GenePrediction:GLEAN_1069 Details

Name: GLEAN_1069
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:383534..385337 (+ strand)
Length: 1804
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:383534..383836 (+ strand)
Length: 303
Type: CDS
Source: GLEAN
Position: GCSC_173:383901..383931 (+ strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_173:383983..385095 (+ strand)
Length: 1113
Type: CDS
Source: GLEAN
Position: GCSC_173:385156..385337 (+ strand)
Length: 182
>GLEAN_1069 class=GenePrediction position=GCSC_173:383534..385337 (+ strand)
ATGGCTCTTCGAGACGTTTTCGACAGCAGCGATGGTAAAGAGACGCCGAACTTGGATGAGGAGATGGGCGGACTGGCCGC
AGTCGGAGCGGAGGGCGAGACTGAAATGAGCAGGCGGAAAGAGCAGCTAGCAGTTGTGGACGATGTCCAGCAAGAACAGC
AACAGCAGCAGGTCCCGAGATCGGTTCTGCGACGGTCTCTAGGCGTCGTGGGCCGAGTGCTGCTCTGGATGCCGCCGTCG
TGTCGATACGACCCGGTTAAGCCGCCCGAGTTCACCATGGGGCTAAACATGCTCTTCTCGTTTGTGCGTTGTCTAGTCCT
TTCAGCCTCTGGGCTCTGGCTCGTTTGGACTCTCTGACCGGATGCAGGCCACGACAGCAACTGTCGGCAATCTCTACTGT
GCGTGCCAGTCTTTTTTATTTTTCCTTGTGCCCACCACTGACCTCCCAGACAACCAGCCGATCTTGTACCAGATTGCCGA
CACGTTTGACGTCTCGTACGAGCGGTCGTCGATCATCGCGACGCTGATGCAGGCCGGCTACGCGACAGGCATCGTGCTGC
TCTGCCCGATCGGCGACGTGCTGCCGCGCCGGCCGATGATCCTGGCGCTGGTGGCGCTGACGGCGCTGCTCTGGCTGGGC
CTCTGCCTAACCGACTCCTTTGCCGTCTTTTCCGGGCTCTCGTACATCTGCGGCTTCACCACCGTGACGCCGCAGCTGAT
GCTGCCGCTGGTCGGCGACCTGGCACCGCCGCACCGCCGGGCAGCCGCGCTCGCCATCGTGGTCTCGGGCCTGTCGTTGG
GCATGCTGGTGGCGCGCGTCGTTGCTGGTCTCGTGGCCAACTACACATCCTGGCGCAACGTGTATTGGTTCAGCTTCGGC
GCCCAGGCCGTCGTGCTGGCCTCGCTCTTCTGCTTCATGCCCGACTACCCGACCAAGAACAGTTTGGCCGAGGAGGCGGC
AGCAGGAGACGAATCCGCAGGACGGGGCCGTAGCAGAACTGCCCTCCACCAGATCCTTCGCCTCTGCCGCGTCCTCTACG
GCGGCATCGTCATGCTGCTCGTCCGCCAGCCGACTCTCGTGCAGGCCTGCCTCATTGTCTACTGCCTCAGCGCCGTCTTC
ACCAGCTACTGGACCACGCTGTCGTTCCTGCTGGCCTCGCCGCCCTACAACTATCCGTCCTTTGCGATCGGCCTCTTCGG
CCTCATCGGTATCGTCATCATCTGCTTCGGCCCCTTTTACGGTCGCTTTGTCATCGACCGCATCGTTCCCACCGTCGCCG
TCCTCCTCGGTAACGCGCTCGAGATTACCGGCGTCGCCATCGGCGTCGGCATCGGCACCTTTTCTGTCGCTGGCCCTGTC
ATCCAGGCCATCTTCATCGACTTTGGTAATCAGTGCTCCAACATCGCCCTGCGCACCTCCATCTATGGACTCGCTCCCAA
GGCCCAGAACCGCATCAATGCCGCCTACATGATTGCCTCCTTCACCGGCCAGCTGAGTGGCTCGGCCGCCGGAAATCGGC
TCTATGCCCAGGGCGGATGGCGCTACAGCGGTGCCCTGAGTCGTAAGTGTCGACTGGCCGACCTTGTCTATCATCACTGC
CATCTACTGACACCCTGCATAGTCGGCTTTCTTGGCTTTGCCACGCTCATCTGTCTGGCCAGAGGTCCCCGCGAGACCGG
CTGGGTCGGCTGGCATGGCGGCTGGTCTATCCGCAAAGACTCCAAGCCAACAAAGCCGGTCTCGGCAGAATCTTCGGGCG
AAGAAGGAGTGGTTTCTGACGCTGTTCAAGAGAAGGTGGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62