GenePrediction:GLEAN_1057 Details

Name: GLEAN_1057
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:312329..314480 (+ strand)
Length: 2152
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:312329..312648 (+ strand)
Length: 320
Type: CDS
Source: GLEAN
Position: GCSC_173:312713..314480 (+ strand)
Length: 1768
>GLEAN_1057 class=GenePrediction position=GCSC_173:312329..314480 (+ strand)
ATGACCAGCCTCCATGGCGGCACCGCCCCACTGGCTGCGATCACCACTGTCTTTGCACCGACCTGCTCGACCAGCTGGCT
TGTCACTACCACGAAGCTGCCGTCCCAGTTTCCCGCTTTTCCCTCGGCTGGTCCCAATTCGTGTGATCCGCCTGCTTGGG
CGAGCAACCTGGCCGGCGGGGGCTTTCCATTTTATTCGCCTGCCATATGCCCAAACGGCTTCCAAGTCGGTGCCGGCTGC
TCCTTCACCGCCACCTCCCTCACCAGCCAGGGTTTCCCGGCTATAGCTCCTGGCGAGACTGTTGCCTTTTGCGTCCCAAG
GTATGTCCTACCGTCTACTTCCTCCGGAGCTGCTTCTCTATACTCGCCATACTCACCCCCACAGTGGACAGAGCTGCACG
TCCGACACCACTGACTTCCATGGCGGCATCTGGGGTGTGAGCACCACGGCCACGACCTCTGGTGCCACCTTCACGGTTGG
CCCGGCCATGCAGATCCGCTGGCGGGACGTGGATCTCGCCGTGCTGGCCACGCATCCACTCACGCCCGGTTTGACGCTGG
CCGGGGCGACATCAGCTGCTACTGCGCCGGCCGCATTAAAACCCACGCCAACGCCGGTACCAATGACAGCCTCGACGACG
ACACGGAACATCAAGACGCTCACGGCAAGCACCGACGACGGCGACGACGACGACGACAACATTAGCATCGGTCATAATGT
ATCTGCGGCATCTGCATCTTCCAGCTCCACTTCAGCGACAGGATCCGCGGTTTCATCAGCAACGACAGGCAGTGCCGTCA
GCGGTGCTGCGGCTTCTGCCACTTCGCAGACGACTGCCTCGACGGAATCCACGGAGACAGCCGCCCGGAAATCCCACAAG
CGCAACGTCATCGGAGCCGCCATCATGGCTGCACTGCTGGGGCTGACGGCCATTGGAATCGCCATTTTCCTCGTCGTGGC
CCACCGTCGCCGCTCACACCAGCTACTGTATCCCAACGGCGACGTGCTGGAAGGAAGTACCGACTTATCGGGCGAGCGCC
AGATGACGGCCGTTGGAGTGGGCGTTTGGGTGCGGCCACAACAGCCGTCGACGGACTTCCAGAGACAAGGGCGGTGGTGG
CCGTCCGGGCTGATGTCACGGATAACCAGCCGGGACAGTCATGGACGGCTCCCGCTCTTCTCCCGACGTGGTAGAAGCCG
TAAGAGTCATGCAGGCAGTCCCGTGGAGCGGCGATATCACGAGCTGGATCCACCGTCAGGACTTCAGCCGGAGGAGCAAG
AGGTGCAAGATATGTCAAAGACGGCCACATCCCATGCTTATGCCGATACTGAGCAGTCCACCGAGATCAGGATCCGTGTG
GGCGTGCTGCCGCCCGTCTACGATCGACGAAATAGCAACGGCAGCAGCTTGAGCAGTCGAAGCAGCAGGAGCAGCGGAAG
CAGCAGCTTTTCCGACGTCGACCTGCAGAAGTTGCGGAACAAGACAGCGGTAGGCTCACGGTTTGCCGGCGGAAGCAGTA
GCCAACAGCAGCAGCAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAA
CAACAACAACAACAACAACAACAACAACAACAGCGGTGGAGCTGGATGTCCCGCCTGTCACGATACATGCGGGGGGGCGT
CGTAGGCGGTTCCAGCAGCGATGAGAGCATGCGGTCCCAGCTGCCGACCGAGGACGATGCTGGCAGCAGCAACCGCACGT
CAACGCGTCTGTCTCGCTGGACGACACGTACCGACGCGGAGGAGTCACAACGGGGTCTTTCTTTTGTCACAGATGGGGAG
TATGCCGGCGGCGAGCCGGACGAGAGCAGCTGGGAGGCCTTTTCGAAGGCGCACGGCGGCGTGGCCAAGCATCTGGTCAC
CAGCAAAGCCCGCAGGGTCGGGAATGGGGGAGTCGGCGGTGCGCACGGCCTGACGACGCCACATCGTGGACAGGCTGCCC
TTCTTCGGCTGCCGTCGCCGGCGAGAACGCTGAGCAGCGGACGGTCAAGGCGAACTACGCGTGACCGTTCGGCAGACGGA
GGCGGCATGGATGACCGCCACCACCGCTTCTCGCGGATGAGCAACGGCACATTTGGCGATCTCGGCGATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62