GenePrediction:GLEAN_104 Details

Name: GLEAN_104
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:721182..722923 (+ strand)
Length: 1742
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:721182..721797 (+ strand)
Length: 616
Type: CDS
Source: GLEAN
Position: GCSC_179:721866..722268 (+ strand)
Length: 403
Type: CDS
Source: GLEAN
Position: GCSC_179:722776..722923 (+ strand)
Length: 148
>GLEAN_104 class=GenePrediction position=GCSC_179:721182..722923 (+ strand)
ATGCACTCAATTGCTTCTTTTGATTGTGCAGAAATCAGCGGCGACGATAACCAGCGCAGATCTAAACCTTCTGGCAGATT
CTGGACTAGCAATGCAAGCTGCGGATGGAGTTTCGAGTTCTTCTGTATGGCGGCGAGCTTCCTGTGCACCGGTGCTATCA
GCGTCATTCTCTTTCAGATGAACCACCGGAGCGCTCAGAGCTGGACCTTTCACTTCACCATCAACTCGGTAATCGCCGCC
CTATCCACGCTTCTGAAGATTACAGTAACCGCCGTGCTGGCGTCTTGCCTGAGCCAGATGAAGTGGCTTCACTTTAAAAC
ATCTGCCCGACAGCTACGTGACCTTGATCTTTATGATGCCGCCAGCCGGGGCAGTACTTGGGGCGCGGCTGTCGTGCTGT
GGTACTCCCTGTGTAAATGGTCGAGCTTTACGGCTGCAGCGGCCGCATTTACGACTATTCTTGTTCTACCTAAGAGCATT
GCCGTCCAGCAGTTGGTCGGTACAGACCTGCGCAGTGTCACTGTCGAAGGCCAGAACGCCTCGTTCCCCGTATGTCTTGA
TTATAACGGCGGGACGATTTCCGATGCGGCTCATGGCAGTGATTTCTATCCGCAAGGTATGAAAATATCGTCGGTATCCT
GCACATATCAATTATGCTGAAAAACGCTCGTTGGTGTCTGCCAGCTTCAACGGCCGATGTCAAGATGCAGGGGGCAATCT
ACAATGGCATTTTCAATATTAGCACAACACCCATCTACACATGTCCATCGACGTGTGTCTGGGACACTGATATATACCAT
ACTCTGGGATTCCACGCCAATTGTACGGATGTTACAAAGTCGATGGTGGTGAGCCCCTACCCATCTAGTGCCTGGATCAC
AGCGTATTCTGTCATGACCCCCAACAATATATCAATGTCAGCAAACTTTTCCACAACCGCCAACCAGGCTGTTATTAACG
TCAAAGCTATCGATCTGACTGGCGAATTTTCCAGCACTATGCCGGCTGAGTTCATCCGCATCGGAATTCTCAAATCGCCC
GTTACAAACGAGGCCAATAACGTCATTGACCAACATTTTCTGGAAGGGTATGAATGCACCGTGGCCTTCTCTGGATATTC
CTATTCGTATGCCTCTGCAAATGGCACGCATTTTAGTATCGGCACCTCGACAATGACGCCGTTAGACGAGGGCTTTCTTA
CGTCTGCTTCGATAACAGAATCCTTCGTCCAATTCAACAAAACTCATCTGCCAAAGATGACAGCCAGGGTTCCTGATATT
GGGGGCATAGTAAAATTTTTTACATCTGACCGCTTTAGTGGCACCGTTTATAATGGCGAAGGCGTTCCCAATGATCCGCA
GGGCGTTGGTGTTGCACTATTGAACGCGGACGTCGGAACAGCGTTTAGCGCTATGGCTGATAGTATGACTGCTCAGTTAC
GGCAAAGCACAAATTCCAGTCTAGCCTACGGCAAGGTTTTAAGTCAGGTCGCAGTTGTCCACGTTTACTGGTACTATTTG
CTTCTGCCCTTGGCCGTTCAGTGTCTTTCTCTGGGACTCCTTATCCAAACTTGGCTCTACAATAAGAAAAGCAGAGTGGC
GCTCTGGAAAGACTCCACTGTGGCAGTCCTTTACCACGGTGTTGTTTCCAACACCGGCTCTCCAGACATTATTCGCACGG
ACATCGAGAGTACAGAGAACCTGAACACTCTGGCTAAGCAATCGAAGGCCAGACTGGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62