GenePrediction:GLEAN_1038 Details

Name: GLEAN_1038
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:205386..206666 (+ strand)
Length: 1281
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:205386..205664 (+ strand)
Length: 279
Type: CDS
Source: GLEAN
Position: GCSC_173:205722..205743 (+ strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_173:205806..205862 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_173:205939..206666 (+ strand)
Length: 728
>GLEAN_1038 class=GenePrediction position=GCSC_173:205386..206666 (+ strand)
ATGATGGACCGGAGCTGGCCTCTACGGGACCTGGAGTCGTCGACGCAGGCCGTGGCGACAACCAGAGAAGAGGTGGTGGA
AGGCGGCCTGGAAGATGCACACGAAAGGGACACGGCACTCCAGGAAGCCAGCGAGGACTACCACCGCTTTATCGAGGCAG
TTGAGCGGTCGTCGAAGCAGTCGGCAGCCGTGGCCGAGCTGAGACGCTCGCAGAAGCGCAAGAGACTGCCTATGGGCACG
ACTAGACTGTATGATCACGGCCGGTTGCGCCTGATTCCGGTACGTGCTCGTGCTGGTGCCAGACTTCTGCGTCGACGGAC
ACTGACATGCAAGCAGACCCCATCAGCCCATCCTGTTGGTGAGCAAGATGGACTACCACTGCTCCTTTGCGGCCTCACGC
CTGCTGACCCGAGCCTCCAGATCCCCTGAACCTCTCGTTCCGACGCAAGTGGGCTGCCATTGGTGCCGTCTGTTTTGGTA
GGCTCTCTCATGCTCGCTGTCTATTTCTTTTTTCCACGATGCTGACAGCCTTTTCGGGCAGCCGGCTCTATAGCTGTGGC
TGGCGAGTCTGCTATTGGCAGTCTGTTGCTGCCCATCTTCGCACTCGAGTACGCCGGTGTCGACCCACATGCCATCCGCC
AGACGAACGCCACCACCGTCACGGCTGCAGCCTTGGTGTCCCAGATCGACTCGCCAGTAGATGTGCTACTGCCAACAGGC
ACGGTGCTGCCGGCGACCAGCCAGATGGCGCTCCTAGCCACGGTGCCGCTGTTTGTGGCAGCTGTTGCCGGCTACGTCTT
GGTGCCACTGTCGGTGGCCGTGGGCCGGCGGCCAGTGCTGCTTCTGGCAGGCGCCTGCACGTGGGCCGGAGCTCTGTGGG
CAGGCCTCAGCAGTTACTCGCCGGTCCTGTCGCCATTTGTGCAACATGTGGCTGCACGCGCCGTTATGGCCGTGGGTGCC
GGCGCAGCCAGCGTTCTTGTTCCTCTGGTGGCCGCCCACGACCTCGTCTTCCTGCACCAGCAGCACACGGCACTGGTGGC
AGTGGTGGCCTGCCATGCCGTGACCACGGCCGTCATCAGTGCAGCGACGCCCTACGTGGCGGCCTTTTACGACTGGCGCT
GGATGTACTTCATCCTGGCCGCGCTGGGCTTTGTGGCCTGGCTGTTGCTGGTGGCATTAGTGCCGGAGACACGGTGGACA
CAACGTACCACGGCCGAGCTGAGTGGTGTCTGCAGCGGCAGCAGCCCAAGATACGCAGACGAGCCACAGACACTCGACTA
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62