCATCGTCTGGCGCCTGCCGGTCTACGTGGTGG
TGCCCATCTTCCTCGCCTTTGTGTCCCTCGATGGTGCGTACATGTCGTCGGTCCTGACCAAGGTGCCGCGGGGAGCTTGG
TTCACCATTGTGCTGTCGGCCATCCTGAGCTCTATCTTCATCCTCTGGCGCTTCGGCAAGGAGGCCCAATGGACGGCCGA
GGCTACAGACCGGCTGCCACCCACAGCCCTTTTGACCAACACGCCGAACAGCCGGAATCCAGACGGGACACTGCGGCTGG
CAAGCGAGTTTGGCCACACGCCTCTGGCCACAGTGCCGGGACTCGGCATCTTCTTCGACAAGCCGGGCGATGGCGCCTCT
GTTCTGCCGCCGGCATTTGCCCACTTTGTGCGCAAGTTTGCTTCGCGGCCGGCCGTCGTTATTTTCTTCCACATGCGTCC
GCTGCCCGTTGCCAGCGTCCCGCTGTCGGAGCGCTACGTGGTCATGCGCGTGGGCTCCAACGCGCAGAGCCGCGCGGTGC
TGCCCAACTGCTACTCTGTCATTCTGCGCCACGGCTACACTGACGATGTCCTGCATCCCGACATGGCTCACGACCTGGTC
GTGCAGATCGAAAAGGCCGTGTCGCGCATCATCCGCCACAACGGCCCGTCGCCCGCGACTGTTGACATCACCATGGCCAC
CATGTCCGACCTCGATCTCGCAGCTTCGCCTGCCGACGACAACGCCGTCTCGCAAGAGCTGGAGACCCTGCACGAGGCCG
CCCTGTCCCAGGTCGTCTACATCTTCGGCAAGGAGGTGCTGCGTGTTCGGAAGCCGGTGGCCGGAAAGGCCCGCTGGGGT
TTGAAGCGGTGCACACGCAACATGCTGCTCGAGCTATATCTGTGGATCCGGGAGAACTCGCGCACCAAGCTGGCCGACCT
GGACATTAATGTAGACCGGCTGGTTGAGGTTGGCTTTGTCAAGGAGATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62