GenePrediction:GLEAN_1046 Details

Name: GLEAN_1046
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:257398..259570 (+ strand)
Length: 2173
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:257398..259467 (+ strand)
Length: 2070
Type: CDS
Source: GLEAN
Position: GCSC_173:259526..259570 (+ strand)
Length: 45
>GLEAN_1046 class=GenePrediction position=GCSC_173:257398..259570 (+ strand)
ATGAGGCCTCTGGTGCCGGCCATTCGGCTGGTTTGTCTTCCTCTGCGGACAGCAGTGCGGCCGCGTCGGCTGTTCCGGGG
TCCTGAGGGCTCGAGGGCGTGGACGAGCAAGACGGGATCGCACAAAGAGCAATTCCGGACTTCATCTGGATCTGGCCCAC
GACGGACACGCGTGACGCTCCTGGCAGCAGTCCACGGCGCGGCTGCTCTGGGGACGTCTGCGTTTGTGGAGCTGAGCGAG
ACGGACAACAGCGGGACGGCACACACGGTGGAGACGCGGATGCTGGAGGTGTCGCGCGCAGAGATTGCCAAGACGGTCAG
CGCGGACGCGTGGGGGCCGCTGCGGCTGTGGCGACAGGTGGTGCTGTTGGTGGATCTTTACGTGTGGGAGCCTCTGTGCA
CAGGACTGCGGCTGGTGCAGCTCAGCTGCATCTTCGTGCCGGTGCTGGCGATGGCGCCGTGCATCTGGATGGGACGACGT
CGACGGGACCGTGACAATGAGCGGGTGGGCGCTCTGCTGTGGTACCGCGTCCTGGTCAAGGCCATGGAGCTGGCTGGGCC
AACGTTTATCAAGCTGGGCCAGTGGGCGGCGTCACGATCAGACATCTTCCCGACCGAGATGTGTGCGGTCATGTCGAAGC
TGCACTCGGATGCACCGGCACACTCGATCCGCCAGACGCGGCTGACGGTCGAGACGGCCTTTGGCGGCCGCATGGACGAG
ATCTTTGACGAGTTTGACGTCGAGCCGCTGGGCGTTGGTGCCATCGCTCAGGTCTACAAGGCACGGCTGCGACCAGCAGG
TCCGAACACGCGGGCGAACCGGGATAGCGAAGAGGAAGAGGCCAGCCACAACCACAGCGACAAATACGGACTGGAGAATG
TGCGACGCCGCGTGGAGCCGCTGATCAAGAGCACGCCGCAGCGCGTACCGTCTTCCTATGTGGCCGTCAAGGTGTTGCAT
CCCGGCGTCGAGCGGACGGTGCGGCGCGATCTGCGGATCATGGGCTTCTTCGCGGCCGTGCTCAACGCGGTCCCGACAAT
GGAGTGGCTCTCGCTGCCGGACGAGGTGGCGCAGTTTGGCGAGATGATGCGGCTGCAGCTTGACCTGCGAATCGAGGCGG
CCAACCTGACCATCTTTCGGCGCCACTTCCGCGACCGCACGACAGCCTCGTTTCCGTTTCCTCACCCCGAGTTCACCACA
CGCAACGTGCTGGTCGAGGAGTTCGCTCAGGGATTACCGCTGTCGGCCTTTATCGACAACGGTGGCGGCGTGTTCCAGCA
CGAGATCGCGTCCGAGGGCCTCGACGCCTTTTTCCGCATGCTGCTGCTCGACAACTTTGTGCACGCCGATCTGCATCCGG
GCAACATCATGGTGCGGTTCTACCAGGCAGCTCGGCCGGACCTCTCGCTGTCGGGCAGGGCTGAGAGCCAGAAAAGCCCG
AAGCCACAGGAGCAGCCCGACGTGACCGAGCAGGTGCTCGCCCGACTGCGGCCGCACTTCCACGACAAGGTGGCCTGGCA
GGCCGAGCTGGCCCGCATCGATCACGAGGGCTTCCGGCCGCAGCTCATCTTCATCGACACCGGGTTGGCGACGCAGCTGA
ATGAAACGAACCGGCGCAACTTTCTGGACCTGTTCCGGGCCGTGGCCGAGTTCGACGGATATCGCGCCGGACAGCTGATG
TGCGAGCGGTGCCGGCAGCCCGAAGCAGTCCTGGACGAGGACGTGTTCGCGCTCAAAATGCAGCACCTGGTGCTCTCGGT
CAAGAGCCGGACCCTGGCCCTTGGAAACGTTCGCATCGGCGACATCCTGCAGCAGGTTCTCGGCATGGTGCGTGGCCACC
ATGTCCGCATGGAGGGCGACTTTGTCAACATCGTGCTCAGCATTCTGCTGCTCGAGGGCATCGGCCGCAGCCTCGACCCG
GACATTGACCTGCTCAGCGCGTCACTGCCGATCTTGCGCCAGCTCAGCGCCCAGAGCGGTGCCGACTTTGTCAAGGCCGG
CGACTTCTCCATGCTGCGCATCTGGGTCGGCCTGGAGACCCGCCGCTTCCTGCAGGCGAGCATTGAGGATGTGAGTGCTG
GCGTGTGCCCGTCGATCTTGGCGCTGATCACCCTGCTAACTGCCACAGGTCGAGCGATGTGTCCGATACGATCTCCTCTC
GCCGAATGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62