GenePrediction:GLEAN_1063 Details

Name: GLEAN_1063
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:351157..352765 (+ strand)
Length: 1609
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:351157..351181 (+ strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_173:351322..352418 (+ strand)
Length: 1097
Type: CDS
Source: GLEAN
Position: GCSC_173:352478..352765 (+ strand)
Length: 288
>GLEAN_1063 class=GenePrediction position=GCSC_173:351157..352765 (+ strand)
ATGTCCTATTATCAATCCTATGGCCGTGCGTCTGTCCCTGCAAACCCTGTTACGGTTCATCGCTCAGCCGGTTCCCGCTG
CCTCTCATTCCCCTCCTGCCAGCAACAGGAAGCAAGCCATTGCGACCTGATTCGTGCAATACTGACTCTCATTCGCGACC
TGCAGAAGCGCCTCCACCCCAAGGCGGTGGATACCAGCAAGGATACCAGCAACCGCCTCCGCAAGGCCAGCACTATCTCC
CACAGGGACAGCAGTATCCCCCACCGGGCCAGCAGTATCCCCCGCAAGGCCAGCAGTATCCTCCGCAACAAGGCCAGTAC
CCACCGCAACAGGGCGGATATCCTCAGCAGTACGGCGGAGGTTCTCCGCAGCAGCCCCCGTACGGCACCCCTCCTCCGGG
CCAATACCAGTATAACCAGCCGCCGGCACAGGGCTACGGACAGCCAGCTCCAGGCTATGGGCAGCCGGCGCCGGGATACG
GCCAGCCGCCAGCGCCGCCACAACAGGGCTTCGGCGGGCCCGGCTACGGGGCACCATACGGAGGTGGTGGGGGCGGATAC
GGGATGAATGTGCCGCCGACGCCGCCGTCGATGGGGTACGGGGCGCCGCAGATGATCGCGTGGAACGCAGATCCGGACGC
GCAAGCGCTGCGGCAGGCGATGAAGGGCTTCGGGACGGACGAGAAGGCGCTGACCCGGGTGCTGGCGACCAAGGATCCGC
TGCAGATCGAGGCGATCCGGGCGTCGTACCAGCGGCTGCACCGGCGCGATCTGGTGGCGGACATCAAGTCGGAGACGAGC
AGCTGGTTCGAGGCCGGGCTGGTGGCACTGGCACGCGGACCGCTGCTGCACGACGTGCACATGCTGCACGAGGCCATGTC
GGGCCCGGGCACGAAGGAGTCGGTGCTCAACGACGTGCTGCTGGGCCGGTCTAACGCGGACATGCAGGCGATCAAGGCGG
CGTACCGACACACCTTCCGGCACTCGCTCGAGGACATGCTCCGGGGCGACCTCAGCATGAAGACGGAGCGGCACTTTATG
ATCGTGCTACAGGCGACGCGGCAGGAGGATGCGGTGCCGGTCAGCCGGCCCGACGTTGACCGCGACGTGCAGGAGCTCTA
CAACGCCACCGAGGGCAAGATCGGCACCGACGAGATCCGTGTCTGCAGCATCCTGAGCACGCGCAACGACGATCACCTCC
GCGCCGTGGCCTACGCGTACCAGCAGCGGTATGCTCGCTCGCTGGAGGACGTCATCCGACGGGTAAGTTTCTGCTTTGTT
CTGGGCTTCTGCCTGTCTCGCTTACTAACCCTTTTCTTCAGGAATTCTCCGGCCACATGGAGAGTGCCTTGCTCTTCCAG
CTGCGCCACGCCACCGACAAGTACATGCACCAGGCATCGCTGCTCGAAGACGCCATGGCCGGCATGGGCACGCACGACCT
GCTGCTTGTCTCGCGCGTTGTGCGCTTTCACTGGGACCGCGCCAATTTGGCCAACGTGCGGGCGGCGTACGAGAAGCGCT
ACCGCCACAACCTGGCGTCGCGGATCAAGGGTGAGACGAGCGGGGACTACGAGAGGCTGATGCTGGCCTGCATTGGCGAC
CGGGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62