GenePrediction:GLEAN_1045 Details

Name: GLEAN_1045
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:243694..253620 (+ strand)
Length: 9927
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:243694..243758 (+ strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_173:243853..243923 (+ strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_173:243986..246225 (+ strand)
Length: 2240
Type: CDS
Source: GLEAN
Position: GCSC_173:246298..251073 (+ strand)
Length: 4776
Type: CDS
Source: GLEAN
Position: GCSC_173:251137..251701 (+ strand)
Length: 565
Type: CDS
Source: GLEAN
Position: GCSC_173:252303..252737 (+ strand)
Length: 435
Type: CDS
Source: GLEAN
Position: GCSC_173:252854..253620 (+ strand)
Length: 767
>GLEAN_1045 class=GenePrediction position=GCSC_173:243694..253620 (+ strand)
ATGGCTTCGTCACAGGGGTCGGCAGAGCTCAGCACGGATGCCCTTATCAAGGAGCTCAAGTCGAGGTAATTGGCACGCTG
TCGAGGCTATAGTCGGCTCGGCAGTTCCAACCGCTCGACTCTACCTATTGCTCGTGCTAACCCGAAATCTTCTTGTCAGG
TCCATTACCGATGAGCAGCGGAGACGAGCAGCCCAGCAGCTGCGGGAGACTGTGGCGGTTGCACAGCGAGGTACGACGAT
GACGATGTATAGTCGGCTGACCTGAAGAAAGACTGACACGTTGAATTGTCAGATCTGAGCGCTGAGCTGTTCCAAACACA
CTTGAGCACGGTGCAAGGGAAGATCAGCACACTGGTTCAGGGCGATACGACGCTCGAAAAACTAGGCGGGATCTATGCTC
TCGATGCGTTTGTCGAGTTTGAGGGCGTTGACCCGACAGTCAAGTACACGCGCTTTGCGTCTGCTCTGACGAGGGTGATG
TCTGGCAAGGACATCAACTGCATGCAGTCGGCAGCCGTTGTCATTGGTAAGCTGTGCCGGCCTGGAGGAGGCTCGCTCGT
GTCGTCGCTTGTCGACACCGACGTGCAGCTTGCCCTCGAGTTTCTTCAGGACGGCAGCAGCGAGGAAAGGCGGTACAGCG
CAGCCCTTTTGTTGCGAGAAATCGCCCGAAATGCCCCAACCCTTATGTATGGAAAGGTGGTGGACATCCTCGACTGGATA
TGGGTCGGCCTTCGCGACCAGCGCCATCTGATTCGGGTCACCTCCGCTGAGGCAGTTAGCGCCTGCTTCAAGATCATCAG
CGAGCGTGACCCGGAGCTGAAGAGCAGGATTATGGACAAGATGTACGAGGAAGCCAGCCACGGATTCAAGCTTAACACGG
TCGACTCTATCCATGGCTCGTTGCTTGTGCTGAAGGAGCTTCTCGAGCAGGGCGGCATGTACATGCAGCACCGCTACACA
GAAGCCTGCGAGATTGTCTCGCGGTACAAGGACCATCGCGATGCGACGATTCGCAAAACGGCCGTCCTACTGATTCCCGA
