GenePrediction:GLEAN_1066 Details

Name: GLEAN_1066
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:365928..369290 (+ strand)
Length: 3363
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:365928..366107 (+ strand)
Length: 180
Type: CDS
Source: GLEAN
Position: GCSC_173:366162..367447 (+ strand)
Length: 1286
Type: CDS
Source: GLEAN
Position: GCSC_173:367508..369290 (+ strand)
Length: 1783
>GLEAN_1066 class=GenePrediction position=GCSC_173:365928..369290 (+ strand)
ATGAATGCATCCGACATCTTCAACCAGGGTTTCATGGCCATACCCCGACCACCGCCAACCTTCTTCCAGCCGCCGTCAAG
AAGGCCCGGGGCTGCACCACGCCGGGATAACGACAACAGCGGCGACGGCCCTTCAAACCGCATCGCGCACACCCTGACGG
CCTGTTGTCGCTGTCGACAGGTAAGAAACAACGAGACGGCCGCTCCTTGTTTTCTGGGCTGACTCTGCTGGCAGCGGAAA
ACACGATGCGACCCTACACTACCGAAATGTCTGCCCTGTGAGCGTTCCGGCTCCATCTGCGAATACTACGACAGCACCAA
AGGCTGCAAGATCAGCCGTTCCTACGTTGTCAGCTTGCAGAAGAAGGTGCGCCAGCTCGAGGCCGAGCTTGCCCAGTACA
CCGAGGAGGACCTGCCCCAGGACACCGAGGATATGATCCGTCCCGGCGGCCTCGTCAGGCTGAGCGACAGCGACGAGACG
CCTCGCTATCTGGGTCCCAGCAGCGGCATCGCCATGACCCGGTTGCTGATGGAGCAGGCCAAGCGCTACACCGAGTGGCA
GTGTATCTCAGAGCTCATTCCCAAGCTTCAGGCGCGCCGCAGAGAACGGCTGGATCGCATGCACAGCATCGCCGGCATGA
ATGGCGGTCCCGACGTCGGCGGCAGTGGCATCCGCAAGAAGAGCTATCCCATGATCAGCGCCCACCCGGCACCAGGCCTT
CCCACGCGACCCATGGCCGAGATGTTGTTCAAGCTCTTCAACTTAAGAGTTCAGGTGCTGACGCCTTCCCTGCACGACCG
CATCTTTGCCGCCGACGTGGAAGACGTCTTTAGCGGGACCAACGATCCTTACCAAAACTTTGTCGTCCGCATGGTTGTCG
CCATCAGCCTCCAAAAAATGGACACGCAGTATGCTGGCTTGGCAGACAGCTACTACCTGGCCGCCATGGAGCACTTTGAA
GATGTCATCCGCCCCAAGGACCTGCGCACCCTGCAGTGCTTGTCGCTGATCAGCCAGTATTCCTTGCTGACGCCGACGCG
CACAAACGTCTACCACATTGTCGGCATCGCTACGCGTATCTGCCACCAGTTGGGCATAGCCGATGCCGAAAGCATCGGCC
GCAGTGGTGGCGCCTACGGAATGGACCCTCAGACTCTGGACATGCGGCGGCGAGTCACCTGGGCTATCGCCATGATGGAG
CTGGGGCTGGCTGAGACGATGGGACGGCCGAATGGCTTCGCCAAGGGCAACGATCGGCTTGACATTGGCTTCTTCGCCGA
TGTGGACGACGAGTACATTACCGAAGCCGGCATCCAGCCAGGGCCACCGTCCCCGAAGAAGCGAGTTGCCATCCATTTTT
GCAAGATGCACCTGCATCAAGCCGAAATCCGCCGTACTCTCTACGAAAAGAAGCGCGCCGAGCCACGCAGTGAGAGCCAT
