GenePrediction:GLEAN_1065 Details

Name: GLEAN_1065
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:359097..361207 (+ strand)
Length: 2111
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:359097..359156 (+ strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_173:359225..360163 (+ strand)
Length: 939
Type: CDS
Source: GLEAN
Position: GCSC_173:360221..361207 (+ strand)
Length: 987
>GLEAN_1065 class=GenePrediction position=GCSC_173:359097..361207 (+ strand)
ATGGTGGGCGTGCCTGGTCGTTCCAAGGGCTGCAACACGTGCATCCAGCGAAAGGTCAAGGTGGGTGGTATTGTCTGGCC
TGTCGGTCCGTCCTGTCCGAACCGGCCACCTGCTGACACGACACCCAGTGTGATGGCGGCCAGCCCACGTGTGGCAACTG
CCGCAAGTCGAATCGGCTGTGCACCGGCTACAAGCGGCCGGTAGCCTTTGTCATGTCGGCTGACGTGGCCCTGACCGAGC
CTATGGCCGCCGACGAGCCCGAGGGCATGAGCGTGACCACGCAGGGTCGCTGGCGTCGACGGCCGCGCAAGCTGCCCGAA
GCGCTGCCGGCAGACCGTCGGCCACGGGGGAAGGCGGCAAAAAAGGACAAGACCGCAAGCAAAAACGGCCTCGAAGTCGA
TCTGGACACGACCGTCTCGCCAGCCGAGCTAAAGCGCTATAAAAAGGCCTTTGGGTCGGCCGGAATCCCGGACGAGGATG
AGCACGTTTCCTGGACCTCGGTCGTCGGCAAGACCCAGACCACAACCACAGCCATGACCATGGTCACATCCTCATCCCCG
TGGACGGCTGTCCTGTCGGGCGATGCCGCCTGGCGTGAGCAGCTCTTCCCCGTCTTTTTGGATTTGCACCTCCCGGATGA
GCTGCTTCAGGGCTGTGCCCGCGGCCGCGGCCAGCGCCCCCGCAACTGGCTGATGCACCTTCCGCACACCGCTCTTGACG
GCTCGCCCGCCCTCGAGACTGCCATGGCCGCTCTCTGCATGGCGCGCGTCGGCCGCCAGAGCGGTTCCGCCGGGCTCAGC
CTCGTCCGCCACAGCCTCGACCTCTACACCCGCGGACTCGGCCAGCTGCAGCGCGCCGTCCAGGATCCCCGCACGCGGCG
TAGCGACCAGACCCTCGCTGCCTGCCTCACCCTGTCCATGTACGAGCTGGCCGAGTGTCCGACTGGCCGCTCCGACGGCT
ACCTCGCCCATCAGGACGGCAGCCTCGCCCTCCTCCAGATGCGTGGCCCCGACGCCCATGCTTCCCCCCTCGCACATTCC
CTCTTTAACTTTCTGCGCATCCAGAACGTGCGTCTGTTTTTTTTTCTGTTTTTTTTCTTGCCTTCATCCATGCTGACTAA
GCAGTTCATCTACGCCATCATGAACCGCCAGAGCAACTTCTTCTCCACGCCGGCCTGGTTGCAGCGCCCCTGGAAGGACC
TTGCCAAGGACCCTCATGACCGCTTCATGGACCAGATGTACGCCATTCCCGTCCTCATGGAGCAGTCCGATGCCCTGGCC
GCCTCCGATGCTGTCCCCGATCGCCTCGCCGCCGGCTACAGCACCATCATCGCCCGCTACGTCGACATCGACACCTGCCT
CCAGAAGTGGCAGCGTGACTTGAAGTTGATCGTGTCCGGACCGCTTTACTGGCCTGAGCTGTCTGCCATCCGCTGCCCCG
TCTTTGACGACAGCCCCGACGGCCATGCCAGCGCCCGCGGCCGTCCCTTTCCCGTCGCCTTCCATTTTCCCGCCTTCTTC
ATCGGCCAGTCCGTCATCCTCTACTGGCTCATCGTCCTCTTCGTCAACGTCCAGATGGACCACCTCTACCGCCGTATCGC
CGTGCTCGAGGACGCTGCCGCCGCCGTTCCCGTCCCTGTGCCGTGGGACTGCTGGACTCTATCGCCCACCTTCTCCAACC
TGCCCGAGTTGGACCTCGAGCCATTGTCACCATCGACAGCACCGCCCGTATCATCGCCAGCATCCACTCTGTCCACCTCT
GCCACACCTCCATCAACGTCCCCGCCCTCCTCCGCACCACCGCCGTCCGTCTCGCCGCTTGCTGCCGCCGATTCCGCTGC
GAGCATTGCACGCACTATGACTAGCAATATCTGCCAGTCAATCGAATACTTCTTGCAGGATAGCATGGGCGATATCGGCT
CCGTATCCACACTTCTGCCTCTGACCGCCGTGCGCTACCATTTGTCTCGCACTCATTCTACTCGGCCCTGTCCGCCTGGC
CCCCCTGAACATCCCGGCGAGTACTCTGATGAAGTCGTTTGGGTCGATTTCCTAATTCAATTCGTCGGTGGCAAGGGCCA
TCGTATGGCTTTCTATATCACAGCTGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62