GenePrediction:GLEAN_106 Details

Name: GLEAN_106
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:727548..728595 (+ strand)
Length: 1048
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:727548..727574 (+ strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_179:727745..727816 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_179:727931..728236 (+ strand)
Length: 306
Type: CDS
Source: GLEAN
Position: GCSC_179:728319..728397 (+ strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_179:728468..728595 (+ strand)
Length: 128
>GLEAN_106 class=GenePrediction position=GCSC_179:727548..728595 (+ strand)
ATGGCGACCAACAAGCAAGGCAAAATGGTACGGACCTCGCTATCCCTCCTGCTCCTCATGACTCGGCTGATGCTAACATA
TATGCTATTGGTTGTTGACAGGCCGGTTACGTACGTGCACCCCCCCTTGCGGCCACCTTCGTCACGATGTCCTCCCGCGT
TGTCCGGCTCCGATATAGAAGCTGACCAGCTCTGCAGATCAACTACCGGATGAGAGTAACCCTCAACGACGGCCGGCAGA
TGACGGGTCAGATGCTGGCTTTCGACAAGGTAAGCCGCACTATGCTGTGGTTTGTTTGACGGGGCCCGGTGCATCAACGA
CGCGCTGTTCTGCCCGATGGCCCCCTTGAATGTACAAGAGCTAATGGCTAACGCCCATCCTAGCATATGAATCTTGTGCT
CGCCGACACGGAAGAGTTCCGCCGCATTCGTCGGAGACAGGCCAAGCCGGCCGCTGCCAGCGGTACCGCCTCGACGACAC
AGACCATTGAACAGGAGGAGAAGCGCACCCTCGGCCTAACTATTGTCCGCGGCGCGCAGATCGTGTCGCTCTCTGTCGAG
TCGCCGCCGCCGGCAGACCCAAGCGCACGCCTGGGCAAGGCGCCGACTGGTGGTGTGGCTTCGGGTCTGACTGCAGGTCC
AGGTGTCGCGCGTCCGGCTGGTCGGGGCGCCGTACCCATCTCGCTGGCGGTAGGTTTCCTCGTGCTCGAAGCTTGAATTG
CACATTCCTCTCTCACTTACCGACACTCGAAAACAAGGCTGACATTTATAGGGTCCCGCTCCTGGCGTTGGTGTTCCTGG
CCAGTCTTTCCCGCCTGGTTTCCCTGGCGCACCCGGTTTCGGCCGTGGTGGTGAGTTTTCTCCCCGACTGCCTGCACACT
GGTTATTTGTGGCATTCGCTAACAAGGCGTGTTTGTGCAGCTCCTCCTGGATTTGCCCCTGGAGGCTTCCCCCCCGCAGG
CTTCCCCGGCGCTCCTGGCTTCGCACCCCCCGGTTTCCCCTCTGGCGGTGCTCCGCCCCCGGGATTCAACCCTCCCCAAC
GGCGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62