TCTCGCAATCTATGCGCCGACCCAGTTCTCTGAAAATCACCTGCACCAGTTTATGATTTATCTCTCGGCGATGCTCAAGC
GCGAGAAGGAGCGCAACGATGCTTTTGTCGCTATCGGCAGCGTCGCCAATGCGGTCAAGAGTGCCATGGCTCCGTATCTC
GATGGAATCCTGATCTACATCCGCGAGGGACTCAGTGTGAACGCTCGCAAGAAGGCGTCTGTTGATCCTGTTTTTGACTG
TATCAGCCGGCTGGCCGTCGCTGTCGGGCAGACTCTGACGAAGTACATGGAGGCACTACTAGATCCCATCTTCGCCTGCG
ACATGACGCCCAAGTTGACCCAGGCTCTCGTCGATATCGCGTTCTACGTACCCGCGGTGCGCAGCACCATCCAGGAGAGG
CTGCTGAACATGATCAGCATTGTGCTCTGCGGGGAGCCCTTCAAACAGCTGGGCGCGCCTCTGTCACAGGGTGGTAGTGT
GCTGGCGTCTGCGGCTCCTACAATCACGACCAAAGAGACACCCAAAGACGCCGCCGCTATCGAGCTGCACAAGGCTGAGG
TGAAGCTGGCTCTAAACACGCTGGGTTGCTTTGACTTCTCCGGACATGTCTTGAACGAGTTTGTTCGAGATGTGGCAATG
CGCTACGTTGACGACGACGATCCAGAGACGCGCGAGGCTGCCGCGCTGACCTGCTGTCAGCTGTACCTGCGCGATCCCAT
CGTCAACCAAGAGAGCTACCACGCCATGCAGGTAGTGGGCGATGTGGTGGAGCGACTGCTGACTGTGGCTGTATCTGACC
CGGTGTCGCATATCCGTCTTACCATTCTCAATGCACTTGACAGCCGGTTTGACCGCCATCTCGGCAAGGCAGAGAACATC
CGCACGGCTTTCTACGCTCTGAACGACGAGTACTTCCCTATCAGGGAAGTGGCTGTGCGTCTGATCGGACGCTTGACGCG
CGAGAACCCAGCTTATATCGTGCCGTCTCTCCGCAAGACGTTGATCCAAATGCTTACCGAGCTCGAGTTCTCAGACGTTT
CTCGGAATAAGGAGGAGAGCGCGAAGCTGCTCAGCTTGCTGGTTCAGAACGCCCAGATGCTAATTCAGCCGTATGTGCAC
CCAATGATGGAAGTGCTGCTGCCCAAGGCAGCCGATCCGACGGCGTCCGTGGCGGCCACTATTATCAAGGCCATTGGCGA
GCTTTGCAACGTCGGTGGAGAAGAGATGCTGCGCTACAAGGACCGGCTGATGCCGATTCTCGTTGATGCGCTCCAGGACC
AGTCATCGATTGTGAAGCGCGAGGCGGCTCTGCGCACCATCGGCCAGCTGGCTTCCAACTCGGGTTATGTTATCGACCCT
TACTTGGAGTACCCGCAGCTGCTTGACATGTTGCAGAATATCATTCGCGGTGAACCACAGCATGCGACTCTGCGACAAGA
GACGATCAAGCTGATGGGCATTCTCGGCGCCCTTGATCCGTACCGACACCAGGTATACTGCCGTTCCCGTTCTGAAGCTC
TAGACTTGGTCTCGCGTAATGACTAACGTGCGTTTCTATCACAGCAAGTAGAGGAGCGCAGTCCAGAGCTGCAGCTGCGT
GTGGAGGCAACGCAGACGACGGACATCTCGCTGATGATGACGGGTCTCACCCCATCGAACAAGGAGTACTACCCGACCGT
CGTTATCAATGCCCTTCTCGGCATTCTCAAGGATCACTCGCTGGTGCAGTACCACCAGGACGTTATCAGCGCCATCATGT
