GenePrediction:GLEAN_1034 Details

Name: GLEAN_1034
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:193911..194238 (+ strand)
Length: 328
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:193911..193913 (+ strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_173:194008..194238 (+ strand)
Length: 231
>GLEAN_1034 class=GenePrediction position=GCSC_173:193911..194238 (+ strand)
ATGGTACGCCAATTCGCGCCTTCCGCTTCCTGCTGCAAATGCCACGTTCCTGTGATTGTCTCTCCTGCATACGACGTACT
CGTATGTCCCTTCGCAGCTGGTGCCCGGGAGATGTAACCTCACAACCCGTCTGCAAGAGGCCGTCCTGTGGCACCTGTTC
GCTGCAAAACCGGGCGGCGGAACCTTGCACAAGCTCGCCCTCGTGACGGAACACTCTCATGTGGATCACCAGAGCAGCGA
GCGGCTGGGCGCCGAGCACGATGCCGGCGCCATGCAGCACGAGTGCCGAAACTGGACTCTGCCCGGGGGAACCGCCAGCT
CCTCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62