GenePrediction:GLEAN_102 Details

Name: GLEAN_102
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:710018..711303 (+ strand)
Length: 1286
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:710018..710137 (+ strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_179:710345..710388 (+ strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_179:710490..711303 (+ strand)
Length: 814
>GLEAN_102 class=GenePrediction position=GCSC_179:710018..711303 (+ strand)
ATGACTACGCCCTCGCCATCCGATCCAGGTGGCGGAGTTGCCACATCTCTCTTGGAACAGTTCTTATCGCTGCTGGGCTC
GGCTGCCTCATACATGCGACTACCGGCTATTGCGTCGACGGTATGCATTTCTTCCCACACCCTCTCCGCTGTCCTGTCGG
GCAATTCGGCCGTCCCAATTGGAATCTTTGCAAAGCTACCAAGCAGATTTCCATTTCTCCTTCGAGCCTCTCTGAGCCTC
TTCTGGCCGCCTTCTGGCCTCTACTCCCTCTCTGTTCTGATAACAGCACACCCAGACTGACCGCTTCTTTTGCTTTGCTG
TCAATAGGGCGCAGCCGCTGTCCTGACCTCCTTGCTGTACTTTAAGCAGAAGTAAGTAGCCACAACCTCAGCCTTGCCAC
GTGGGACGTGGATTCTCTTTGTCCCCTCTCTCTTCCCTCCCAAGTCGTTACCGCTTTCTGACGCATGCATAGAGCTCTGA
TATACCCATCACACGTCCCCGGAAATGCCCGCACCGACATCCCACGGCCGGACCAGTTTGGCCTCACCGACTTTGAGGAG
CTGGTCATCCCGACAGACGACGGCGAGAAGCTCGCGGCCTTTTACATTCGTGGCCCGCGCGGTGGGAAACACACCAAGGT
GACGGTGATCATGTTCCACGGCAACGCTGGCAACATTGGCCACCGCCTGCCCATCGCCCGCATGCTCCGCCACATGGTCG
GCTGCAACATCCTTATGATCGAGTATCGCGGCTATGGCAGCTCCACGGGCGAGCCTGGCGAGTCGGGCTTGATGCTCGAC
GCCCAGACCGCCATCGACTACCTCCGTGACCGCGCCGAGACTTGCGCCCATCGCTACATCGTCTACGGCCAGAGCCTTGG
TGGTGCCGTGGCCGTCCGCTTGGTCGCCAACAACCAACAGCGCGGCGACATCGCCGGCCTCGTGCTCGAAAACACCTTTC
TCAGCATGCGCAAGCTCATCCCCCAGATCCTGCCGCCCGCTCGCTTTCTCACCCTGCTCTGCCACCAGGTGTGGCCCAGC
GATGCTGTCATACCTACCATCACAAAGGTCCCCATCCTCTTCCTCAGCGGTCAGAAGGACGAGATCGTGCCGCCCGCCCA
CATGCGCCAGCTCTACGACCTCTCCGCCGCTCCCAACAAGATCTGGAAGCCCCTGCCACTCGGCGACCACAATGCGAGCG
TGCTCGAGGAGGGCTACTTCGAGGCTATTGCCGACTTCATCGCGTCCGCCACCGACGAGGGCCCGCCGGAGAAGCCTCTT
TTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62