CTATCTTCCGCACTCTTGGGCTGGAGTGTGTCCAATTTCTCGATCGCATCATACCCGCCTTTCTCCTCGTCATACGGAGC
TCGTCACCCTCCAAGGCCGAGGCCTATTTCAGCCAGCTTGCCACACTAGTAAGCATTGTTCGACAGCACATCCGCAACTA
TTTACCGTCGCTTGTGGAGATCATGCAGGAGTACTGGAACAGCTCGCCATCGTTGCACTCGACAATCTTGTCGTTGATCG
AGTCCATCTCTCGGTCGCTCGAAGGCGAGTTCAAGATTTACCTGGCGGGCTTGCTACCACTGATGCTCGGGCTCCTGGAA
AACGACACGTCGATGCGGCGTCTCCCATCGGAAAAAGTGCTGCATGCTTTCCTTGTGTTTGGATCAAGCAGCGAGGAGTA
CATGCATCTTATCATTCCGGTGATTGTGCGCACTTTTGAGAAGCCGAACCAGCCGACGTTTCTACGCAAGATGGCCATTG
AGGCAATTGGCAAGATCTCGCGGCAGGTGAACCTCAATGACTATGCCTCCAAGATCATCCACCCCCTGAATAGAATTCTC
GCGTGCAACGAGCCGGTCCTGCGGGTGGCTGGTCTGGACACGCTCTGTGCGCTTATTCACCAGCTGGGCAAAGATTACCT
CCACTTTATGACCATGGTGAACAAGACGATCGCGCAGCAGGGTATCCAGCATGCCAACTACGAGCTGCTTGTGACGAAGC
TTCAAAAAGGCGACGTGCTACCGCAGGATCTCAGCTCCGAGAACCGTTTTGCCGACCAGTTGGATGAGGTGCCATTTGCC
GAGCAGGCAACGAAGAAGCTCGAGATGAACGCTGTGCATCTCAGGACGGCATGGGACACGAAGGGCAAATCTACCAAGGA
AGACTGGCAAGAGTGGCTGCGTGGATTCAGTACGACGTTGCTGAACGAGTCACCCAACCATGCTCTCCGCGCGTGTGCTG
CCTTGGGCAACCTGTATCCGCCACTGGCGCGGGAGCTGTTCAACTCGGCTTTCGTGTCTTGTTGGAGCGAGCTGTACGAT
CAGTACCAGGAGGAGCTGATCTACAATATTGAGAACGCGATCAAGTCGGAGCACATCCCTCCGGACCTGCTCGGGCTGCT
TCTGAACCTGGCCGAGTTCATGGAGCACGACGACAAGGCGCTGCCTATCGATATTCGGGTGCTGGGGCGCGAAGCGGGCC
GGTGCCACGCATACGCAAAGGCGCTGCACTACAAGGAGCTCGAATTTTTGCAGGACCAGAGCACGTCTGCGGTGGAAGCT
CTGATCTCGATCAACAACCAGCTACAGCAGTCTGATGCCGCCATTGGCATATTGCGTAAGGCACAATTGTACAAGGATGG
CATACAGCTGCGTGAGACCTGGTTTGAAAAGCTGGAGCGCTGGGAGGAGGCGCTGGCTTTCTACGAGCAGCGCGAGAAGG
AGCTCCCAGAGGACCAGCTGGCATCGATCGAGCTGGTGATGGGCAAGATGCGATGTCTGCATGCGCTGGGCGAATGGGAT
GCGCTGGCGACGATTGCAGGGAACACTTGGGCCAACTCGGCGCAGGAAATCAAGCGACTGGTGTCGCCGCTGGCGACGGC
GGCTGCGTGGAACCTGGGCAAGTGGGACCTCATGGACGTGTACCTGCAAGCGATGAAGCGGCAATCGACGGACCGGGCGT
TCTTCGGGGCGATCCTGGCGCTGCACCGGAACCAATTCCGCGAAGCAGCCGTCTGCGTGGAGCTGGCACGGCAGGGACTG
