GenePrediction:GLEAN_1044 Details

Name: GLEAN_1044
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:239793..241591 (+ strand)
Length: 1799
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:239793..239837 (+ strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_173:240100..240886 (+ strand)
Length: 787
Type: CDS
Source: GLEAN
Position: GCSC_173:240942..241591 (+ strand)
Length: 650
>GLEAN_1044 class=GenePrediction position=GCSC_173:239793..241591 (+ strand)
ATGTGGTCGTGGCAGCTAGTCTGCCCAGAGGTGTTGGCCCTGAGTGTAAGTCGACCTCCTCTCACTTAACAGCTACGGGA
GTATAGCTTCAGTCATATTGCCATTGGGTACACCATTTTCTTACCAGTGGCCTGTATCTACAGTTTCTGGTTATTTTGAG
TCCAAGGAAACGTTCGCATGCATTAGCAACCCTGCACTGGTCCTCAAGGCTTCACAAGTGAACGACAATTCTTGTGACTG
TCCGGACGGATCAGACGAACCGGGCACCTCGGCGTGTTCTTACATCGATCCCCTCTCTCCTCCACAGCCTTTGCCTGGAT
CACCTTCCGGGACTACAAATACAACTACTGCACTACCAGGATTCTGGTGTGCCAACACCGGACACATTGGTGCATACATC
CCATTCGCTTACATCAATGACGGTATCTGCGACTACGAGCTCTGCTGTGATGGCAGCGACGAGTACGCAGGAAAGGGCGG
AGTCAAGTGCGAGAACAGGTGTGCCGCCATTGGCAAGGAACACCGCCGCGTCACAGAGGAGCGCAAGCAGGGCTTAGAAC
GGGCTCTGAAGCGGCGACGCACTCTGGCCAAGGAAGCCAGAGAGCTTCGACGTCAAGTAGAGGCCCGTGTCACGAAGCTC
AAGGGCGAGGTGGTGGAGCTTGAGCAGAAGCGTACTCAGCTGGAGCGGGAGCTGACCGAGGCTGAGCGGACCGAGAGAGG
CAAGGTGGTCAAGAAGGGCAAGGGCAAATCTGGTGGCAAGCTGAGTATTTTGGTTGGCTTGGCCAAGAAGCGAGTTGACG
AGCTGCGGGATACGCTCGATAAGCTGCTCGACCACCGCGACGACCTCCAGGACAAAGTGACCGAGTTGGAGAGCATTCTG
CGCAATCTCCAGGCCGATTACAACCCAAACTTTAATGACGAGGGGGTTAAAGCAGCCGTGCACTCGTGGGAGGATTACGC
AGCCAAGTCTTCCACGGAAAAGGAGCCTAAGGTGCATGATATCGACATCTATGAAGTTCTCAAGGAAGATTCGGAAGACA
GGGGTATCAACTGGAAGGAGTTTGAGGCGGAAGACGATACCGACACGGACATCTGTAGGCACTGGGTCTTTTTCTCGTGC
TGTCACTTCATATGCTAACAAGCCTAAAGTGTACAGCTTCGACGCATATCTGCCCCAGGGGGTCAGAACTTACATCCATG
AGACGATTACGAGTCTTCGGATCTGGATGATCGAGAACGGCATGCTTGCAGACAACTCCGACGCAAACGAGTCGTCGACT
GTAAAAAATGCGCGCTCGGCATTCCAAGCTGCCGAGAATGAGCTGTCTTCACGGAAGCGTACGCTGAGCGAGAACGAGGA
GGATCTGTCCAAGGACTACTCCGCCGACGACATTCTCCGGGCGCTCAAGGACAAGTGTGTCTCCACAGATGCGGGCGAGT
ACGAGTACGAGTTTTGCTGGCTAGGCCAAGCAAAGCAGAAGTCTAAGAAGGGCCACGCCAGCACTGGCATGGGCAACTAC
GAACGCTTCGAAATCGAAATAGCCGATGATGCGGAGCGCCTGGATGGAAAAAGCCTGGGAAGTGGTTCCCGCATGGTGTT
GAAGTACGAAAATGGCCAAAACTGCTGGAACGGACCGAACAGACGCACAGATATCTGGCTAGGCTGTGCTGAAAAGGAGG
AGATGTGGCGCATCGCGGAATCCGAGAAGTGCGTCTACAAGATGGAGGTTGGCACGCCAATTGCTTGCGAGGAGATTAAA
GAAGAAGGCGCTGCTGAAGCAGGCAAGGAAGAGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62