GenePrediction:GLEAN_1030 Details

Name: GLEAN_1030
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:162701..164345 (+ strand)
Length: 1645
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:162701..162796 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_173:162868..163187 (+ strand)
Length: 320
Type: CDS
Source: GLEAN
Position: GCSC_173:163258..163935 (+ strand)
Length: 678
Type: CDS
Source: GLEAN
Position: GCSC_173:164000..164345 (+ strand)
Length: 346
>GLEAN_1030 class=GenePrediction position=GCSC_173:162701..164345 (+ strand)
ATGTCGTCCGGACCGGTCGAGGTGTACAACGGCACGGTTGGCCATGCCAGCAATGGCGGTGACTCACTGACGTCTGACCT
CAATGTCTACTACTCCGTATGCTGGGCCTCGTTCTTGTTGCTAATGCTCATCGCCGGCCATTTACTGATTTGCGGTCTCC
AATTTAGAGCGGCGATTTCGCCTGGATCATGACATCCGCGGCTCTCGTCTTGCTGATGATTCCGGGTGTGGGCTTCTTCT
ATTCCGGCCTTGCCCGCCGCAAGTCGGCGCTGTCACTCATCTGGCTCTCCATGATGAGTATAGCCGTCGTCACTTTCCAA
TGGTTCTTCTGGGGCTATTCCCTGACCTTCTCCCACACCGGCGATGCCTACATCGGCGACCTGACCAACTTCGGCCTCAT
GAAGACCCTTGCACAGCCCAGTGTGGGTGGCTCCAAGGTCCCCGACCTGCTTTTCTGCCTCTACCAGGGCATGTTCGCCG
CCATCACGTACGTCTCTCCCTCCTCTCTGCATCTTCTTCCAGACTTTGTCGGCAAAAGCTAACAGTCGTCCGTCCAGTCC
TGCTCTCGCCATCGGTGCTGCTGCTGACCGCGGCCGCATGCTTCCCTGCATCGTCTTCATCTTCGTCTGGTCCACCATCG
TCTACGATCCCATCGCCTACTGGACCTGGAACCCGCGTGGCTGGTCCTACAAGCTCGGTGGTCTCGACTTCGCCGGTGGC
ACGCCCGTGCACATCTCCTCTGGCGCTGCTGCCCTGGCCTATTCTCTGATGCTCGGCAAGCGCACTGGCTACGACAAGGC
CCACGGCCTGCCGTACCGTCCCCACAACGTCACCCACGTTGTTCTCGGAACCGTCTTCCTCTGGGTCGGCTGGTTCGGCT
TCAACGGTGGCTCTGCGCTCGCCGCTAACCTGCGTGCCGTTATGGCCTGCCTGGTTACCAACCTGGCTGCCTCTGTCGCT
GGCATCACTTGGTGCCTGCTCGACTACCGCCTGGAGAAGAAGTGGTCGACTGTCGGCTTCTGCTCGGGCGCTATCGCCGG
CCTGGTTGCTATCACCCCGGCCTCTGGTTTCGTTCCGGCATGGTCTGCTGTCATCTACGGCATCGTTGGCGCCATCGTGT
GCAACTTCGCCACCAAGCTCAAGTTTGTCCTGGGCATTGACGATGGACTCGATATCTTTGCTGAGCATGCCGTTGGCGGT
ATTGCTGGCAATATCCTGACGGCCTTCTTTGCTGCGTATGTTCCCATCCAGCTTTCCTGCTGTGCTGCCTGATTTGGACG
GAAAACTGACATTTCACAGCGACTACATTGCTCACCTCGACGGTGCCACCGTGATTGACGGCGGCTGGCTCAACCACCAC
TGGGTTCAGCTCGGCTACCAGCTGGCCGACTGCGTTGCCGGCTTCTCCTACTCCTTTGTCCTGACCTGCGTCATCCTGTT
CCTGATGAACCTCGTGCCCGGCCTCAGCCTGCGCGTGACGGCCGAGGAGGAGGAGCTTGGCCTCGACGATGCGCAGCTTG
GCGAGTTCGCCTACGACTACGTTGAGCTGGCCCGCACGCCGCCCGAGGCGCTGCACGGCGAGTTTGTGTCCAATACGAGC
AATCCCGGCAGTGTCAAGGAGAGCAAGGGGGCATCGCCTGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62