GenePrediction:GLEAN_1050 Details

Name: GLEAN_1050
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:268288..271153 (+ strand)
Length: 2866
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:268288..270061 (+ strand)
Length: 1774
Type: CDS
Source: GLEAN
Position: GCSC_173:270117..271153 (+ strand)
Length: 1037
>GLEAN_1050 class=GenePrediction position=GCSC_173:268288..271153 (+ strand)
ATGGACGACTCCTTTGGCCCAAACAGCCCCCCTATCCCGCGACAAGCACATCAGCACTCTCGGCGCAAGGCCATACACAA
CGTACAAGATATTGCATCGCCTTCTTCTGCCTACAGTCGCGGGCTGCCGTCATCCTATGAAACTGCGATTTCCTCAGCAT
CTCCCGAGGTCATCTCCTCACTTATAACAAGTCTCTGCGTTATCTCGAAGCCTACCAACGCCCAGCACGACGTGTCTCAT
AATTCTTTGCAACCACTCTCTTTCTCCAGCGTAGGCCTACTCTCGCCCGATAGTGGCTCGTTCGGCGTGGACTACGGCGC
CTATTCGAATACCGCGATGGCAAGCATGCCGGACAGGAACGTTTCTCTGGACGAGCTTGCCGCCAGCCCACCTGTCATCC
GAACTGCGAAACCGCCCAGCGGCTTCTCGCCTCTCACAGCACCCAAATCTCCGGTGCGTGAGACGTCGTCTTCTGGCGGG
CTCAAGTCCCTGCTGTCGGGCCGCACATCCTCCCGACCGTCCTCCAAAGGCTCGGTAGCATCACGCGATGCTGACACCCA
GAGCATTGGTAATCTGTCGGTCGAGCGCGGGGCCGTGTCGCCCATACCTGAGCTGAGGAGAAGATCCTCCCACGACAGTT
GGGGAAAGAAAACAGCACGGTCTCAGAAAGGCTTGATGTACATGAGCAGCAAAGAGCGCCTGCGCGAAAAAGACGCGGAG
AAGAAACGGATCAGCATAGGAGCTGTCGGGACCGACCGGTTGAGCTCTTCTGGTGCCATTTCCCCGCGGACTGACGCATT
CTTGGCCGAAGAGCCCATTAGTGAAGAGTCGCACCACGATTTGCACCTCGACTCGCCCCGCCTGGCAGATCCGCGAGGGT
CTGTAGACAACGGGGGGGCGCCGAGTACTCATGTCATCCCTATTCGTGACTCTAGCCTCCGCAAGACGAGTTCGAACGGG
AAGAGATCCTCGCGACGCTCTTCAAGACACAAGAACGAGCCTTCAACAACCGACATAATCCAAGAAACCGACGAGCATCA
CATGTACGGGTCGAGTGACGGCTACAACCAGCCCGGCCTCGCAAGGAGGAGCACCCAGCCTGCAAGAGGCAGAATGTCTC
CCATGCCGATGGGTGGTGAAGAGCCGGCGGTGCAACCCAGCCGACAGAGCAGACCGAGTGACCGTGAGCCCGAACCGAGA
TCATTCTCCCTGACGGGGTCCTCTAGGCAGTATAGCGACATTAATTATGCGAGGGAGGATGATCCTGAAGATGGTGCGCC
TTTTCCTGCCGTTTCGCAAGGACGCCATCGTTACGGCTCAAACATGCTTGATCCTAGCGAGGGCAAGACGAAGCGAAATA
GCAAGCTGAAGCGCCTTTCGGGCCCGCTGAGCCCCCGAATCGACGACAAGGGGGCTGCGGCAGACAGTTCGAAAAAGGAC
AGACCATCTATCGAGGATACGCATGTCGCGTATGAACGTCCTGGTAGCGCAGACAGCGTCGACGATGCCGTTGGGGCTTA
CCTGTGCTCGCCGCGCTTGTCGCAGAAGATCCGGCATCCGCAGACTGGTCGCATAATCTCCTTTTCGGAGGTGGGAGACA
GCGACGGGTCGGCTGTGTTCTGCTGCGTTGGTATGGGGCTGACACGGTACATTACTGCGTTTTATGACGAGCTAGCCTTG
ACGTTAAAGCTACGTCTAATCACCCCTGATCGGCCGGGTATTGGAGACAGCGAGCCGTATGCGGACGGCACTGCCACTCC
GTTGGGCTGGCCAGGTATGTGGCTCCATGTTTCGCGTCTCGTGCGAATTTAGGCTGACGAATATTGCAGATGACGTGTAT
GCGATTTGCCAGGCCCTGAAGATCACAAAGTTCTCCATACTCGCCCACTCGGCTGGAGCCATTTACGCGCTGGCAACGGC
GCTGCGCATGCCCCAGCACATTCGAGGGCGTATTCATTTACTGGCGCCGTGGATTCCTCCGTCGCAAATGTCCGTCTTTG
GAGCCTCTGCGCAAACGCCCCTGCCTCCGACAAATGCAATCCCCACATCGCAGCGGATTCTGCGGGCGCTTCCGACCCCT
ATCTTGAAGGCGGCCAACTCTAGCTTTATGAGTGCGACGAGCAGCTCGATCACGTCAAGCCTGCCAAAGACGCCAAAGCG
GAAGCGGAAGTCGAATGCCAACCTTGCGAAAGAAAGGGAGAAGGATGCGCACAAGAACCATCCGCTACCAACGGACAACA
AGGAAAACGTTGCAGGCCAGACGCATGCGCACAAAGACCAGGCCGGCTTAGAGGATATGGACCGTATCCGGCCCCGCGGA
ACGCGATCCAACTCGACGGCAGGCATGGCTGCGGCCTCAGATCCGTCTGGCCACAGGAGAGGCCCATCGGCCGTCGGACA
CATGTCGCGCGAGTCGGCCGTGATAGCAGCAGCAGCCAGCGCGATCGCCGAACGGGAGCGGCAGGCGGTCTACGACACCC
GTCTGACACACGCCATCTGGGAGCTCGCTACAACGGGGGCCAACCCGGCGGTAGACCTGCTGGTGTGCCTCGAACGGCGG
CACACGATTGGCTTCCGCTATGTAGACATCACCCGGCCCGTGATTATCCACCACGGATCCCGTGATGCCCGTGTGCCGGT
GGAAAATGTGCGGTGGCTGGGCAAGACAATGCGCCGCTGCGAAGTGCGGGTGCTGGAGGGCGAGGAGCATGGGCTGATGG
CCAGTGCATCAGTCATGGGCGGAGTGTTGATGGAGATTGCGAAAGAGTGGGAAGATTGGGGACGTCTGACCGGAGCGTCT
GGTCACAGGCGCGAGGGTACGCGTGATGAGCGTGGCCGCCGTGGGACTGTCGGCATGGCTCACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62