GenePrediction:GLEAN_1059 Details

Name: GLEAN_1059
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:332195..335414 (+ strand)
Length: 3220
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:332195..334361 (+ strand)
Length: 2167
Type: CDS
Source: GLEAN
Position: GCSC_173:334411..335414 (+ strand)
Length: 1004
>GLEAN_1059 class=GenePrediction position=GCSC_173:332195..335414 (+ strand)
ATGGTCGATGCAAATGTCGCAGTCATGGATGATAAGCAGACTTTGACAGAGACAGTCTCACCCAAAATACCCATCAGAGA
TGACGGAGAACCCAAGGCAGATACGACAAAGACAAGCGGCAAACGAAACTTTGAAATCGACTTCGACAATGGCAGCGAAA
GAGGTTACGAAGACGGCGGAGACGAAAACAGCCAAGGTGATGGAAACGACGACTTTGGAAGCGGTGGTGATGAGAAGGAT
TGGGATAAATATATCAAGTCTATCCCGATGGTTCATGGGTATAGAAAGGTGAACTTTGAAAAGTTCAAGAACTACTACGG
CGATTTTACAAGACATACCATCGATGCCCTTGTTGTCGGGCCAAATACGAGCCATGAGATTAGGGAGGAGACTATGCGTC
GAGGAATGTTTCGGACGGGAGAAAAAGCTTCCATCGAGTCTCCTGATGCGTGGATTCAACGTGTTCGCATTCATTCCAAG
GCAGTCCTTCTCCACCTTGAGAATGCAGCACGTGTTGGTGAAGATTGGGACAGGACATTCCCGAGGACTTTCTTCAGGCC
TTTCCGAGCTTTTATTTGCAGCCAACCACGGATGAGGCAAGCCCTCCTGGTCCTCGAAGAGAAATGGGGCGAAGCTGAAC
GTCTGGAGTTTCAGGGCCTAGCATCGGACTATACGAACGACTCGCCAAAAGAGAAAGGATATGCAAAAGAAAAGATGGAG
ACCGGGACGTCTGCAAGCAAGCCGATTCTAGACAGTCTCAAGGACGACAACTTTGCCGACGGGGATGAAGAAGAGTATAA
CGAGGTCAAATTCAGTGGTGACAGCATGGACAGTATTGACGCATTGAGACACATGCGCAGCTATGTCGACTTCGTCGACA
AGGAAATTCTTCCTCTGTATCACACGTTCGAAACGCCATCAAAAATAAAAGTCCGCTTCAACGATCTATGGTATCTGTTC
AGAGCCGGCGAGACCGTCTACTCGGCAGATACAGATGTCGTGAAGTCAAAGCGATCAGCATCCCGTTCGCCGACTTACCA
AACGATCTGGCGGGTGTATTCCACATATCTGGATCCTGTCTTGGACGGCAAACCAGACGATATTGGAAAAAGCAAACGTG
TGTTTGTGGTGAACTGCTACTATATTGACTTTGATGGTGAATCGTATGGGGCTGTGAAGCACTCGCTCAACATCAAGTAT
TTCGAGGGGGAGAGGGATATCGCACGGCTCAATATGATACCAATCCGATTTATGGAGGGCGCAGATGCATTTATCGACCG
GCTCAGAGAACAGGGACGCAGGTTTCAAAATTATATCAAGATACGACATCTCGCCTATCAGGGATGGAATCTGATCAGCA
CACCAACGGGAGAGGCCATCGGTGACAAGAGCCATCTTGAGCACATCGACAGCAATGTGATCGTCGACTTTGCGGAGGGC
TTTCAGCATTTCTCCTCCCACAAACCTGTCTTCAATGCGGTATCAGACGATGAAAGTGGATGGCGGCGGGGAGATGACGA
GCTTCCAATTTGTCACTGGACTGACGCCAGCCGAACAAAATCTGTGCTTGAAGTCGTCGAAGACATCCAGCTGTCCGAGG
GGATTGCGGACACAATACGACCGCTCAAGATGAAGAGCAAGATTGCCACTATTGGCGAGGATGATCTCATTCTGCTGCCC
CGACGTCTCGTGGCCTACGTGCTGCGGGAGCGGCGCTTTGCTATGTTGGATATTGACTCTTTCAGCCCCATCAAGCAGCA
GAAGAATATATTCTCCAGCCTGAAGATTAATCCCAAGCACAAGCGGCTGGTGAAGTCGCTCACTCGGGCCCATTTCATGA
AGCAGGAGGCCCTCAAGAGGGGCGCCAATCTGAGCATGAACCAGGACATTGTTAGGGGCAAGGGCCTTGGCTTAACTATC
CTTCTTCACGGCGTTCCCGGTGTGGGAAAGACAGCCACAGCTGAGGCGGTCGCGCAGACAAGCGGCAAACCTCTTTTTGT
CATCACATGTGGCGATCTTGGAATTACACCTACGGCGGTTGAAGAATCACTGAGCGGGATCTTCCGACTGGCTCATCTAT
GGGACTGCGTCTTGCTTCTGGACGAGGCTGACATTTTCCTTTCCAAGAGAGACACGTCGAATCTACAACGCAACGCTCTC
GTTTCCGGTGAGCAATCCGGAAGACTTTGGCGGAAACATTGCTGACAAAGCACTAGTCTTTTTACGTGTTCTCGAATACT
ACAGCGGCATACTATTCCTCACCACAAACAGGGTTGGCACGCTCGACGAGGCCTTTAAATCTCGAATCCATGTTAGCTTA
TACTATGAGCCACTCAAGCGACAGCAGACGCTGGCGATCTTCCAGGTCAACATCACCAAGCTCATCGAAATTGAAAACGA
AAGGCGTGGAACACTCCAGGAGATGGATCTGTCCGAGCCAGCGCTGACGATCCACAGCGAGAGCATTCTCGACTATGCGG
CTTGGTACTATGACAGCCACCCAAGTAATCGCTGGAATGGACGCCAAATCCGAAATGCGTTCCAAGTGGCCTCGTCGCTC
GCATCTTATGACATGCACAAGGCCGCTATCGAAGACGACGATGATGAAGACGATGAGGACGAGAACCCTGTTTACCGAGG
ACATAATCCGTTAGATCCCTATTCATCACCATCAATGCTAAGTTGGAAGCAATTCGACCTGGTCGCAGATACGATCCGTC
GTTTCAGCACCTACATGAATGAAACAACCAACGGAACTCCAGAGGATATCGCCAGAGTTGATGGCATCCGAGCTGACGAT
CCCAGCTACAAAAACAGCCTCAAGGCGCCAACATCGAAATATGTGCCGCCAGAGTTTCGTCAGCAGTCCAAGTCACCATC
AAGCATGTTGCATGGTGGCACAGGTGCTAGAAACAATGTTCCCTTCCACGGAAATTTGATCCCCCACACGCCATTCGATC
AGCGAGGCCTAGGACGCGGGAGAAGGGGAGGGTTCCAGCAGTTCCAGCAGGTGATAGACCCAAACACCTATCATGCAAGA
GGGTCATCTGGAAGTCCTGGGGTCACGGAAAACTCGCGCACAAGGGGATTTGAGAACCATTCTTATGAAGAGTCTGGCCA
GTACTTCGGAAGTGGTGGCGACTTCCAAGAGAGAACAAACAGTCGTTACGAAGGACATAGTTATGGGCATGATGCTGCAC
ATGAAGATGACTATGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62