GACGTGGAGCTCAGCGCCCTCGTGACGGAATCGTACACGCGGGCATACCAGGTGATTGTGCGGGTGCAGATGCTGGCGGA
GCTGGAGGAGCTCATCACGTACAAGCAGTGCGACCCGAAGAAGCAGGAGTCGTTGCGGCGGACGTGGGAGACGCGGCTGC
TGGGCTGCCAACGCAACGTGGAGGTGTGGCAGCGAATGCTCCGGCTTCGTGGGCTGGTGGTCAGCCCGATGGAGAACATG
CAGATGTGGATCAAGTTCTCGAATCTCTGCCGCAAGTCGCAGCGGATGGGCCTGGCGGAGAAGTCGCTCAAGCACCTGAT
CGGCAACGAAGACCCGCTCGAGTACACGATCCCACACTGGGTGGACGCAGAGGTGCTGCGGGAGCGCGAACAGGTGCGCG
AGAGGGAGCGGGAGATGGAGTACGAGCGGCGTCGTGCGGCCCGGGAGAACAACGGATCGGGCAACGGCAACGGCATCGAC
ATGATGGGCGGACGGGGCCAGCGAGACTTCCGGCACGGACGTCTGCTAATCGACAGCACGGCCAACGAGGCGGGCAGCGG
GGCGGCCGCACACGACGACTACCCGAAGCCGCCACCACCGCCGCCGTCACAGGTGATCTATGCGGTCCTCAAGTACGAGT
GGGACCGCGGACAGCTGGCAGACAACAAGCACGCAGGGATCGCGGAGAAGGCGCTCGGTTGTCTGCGGCAGTTCACGGCG
GACCTGGGCGTGCGTCTGGAGGCGGCACGGCAGCAGTTCCAGATGCACGGCATGACGATGAACGGCGGAATGGGACCAAA
CGGGCTGGGTGTCGGCGGGCTAGACATGTCAGGCCACCATGGGTTTGACCGGGTCCGAGATGCGGCATCGGCGGCACAGA
TGAGCCCGGAGACGCAGCGGCTGCTACAGGAGCAGACGAAGCTGCTGGCCAAGGGATACCTGCGGACGGGCGACTGGCTG
ATCGCGCTCAACAAGGACTCTTGGCGCAACACACACGTGCGGGAGATTCTGTTTAACTACACGCAGGCGACCAAACACAA
CCCGAAGTGGTACAAGGCGTGGCACGCGTGGGCACTGGCGAACTTTGAGGTGGTGCAGGCACTGACGGCTGGCGGCAACG
CTAACGGGGCCAACGGAGTGGGCGGACAGGCAGCGGGGCCACAGGCGGCGGTGGATTACGGCATAGTGTTGGAGCACGTG
GTACCGGCAGTGCGCGGGTTCTTCGAGTCGATCGCGCTGTCCAAGGGCAGCACGCTGCAGGACACGTTGCGGCTGCTGGC
GCTCTGGCTGACACACGGCGGCCATCCGGACGTCAACGTGGCCGTGACGGAGGGCTTCGCGCGGGTCAGCGTGGACACGT
GGCTGGAGGTGATCCCACAGCTGATTGCACGGATCAACCAGCCGAACCGACGGGTACAGCAGTCGGTGCACAACCTGCTG
GCCGACGTGGGCCGGGCACATCCACAGGCGCTGGTGTACCCGCTGACCGTGGCGATGAAGTCGTGGCAGAACACGCGACG
GTCACGATCGGCCGCACAGATCATGGACAGCATGCGGCAGCACAGCGCGAAGCTGGTGGAGCAGGCAGACCTGGTCAGCC
ACGAGCTGATCCGGGTGGCGGTGCTGTGGCACGAGCTCTGGCACGAGGGTCTGGAGGAGGCGTCGCGGCTCTACTTTGGC
GACCACAACATTGAGGGCATGCTGGCAGTGCTGGAACCGCTGCATGATCTGCTGGAGCGTGGGCCGGAGACGTTGCGGGA
GATATCGTTTGCGCAGACGTTTGGGCGTGATCTGGGCGAGGCGCGCGAGTGGTGTCGGCAGTACGAAGTCAGCCACGATG
