GenePrediction:GLEAN_1064 Details

Name: GLEAN_1064
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:353800..356394 (+ strand)
Length: 2595
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:353800..354639 (+ strand)
Length: 840
Type: CDS
Source: GLEAN
Position: GCSC_173:354691..355191 (+ strand)
Length: 501
Type: CDS
Source: GLEAN
Position: GCSC_173:355253..355363 (+ strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_173:355426..355875 (+ strand)
Length: 450
Type: CDS
Source: GLEAN
Position: GCSC_173:356020..356394 (+ strand)
Length: 375
>GLEAN_1064 class=GenePrediction position=GCSC_173:353800..356394 (+ strand)
ATGTCGGCACCAGGGCCTGGGCCCGATGCGCCTAGCCGGCCAAACACGCAGCTGCCACCACAGCCAGCAGAGTTGTCGGC
GCCAGTCTCAGGCACAACCGGCCAGCCATCTGGAGCAGAGACACCGGCCGCAAGACAACCTGTACCGAGTCAGTCTCGTC
CAGAAGCCGTTTCGGCTCAGATGCAGATGCGCCAGACTTCTGGACCACTACTTCCGCCTCACATGATGCACCACCCTTCA
CCCGCCGTGTCGCCACAGCTGCCGCCACAGTTACCGCCACAGCTGCCGCCACAGGTCCCGCCGCAGCTTCCGCCGCAGGT
CCCAACGCAGCTTCCGTCACAGCACCCAACACAGGTCCCGTCACAGCATCCGTCACAGGTTCCGTCACAGCTTCCATCAC
AATTTAGCCATCATCCATCTTACCAACAGACAGGTCAGCTCCCAGCCTACAATGAGCATCTGCAACACGCCCGCACTCAG
CCTGCACATCAGCCTGGATATATACCACCCCTCACTGAACTGGCCCATCTCGCTCAGCCATCCCAGCAGCAAATGGCCCA
ACAGTTTCACCAACCAGGAAACTCATCCAACGCAGTCACGCGCCCCCCCGACCCACGCTTGAACCACAAGCAATCAGTCA
TAGTCGGCCCGCCTGACAGCACACGATTATCCTTTCCGTCGCCTGGACGTGATCCGGCCCGCGCCAACCCCAAAGCTAAC
GAGGACTACTCACGCCTCAACTACGCCATTCAGCAGGGCCTGCCCGAGAGTGTTCGGCTTGCCGTTCGTGACAACTGGAA
GAAATGCCTCATTGGCAGTGAGTTTCAAGAAGCATTTGTGGTATGTAACTTCTTTACAGTACCGCCTCTCGCACAGCTAA
CAGTTTCACAGATGAACGCGACTGTCCGCCACATTGCACCGGCCTCTATCAAAAAGGCCTTTCGCGACTTCGGCCGGGAC
ATCATCAACGTGGGCAAGGAGGAGCTCATCGGCCATCTGACAACGTCAGACATTGACCAGCTGACGGAGGCTATCCTCTC
GAAAGCTAGCGGCCGCTTTCTCGATGCGGCCCTGGATCTGCGTCTTCGCACCATCGAGGCCAAGCCGCTTATCAATGCGC
TAGCTCGAGCTGAGCGTCTGGGGTACGAGCCCGGCGACATCGTGGAGGAGGCGCCGACAAACGGCCAGGAACGCGTGATA
CCTCAGCACCAGGCGGCTTTTCCCCCGCAGGCTAAGGCTCTTCCGTCCCGGAGCCAGGTGGCATCTCCTGCCATCCCGCC
AGCTGCTCCCAAATTGCAGGCTCAACCGGTTCAGCAGGCCCAATCAGCTCAGGCCAAGTGGCAGTGCCATCTTTGCAATC
GGTTGTTCGAATACGAAGAGCCGTTCCTCTTTGTATGTGTAAACCCACTTGCCATTGCCGTTTTCCTTTGCTGACGTACT
GAACTGAACACAGCATATGCGGAAGGATATCTGCAAACGAGTGCCCCCCAAAGCGCATATCGGATTCAAGTGTGTTTGTG
AATTCTGTGGACAGGGCTTCAGCACGACGCTGGGACAGCAATATGTAAGGATATGTTACAGACCGAAGTAATCAAAGGAC
ACTGCTGACCTAGCTTTCTTTTCCAGCACAAAATGAACAAAGTCTGCGGCGACTTTATCGTGGCGCCAGGAACGCCAGGA
GCACCCAGGACACCGGGAACGCCAAATACAAAAAAGCAGGCTGCAACACCAACAACTGGGGGTGGCGGGTCCTCGTTACT
GGCACCGACCTCGCATGGTGCCAATGCAACGCCCACCCGGCCTCTGGACTCGTCTCAGCCGCAGCAGCAGACGCGTTATT
CGTCGCCACCTTCGGCGAGTCAGTCGCGGGTGAGCGCAGGATCGGATCCATATGCCCACCTCAGCCCAATTCTGAAGGCG
GCCCTGGACGAGGAGCTAAGGCAAGCCGAGGAGAGCTACGGCGAGAAGATGCGCGAGGCCGAGGCGATTGACGGCGAAAT
GAAGCGTCGCGCCCGGCTGGAGGGCTTGAAGAACTCGTTTGGCACCAAGCAGTCTGGGATCCGCAAGAAGTACGGCGTGC
GGCTGCGAGAGAGACGCACACGGGCAGAGATAGAAGCAGAACGGACGCGGATGCTGATTGGAGCCGGGGCGATCACCAGC
AGCAGCAGCAGCAGCAGCAAGGGCCTGCTGGCTGACGGCCAGATGATGCCACCGACGCAGGGAAGCAGTGTCCCGAGCCA
GAGCCAGAACGTGCCGGATAGCAGCCGGAATCACGAAGTGAAGCGCTCGCGGCTGATGGGACCGTTTGGGTTAGATGGCG
GGTCTAGCGGCCACAGAGCGACGCTGTATGACAGCGACGAGATGACAGACCGGACGCGCAAGTCGCCGTCGCTGCCCAAC
ATGTACACACCGTCCAAGATGAATGGTGCCGGGGCTGCCAGCATGGCCTCGGCTGCCCTGGCGCTGCAGAAGACGCCGGC
GTCGGCGATGCACGTCAGCACAACGTTTCCGGTGGCGCTGTCGGACTCGTCATCGGACAATGAGGATATTCCGGCGCGGC
TTCCTGCAGCGGTACGTCAGAGTCTCGACCACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62