CCTTGGTTCGCACAGATGGAGAAGTCGATCCGCGACTGGTGCGACTCCTGCCCCGAGGAGCCGGCTTGGTGCAAGCCATG
GTGTGTCTTCTGTGCCTCCATGTCATTCATGCTCTTGCAAGTGTACTCACGCAATCATAGGTTTACCGGCCGTTACCACG
CCATGATTATCTTGCTGTTTCGCCCATCGCCCCAGGTGTCGAAGCCGTCTCCAGCCTCGGCACTCAAATGCTTCCAGTCT
GCTGCTTATGTCATCAACCTCGGCAGCGAACAGGTCAAGAGGCGTGCCATCGACATCACGTGGATCTTCCTTCTTACCAT
CTACACCTCCATCAACGCCGTTCTTTGGTCTGTTTCCTACCCGGAGGTTCGCCAGGCACACCCGCGTGAGGAAATTGAAG
AGTTGGTGAACACGTCCCTGAACATTATCGACCAGTGCTCTGAGCGATGGCCCGGAGCATCGGCTGCATCGCAGCTCTAC
ACCATCTTTTCCAAAGCCTGCCTGCAGAGCTATGATTCCATCGATGAAGACGAGGGCCCTTCAGGATCCGCATCCCCATC
TGCTCCCTCATTCAACACTGCACACCGCATGTTTCAAGACGGCACCATTCCATCGCCCTCGTCACAGTATGACCCCAACT
CGCCAGCTGTTTCAGAGGTATCGTCCATGCCCACGACGATGTCCCACAACTCCAGCCAGCAGCATCATATACAGCAACAC
CAGCAGCAGCAGCAGCAGCAGCAACATCAGCAGCAGCAGCAGCAGCAACACCAGCAACAGCAACACCAGCAACAGCAACG
GCAACCGCCGCCGATATTTCACACCCCGCAGTTCGGAGATGCAGCCCCCAAAGCTGAGCCAGAGACTGTCAGCGCAGAAG
AGTTCCAATTTGGCGAGCCCTTCGCTCCCAGCCAACCGCAATTCCGCTCTGGGTCCATCTTCCTTAATCCCCCATCCGCG
GAACCCTTAGGACGCCGCTTCTCGTACTTTCCCCCAGAAGCCCCCCCGGCAATGGGGAACGGTCCCGACAGAGAATTAGC
CTCGGCCCCTCATGTCTTGCCTAGCCAGCCAAGCAGCATGTTGTCCATGTCTCCGTTAGTACCGTCAACCCCTGACACGC
TGGTGCCGATGTCAGCCCCCAGCACCATAGGAGCCATGTCGCCCGTGACAGCTCTGACCAGCTTGTCGTCTCCGGCACCG
ACGCCCAACACGCGACACATCAGTCCTGGGCCTGTCGGCATGGGAGTTAGTTCAGGGCCTATGCACCAGGCCATCAGCTA
TGAACCCCCCGAAACACCACAGTCTCAGCTGGCGCAGGCAACTCAGAGACAGACGATCCCACAGCAAGACAACATGCCAC
AGCAGCAGCAGCAGCAGCAGTCACAGAGGACGGCCTACGCGATGCCCTATCAGACACAGACGCACCCTGCGCACAGCGCA
CCTCTTTCGGCCGACCCTCATCAGCAGCATCCGCTACCGACGTCGGGCATGGGCTGGTATTCGCCGCATCCGCCGTTCAT
GTCGTCGTACACATTTGGCGGCATGGGTGGTGGCGCGACGTACCTGTCGGATCCGTCGGCCGCCATCTCCGGCTATGGCC
TGGGCGGTTTCGGCGGCATGACGACGATTGGAGGGCTCACGGGAATTCCTGGCAGCCAGGGGATAATGGACGGACACTTG
GTCCTGGGCAATGGTGGCCCCGGAAACGGCGTTCCGGACTCGCTGCTGCACAACCCGTTCGAGATGGCCGTGGCTAACAG
CAGCCAGCCGAACCCGGACCGGCAGGGAAGCCTGTCGCAGGAGCAGCAGATGGAGCTCATGGACGTGTTGGAGACGGAAG
GCATGGGGGAGATCAACTCGTTCCTCAGCATGAACATGAACCTGGACAGCGCAACGGCGCACAACAACGGCATACACTGG
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62