CCAGCGACCTCAACCAGGCTTGGGACCTGTACTACCAGGTGTTCCGGCGGATTACACGGCAGCTGCCGCAGATGACATCG
CTGGAGCTGACGTACTGCTGTCCGAAGCTGTTGATGGCACGTGACCTGGATCTCTCGGTGCCGGGCAAGTATCGCAGCGG
ACAGCCGGTGATCCGGATCATGTCGTTTGCGCCGACGTTTGCGGTGATCAGCTCGAAGCAGCGGCCGCGCGAGATGAAGA
TTGTGGGCAGCGACGGCAACAACCACGCGTTCCTGCTCAAGGGCCACGAGGACATCCGACAGGACGAGCGGGTGATGCAG
CTGTTTGGGCTGTGCAACACACTGCTCTCGATGGACTCGGAGAGCTACAAGCGCCACCTCAACATTGAGCGGTTCCCGGC
GATCCCGCTGTCGCAGAACTCGGGCCTGCTCGGCTGGGTGCCCAACAGCGACACGATCCACGTGCTGATCCGCGAATATC
GCGACTGCCGCAAGATCCTGCTCAACATTGAGCACCGCATCATGCTGCAGATGGCGCCCGACTACGACAACCTGACGCTG
ATGCAGAAGGTGGAGGTGTTTGGCTACGCGCTGGACAACACGACCGGCCAGGATCTGTACCGGGTGCTGTGGCTGAAGAG
CAAGAATTCGGAGGCCTGGCTGGACCGCCGGACGAACTACACCCGCTCGCTGGGCGTCATGTCCATGGTCGGCTACATTC
TCGGCTTGGGCGACCGGCATCCGTCGAACCTGATGCTGGACCGTGTGACCGGCAAGATTGTGCACATTGACTTTGGCGAC
TGCTTCGAGGTGGCCATGAAGCGGGAAAAGTACCCAGAGCGCGTGCCCTTCCGCCTGACCCGCATGTTGACGTATGCCAT
GGAAGTGAGCAATATTGAGGGCAGCTTCCGGATCACGTGTGAGCACGTGATGCGTGTATTGCGAGACAACAAGGACAGTG
TGATGGCTGTGTTGGAAGCTGTGAGTTTTGATCGGTTTTCTTTTCTTTCTGATCGTTCTAGCTTTCCTTTACTAATTCCC
TAGTTCATTCACGACCCGCTCTTGACCTGGCGTCTGACCAATGCACAATCGCCGGCCGGCCCCAACTTCCAATCGGAACG
CGAGCTGGCCATCCTGGGACCGGCTGCGGGTGCGCGGACGAGACGGGCGTCGGTCCTCGACGGACACGTGGCGCCGTCGG
AGCTTCTGGTAGGCGGATCTGCCGTGGACGATGACGACGACGGCAGTGCAGTAGCCGGACCCGATGCCGGTGGCGGACGT
GCTCGCACGCGGTCCAACAGCTCGCTGGTGGCGGCGCCGACAGCCGCAGCAGCACCAGTCAATGGAACGAACGGAGCCAA
CGGAGCTAACGGAGCCAACGGAGCCAACGGAGCCAATGGGACCAACGGTTCCCAGCAGCTGCTGCCACAACAGCTGCCAT
ACGCGGCTGAGACGCAGAATGCGCGGGCTGTCGAGGTGCTTGGGCGCGTGCAGCAGAAGCTGACGGGACGCGACTTCAAG
CCGGGCGAGGAGCTGGACGTCACGGCGCAGGTAAACAAGCTGATCATCGAGGCGACCAAGCTGGAGAACCTGTGCCAACA
CTACATTGGTTGGTGCAGCTTCTGGTAGGGGACTGGGGATAGAAGGCTAGGAGGAGGAATGGACAGCTGACGGCTGGCGG
GCTTCTAATGCGTGTTCTTTTCTCTTGGCGTCTGTGTATTCCTTGCTGCGCATATGGATGCTCTTGGCGGGAAAAGCGCC
