GenePrediction:GLEAN_105 Details

Name: GLEAN_105
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:723692..725786 (+ strand)
Length: 2095
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:723692..724018 (+ strand)
Length: 327
Type: CDS
Source: GLEAN
Position: GCSC_179:724262..724713 (+ strand)
Length: 452
Type: CDS
Source: GLEAN
Position: GCSC_179:724779..725297 (+ strand)
Length: 519
Type: CDS
Source: GLEAN
Position: GCSC_179:725669..725786 (+ strand)
Length: 118
>GLEAN_105 class=GenePrediction position=GCSC_179:723692..725786 (+ strand)
ATGAGCGACAAGCCAGTTGAGACACCGGCTGCGGAGGTGAAGGCAGTTGAGGAGCCCACAGCTGCCCCGGTTTCTACGGA
GACTATCATCAAAGAGACGCCCGAGACGACTGTTGACGCCGCCACCGAAAGTGCAACGGAACCAGTCCCGGCCGTTGAGG
CAGCTCCGGCCGTTGTTGAGACAGCGCCGGCTGCTATCACTGAAGAGGAAAACTCTGTTGAGGTCACACCCGTGGAGGAA
GCAAAGCCTGTTGAAGCGACCAAAGCGGTCGAGGAGACCGAGCCTGCAGAAGCTACACCCGCAGAGGAGACAAAGGCCAC
AGAGGCCGTCCCGGAGGCGGAGGTCGCAGCGGCTGCCCCCACTGTCACTGAAATCCCCTCTGTGGCCGAGATCTCCGCTG
TCACTGAAGTCTCCGCCGTCGCCGAGATCTCCGCTGTCACTGAGGTCCCCGCCGTCGCTGAGGTCTCCGCTGCCACTGAA
GTCCCCGCTGCCACCGAGGTCTCCGCTGTTACTGAAGTCCCCGCTGCAACTGAAGTCCCCGCTACCGCTGAGGTCTCCGC
TGCAACTGAGGTCCCTGCTGTTGAGGTACCCGCTGCTGCGGCTGCCGGGGCCGAAGCCCCGACCCCGACCCCTGAAGAGC
CCAAAATCACGCCCATCCAGGCTCTGTGGGCTGCCGCCCAAGAAAACGGCCACCCTGAGATCTGGGGCGTCACCCTGGCC
GACCCCAGCGCCCATGTGCCCAGCCAGATCGTCTTCCAAAAGTACCTCAACGCCAACGACGGCAACTTTGACAAGGCCAA
GGACCAGCTGCTCAAGACGCTCGAGTGGCGGGCCAAGACCAAGCCGCTCGAGCTGCTGAAGCAGGAGTTTGATAGTGCCA
AGTTTACTAGCCTTGGCTATGTCACCAGCTACACGGCCGGCGAGACCTACGATTCCGCCGTGCCCGAGTCCAAGGAGGTC
TTCACTTGGAACGTCTACGGCAACGTCAGCAGCATGGACAAAACATTTGGCAACCTACAGGAGTGAGTCGATTGTGCTGC
CTCTTTGTTATGCGTCTCCCATGTTCCTACATAATCTGACAATCTAGGTTTATCAACTGGCGTGTCGCCCTGATGGAGCT
CGCTCTGCAGGAACTGTCGCTGTCCACCGCAACCAAGAACATCACGGCCGAATACGACCCCTACAAGATCTTCCAGGTCC
ACGACTACAAGTCCATCAGCTTCCTGCGCCAGTCCCCCCTTGTCAAAGCTGCCAGTACCGAGACCATCAAGGTCTTTGCC
ACGAGCTATCCCGAGCTGCTCAAGGAGAAGTTCTTCGTCAACGTACCCGCTATCATGGGTTTCGTTTACTCCTTCATGAA
GCTGTTCGTTGCTGCCAAGACCATCAAGAAGTTCCATCCGATGTCCAACGGCTCTGGCCTGGCGAACGAGTTGGGCAGCA
GCCAGATCAAGGACCTGGGCAAGCGTCTGCCCAATGAGTACGGCGGCAGCGCTGGTGAGCTCAAGACACTGGGCAAGGAG
ACGGCACTGAAAGCTGCTCCTGCTGCAGAAGAGCTAAAGACGGTAACCAAGATCGAAGCCAAGGCTCCAGCTGAGGCCAA
GGCCGAGTGAGTACAAATGGCTGGCCTATTTGTGGGCAAAATCAATCAGCCATAGCTGCAACATACGGTCGAAGACACGG
GTGTTGCACGTTGTTTCATTTTTTTGAGTCACTGTTTTGCTCAACTATATCCTTGCTGTTTCTTCGTTTTTGAGGCTAAA
TGCCTATAATACATAGAGAGATCCCCTGTGTTAAAAGTTGTCTGTGTCCCTTACGGAAGAGACGGCTATAATGAAGCACA
TTTTATACCCTTTAAACTTAAATCGAGTAACCTTGCTGCCATCAGATGGGGAAGCAAATGGGTTGTTTCATTTTTACGAG
GGTGCCCAGTCGGATTGTCTCTCCATTGGAACGACAACAATACTCCGTACTACGGAGTCAGGATAAGCTCAGCGGTGAGC
CAGGCGACGGCGTGGCGAGCGTGTTGCGCAGGCTGAAGTGGTGCAGGTTGCCGATGAAGCCGTTGGTCGCGGTGCTGCTA
GAGGCCAGCGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62