GenePrediction:GLEAN_1058 Details

Name: GLEAN_1058
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:324974..326809 (+ strand)
Length: 1836
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:324974..325268 (+ strand)
Length: 295
Type: CDS
Source: GLEAN
Position: GCSC_173:325325..325764 (+ strand)
Length: 440
Type: CDS
Source: GLEAN
Position: GCSC_173:325819..325911 (+ strand)
Length: 93
Type: CDS
Source: GLEAN
Position: GCSC_173:325965..326378 (+ strand)
Length: 414
Type: CDS
Source: GLEAN
Position: GCSC_173:326436..326602 (+ strand)
Length: 167
Type: CDS
Source: GLEAN
Position: GCSC_173:326659..326809 (+ strand)
Length: 151
>GLEAN_1058 class=GenePrediction position=GCSC_173:324974..326809 (+ strand)
ATGGACAAAGTCGCCATGGAAAACTTCGCGCTCGAGGCCGAAAGCCATCTGCTCCAATTCAAGGCCCAACTGCTCAGCCT
GGACCGCCCCGTGCTAGTCGGCGGTGGTGTTCTGGCTGCATTGGCAGCAGTGGTAGTCATCACCTTACTCAAGGGCTTTT
ACAACCTGTTCCTGCATCCCCTCCATGATATTCCTGGTCCGTGGATTGCAGGTGCTACCCGTTGGTGGTTGTTTCAACGC
GAGTTGGTGAAGGAAGATGCCCACGCCACCATTTTGAAGCTGCACCAAAAATATGGTACGTGCCGGTTGGTCCGCAGTGT
TGCATAGCACCCAGAGAAACTAACTGTCCAGGACCGCTTGTGAGGATTTCGCCCGACGAAGTGTCCGTTAATGATGTCAC
GGCCTATACCGAAATCTACAGCCAGACCTCCAAGTTCCCCAAGGCCAAGTATTTCTACTACGCCTTCACCGACCAGACTG
CCAATCTGTTCTCCATGTACGACAAAAAGGAGCACATTCAGGACAAGCGCTTGATGTCGGCAGCCTTCTCCAAGGCCGCC
ATTCTCCAGCGGGAAGACAAGATCTACACCATGGCCGACCAGCTGATGGACCGCATCGCCGGCATTTCCGATGCGAAACA
GCAGTTTCCCCTCCTCAGTTCTTTCCACTGTATGACCCTGGATCTGATCTCTGAATTTGTTTTCGGCGAGGCTCCTGGCT
CGTTATCCCTGAGCGACTTCAAGTCGCCCATTGTCCAAGAGATCGCCAATGCCAGTGCCACTATCGCATTTGTAAGTGTG
GCATACGTACCACACCGTGTCAAACAAAGTAGCTAACTCTGGTAGTTTCAACAATTCCCTACGTGTCGCGAGCTGCTGCG
TCTGGCCGGCCACTACAAGATCAAGGCGATTCCTAACCCGTTCCTCGGACTCGGACAGGTTCGTGAGCTACTGCCACACC
GCACATCCATTCGTTGCTAATTGCCCGGCAGGTGGCTGACAAAGGCTTGGAAATAATGCGGTCGCCTGACAACACCAAGT
GGACACTGTTTGGCGCCATGGTGGAAACTGCAAAGAAACACGGTATTACGCTGTCCAACGAGCACCTAGTCTCTGAGGGA
ATTCTCATGCTTGTTGCCGGCACCGATACAACGGCCATCGCCCTGTCTACCACCACGCACAATCTCATCCGGCGTCCAGA
ACTGTTTGAGAAGCTGCGCCAGGAAATCATGACTGTTGCACCAACACTAGATTCTCGGCCCAAATACAGCGATCTTGATG
CCCTGCCATTTCTGGACGCTTGTGTTAAGGAAGGTCTCCGGATTAGCTCGCCTGTACGAGGAAGACTGCCGAGAGTTGTT
CCAAAGGAAGGCTGGACTTTCAAAGGCCGATTCTTCAAGCCCGGTGTACGTGTAAACCAATCCCTCCACAGTGCCAGCCA
TGGCGAGCTAACAAATCACCAGACCATTGTGAGCGCGTCATCGCTGTACCTTCTTCACGACGAGGATGCTTTCCCATCGC
CCGAAACCTTCGACCCGAACCGGTGGCTGGGCCTTGAGGACCAGCGGGCCGAGAAGCTGAAGTACTTCCACCCGTTCTCC
CGAGGAACCAGACAGTGCATCGGACAGAAGTACGCCTCCGAATGCTCACCAGAGTAGAATGCAGCTGCTAACAAAGACAA
ACTAGCCTTTCTCTTATCGAACAGAAGATCACACTGTCGAGGCTTGTGCTCCGCTTCAGTCCGGTTGCCGTGTCTAAGCC
CTCTATCGAGTGGGGCGAACTCGGCACCAACGCCGTGCCCGACACTCCTTTGTATGCTCAGTTGAAGTGTAATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62