GAGCATGGGAAGCTGATATTATTTTACGAGATAGTTGCTGTTGATTTCGCTAAGAGTCCGCTCGTTGCCCTGGACCGAAA
AGGTGACTAATGCAAAGATGCGAAATGGGAAAGTGCCGAATCGGGAAAGACCAATCGTGTAAGCCAAATCGGGCAAGAAC
GAGCAGGTCGAGGCAGGCCCAAAGACAACAAGGAGAAAACAGGCGATTGAATCAGTCAAGACAAGGATATGCTTTATGAC
TTGAGACGGTGGCTAGCAAGTCGCCTGGATAAACGCGGTCGTGGGCACATCTGGCATAGGCTGCTATCACTTGGCCATCG
CCGCGCTCTCACCTGGCTCTGTCTTGTTTACATTTGGCCGAGCGGCGTAGTCTCGGCGCAGCCGATTTTTCTGTTGTTTT
TATTGTGGCAATGGTAGCTATCATCGACGTGATCCGATACATATCACAGCATACGCTGGACGAGCCGTCACGAATCTGAA
GGGTGGAAGAGTACGAGACAGAGAAGACGACAAGAGAGCTTCTGCACGACAGCCGGCATCGATGGCCAGCATCCACTCGG
TCCAGAACTTCTCTCTGCCCAGCCGAGCGGGCAGTCGCCGGACGGTGACGCCGCTGGGCCGATCAGGCGTGCCCTCGCTC
GGTCCTGCCTTGAGCACAGCCCAGCTCAACCGCCGACGGCCTCGGCCTATGTCGACGTCTTCATCGGCGCCGGCACTGAC
GACGGCAGTAGGGGATGGGGACGGCAGCAGTGCGGCGTGTCAGCCGGAATGGATCCAGGAAGAGGGGTCAGACAGAGGAC
CGGAAAGGGAGACACGACAGTCGCCAGATGCTGGCATTGTTATCGGTCACGCTACCACCAGTCTCCGTCTTGCCGCCTCT
GGCGGTCAGCCGCCGCCGCTGACTCGCTCCATCTCCATCCGCTGGGGCCCACGGCTGCGTCACATTCCGCTGAGCGAAGT
CCAGGCCGCCGACGATGCTGTCTGCAATCTGGCTCGCCAGCGCCGCCATCGGCTCGCCATGGTGCTGCTCGTGGCCGTCC
TGCTGGCTGGCTTGCTGTCGTGCGCGGCTGCCGTGACGCGGTGCTGCTCGTGGCCGTCCTGCTGGCTGGCTTGCTGTCGT
GCGCGGCTGCCGTGACGCTGGTGGCGGCGAGCGTGGCTGTGCGGGCGACGACGACGACGACGAGCGCCCTGTCGTGGGAG
GCACACGGGATCGCATGGCTGGCAGCCAGCCTGGCAATCAGCGCAGCGGCCGGAATTGTGCTGGCAGTGGTGGCGTGGCG
ACAGAGGCAGCAGGCCGGGAGAGATGACGAGAGCGAAACAGGAGAAGAAGCGGACGCGACAGACCAGAGCAGAGAATGGA
TGGAGATGGGAGCGCTCACGAGCGAGGACCAGCTCGATCACATCGTCGACTGTGAGGAGGACCGCAACTGGGCCCGTTTC
GTCGAGGATCCCCTACGGTTGCGACGCTATGTCGAGGCCTTGGAGGCACGGCTGGCCTTGACCCAAGAGACGCCGGAAAA
AGAGGACACCAAGGCTGCTGGAGAGGTAGAAGAGGCGGAAATCGCGGCCACAACCGTCTCAGCCGTCACCTGCTCGAAAG
ACCGGATTCTGCTCGGCCACACCATCACCAGCAGCTGCAACAGCAGCAGCAGCAACGCCGTCGTCGGCGGACTGGCCATC
GGTGGGCCAGGTGCATCGTCCAACAGTCTCCTCCTGCCGCTGGCACCACCTTGGCCGCCGTCGTCGCCGCCGCCTAGACT
TTGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62