GenePrediction:GLEAN_1032 Details

Name: GLEAN_1032
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:173946..176509 (+ strand)
Length: 2564
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:173946..175390 (+ strand)
Length: 1445
Type: CDS
Source: GLEAN
Position: GCSC_173:175444..176146 (+ strand)
Length: 703
Type: CDS
Source: GLEAN
Position: GCSC_173:176207..176509 (+ strand)
Length: 303
>GLEAN_1032 class=GenePrediction position=GCSC_173:173946..176509 (+ strand)
ATGTCGCACGGTAGGAATTATCCGCCGCCGCCGGGCCTAGACCGTCCGAGCGCATCTTCACGACTGCCGCCGCCTCCTTC
ACTGCGGTCAGAATCGTACCGGCCATCAGGGCCGAGAGTCAGCAACGGAGGGGGTCGTGGACGCGACCGAAATCGCGGAC
GCGGCCGTGGCGGTGGTGGTGGTGGCTGGAACAACCGCGACGACGACCGGTCACGCAACGGCCGATCCGACAACTACCAC
CCGCTTCCTCCGCGCCCCAGCTCTCCTCATCGCTTCCGGGGAGGCGACAGCGGGCCAACACCTCCGCAGGGCGAGTTCAC
GTTCCGGGCGCCGAAACCGTCAGGTGTGTACGAGGCGCAGCAGCGCGGAGATTCGTACCAGCCGCGCGACCGGGATCGGG
ACAGAGATTGCGACAGAGACCAGCGCTATGTGCCGTCAGGGCCGCGGTCCTACCAGCAGCATGGCCGGCCGAGCTACGAA
CGTCGTGGCGACCGCAGAGATGGCCGTCGAGCGAGAGGTGGGCGCTTTGGACGGTTTATCGCGGCCGACCGGCCAATCTT
GCACCAGACGAGCCAACAGGACGGAGACGCATCGCAGGACTTTGCCAAAGGCGCGGGCGGCATCACGTACCTCAACTTTG
ACGAGCTGTCGGACAGCGACGAGGCTGAAATGGATATTTCAGGCGACGAGGGCGGTGTTGTGAGCGGCGACGACGCCGAC
GGAAAGCCGGCTCGCAAGCGGACGCGTCTCTCCAGGTCGGCTGACGAAGCGGCCAGCGTGCCCAAGTGGTCTAACCCGGA
TCCCTACACGGTGCTGCCGCCGACCGAGACGGGACAGAAGAAGAAGGACGTTGTGCATCTGATCCGCAAGGCCCGCGTCA
GGGCGGAACAGACGTCGTCTACGGCGCCGGCTGACACGGAGGAATTCATATCATGTGACATGGACAGCGAAGGCGAGGAG
GACGAAGAGGACGATATGCTCGTGATCGATGATGTCGACGAACTGGATAGCAGCAGAAAAGGGAAGGAGCTCCAGGCAAC
AGGGGATGACCGCGTCCGCGACAACGGCGGCAGCAACGACCAACAGGCGGTGAGCAGTGGCAGTAATGGTCGCGACGCGA
GAGAATCGGGAGAATCGATAATATCAGATCTCTCTCGAGATCCCGCCAGAGCGCCAACCTCGCGGGCGGCGGCAAAAGCA
ACCAAGGCGGCGGCGAAAAAGGCAAAGACGGCATCGGGCAGCGCACCGCCCCCGGTTGCCGAGCTCAATCCGTCGCGCAA
ACGGACACACGACGACCAGTTCAAGCTGCCAGACCATGCGAAGCTGAAGAGAGCCACCACCATGCCTGCGGCTGGCTTCA
TCGTGCCCAGCTGGCAAGCCAAGGAGAGCGAGGACCGGTGTCCGTGGCTCAAGGACCATTCCGACACTGCCGTGATAGCG
ACTTGGTCAGTTTTGTTCTGCTGCCCCTTTTCACTTGTCTTCTCTCCTGACAGTATAGGCTTCACAAGGAAATTGTCGAT
TTCTACAACCACGTCAAGCCGCGCGAATTCGAGCAGCGGCTGCGCCAGGACCTGATTGACGACCTGGAACGCGCGGTGCG
CAAGCGGTTCTCCAACGCGAAGCTCTTCTGCTTCGGCTCCTTCATGTCGGGTCTGTACCTGCCGACGGGCGACATGGATC
TGGTGATGTGCTCGACGCATTTTCTCAACAACCGGCCGCCTGTGTTTAACAAGAAGGGCGTGCTGTATAAGTTTGGCAAC
TTTCTCTGCATGAATCAGATGGCCGACCGCGAGCATCTCGAGCACATCACCAAGGCCAAGGTGCCGCTTGTCAAGTACGT
CGACGTCAAGACCTGGCTCAAGGTCGACGTGTCGTTTGAGAACATGACCGGCGTCGCCGCTGTCCGTACCTTCACCAAGT
GGCGCGAGCAGTACCCGGCCATGCCGGTGCTCGTTACCCTGGTCAAGCAGTTCCTGACCATGCGCGGTCTCAACGAGCCG
GTCAATGGCGGCATTGGCGGCTTCTCCATGATCTGCCTTGTCGTCAGCATGCTGCAGCTGATGCCGCCTATCCAGAGCAA
GGACATGAAAGGCGAGCACCACCTGGGCGACCTGCTGATGCACTTCTTTGACCTCTACGGCAACAAGTTCAACTACGAGT
CCTCGGCCATTAGTCTCAACCCGCCGGGATACATTCCCAAGGTGAGTCCGGCCTCTCTCTAGGCACTCGGTTCTTCCAGT
TCTGTCCGCTAACTTCCCTAGTCGAGAGTCACTCACTTTGTCTACAAAAACGTCGATCGGCTCTCCATCATCGACCCGAA
CAACCCGCAGAACGATATCGCCGGCGGTTCCAGAAACACGCCCGCCATCATGCGAGCCTTTTCCGACGCTCACGAGGTCC
TCCGAAAACGCATGCTAGAGCTGGCTAGCCTGCCAGAGGCTCAGCGCCGCAACGAGAGCCTTCTGAGCGCTGTTCTAGAG
GGCGACTACTCGTCGTACCGCGAACAACGAGAGCACCTCCGCTATCTGTATCGTGACATGTACGGCGCCGAGCCGAGCGA
CTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62