GenePrediction:GLEAN_1070 Details

Name: GLEAN_1070
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:386157..387941 (+ strand)
Length: 1785
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:386157..386185 (+ strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_173:386242..386353 (+ strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_173:386415..386652 (+ strand)
Length: 238
Type: CDS
Source: GLEAN
Position: GCSC_173:386715..387620 (+ strand)
Length: 906
Type: CDS
Source: GLEAN
Position: GCSC_173:387685..387941 (+ strand)
Length: 257
>GLEAN_1070 class=GenePrediction position=GCSC_173:386157..387941 (+ strand)
ATGGCAATTTCTAAGCGAGTCTACAACTGGTATGAGCTTGTTCCTGTATCCCAAAGACCATGTCTGACCTTTCTGACGGT
CTCAGGTGCATTTCCATGGTGGCGGCAGGATGTATGGTCCTCTACGGCTACGATGCCTCTGTGTTCAACTCGGTGCAAGG
CTCGAAGAACTGGTTGAACTGGTTTGATCTCGACCCGGTATGTGGATCATGGAGATGCGGAAGCTCTCTGTCTCTCAGTC
CCCTCTCTGACAGAACAGAAACGAGACTCGTACCTGATCGGCCTTATCAACACGGCCTACACAATCGGGGCCATTGTTGC
CGGCTTCTTCTTTGGTGGGCCCATTGCTGACTATCTCGGCCGTCGTTGGGGCATGGGCATCGGTTGCTTCCTGACCATCA
TCGCCACGTTCATGCAAACGTTTGCGCCACACCACAATCTCGGATGCTTTATTGGCGGACGTGTCATTATTGGCCTAGGC
CAGGGACTGGCTTTGAGTGGGTTTGCCCTTTCTCGACTAGCTTTTTCCTCTCTTTTTTTCCTCCTTCTGACCGTCCAGCT
GCTGGCCCCGTTTATATTGGCGAGATGGCACCGCCCGAGATCCGGGGCCTGATCATGGCCTTCTGGCAGCTCTTCTACTC
GGTCGGCTCCTTTATCGCGTACTGGATCAACTACGCCTGCTCGCTGCACCGGGCCCGGTTGGGCGAGTGGGACTGGAAGA
TGGTCGTGATCTTCCAGATGCTCGTGCCGGCCATCATCATCGCCCTGCTGCCCTGGCAGCCCGAGTCGCCGCGCTGGCAC
ATCCAGAAGAACAACGACGTCGAGGGCGCGAGGGCGGCGCTGCGCCGCATCCGCGAGTCGGATGCCCAGGTCGAGGATGA
GATCCTGGTGATCCGCGAGGCCATCGAGTACGAGCGCGAGGCCATCGCGCACAGCTACGCAGCTCTGTTCCGGGATCCGT
CTGTGCGCCGGCGGCTCTACTTCGCCTTCATGCTCAACGTCGGCCAGCAGCTCACTGGTCAGGGCACGCTCAACAGCTAC
AGCACGGCCATCTACAAGAAGGTCTGGACCTCGACCACCACGATCAACCTGATCAACGCCCTCAACGCCACCTTTGGCAT
CCTCTTCACGCTAAACGCCACCTGGACGGCCGACCGCTTCGGCCGCCGCTGGCTCTTCATCGTCGGTGCCGTCGGCATGG
GCTTGTGCATGCTCTGCGTCTCTGTCGTCGGCCTCGCTACGCCCACTACCAACGGGACCAAGTCTCAGCCGGTCGGCATC
GCCATCGTATTCCTCCTCTTCCTCTTCATCTTCTTCTACAAGCCCTCCTGGGGCGCCACCACCTGGATCTGGACCTCCGA
GGTCTTCTCCATGAACGTCCGCGCCCAGGCTGTTGGCATGTGCTCCCAGATGCAAAATGTCGCCAACACCATCTTCCAGC
AGTTCTTCCCTACCTTCCTCAACCGTGAGAGCCCCTGGTCTTCCTATTCTTCCTCTGCTATCTACTGCTCAAACACTGAC
AATCACAGACTCTGGTCTCAAGTGCCTCTTTTTCTTCATGTCCGTCAACTTCTGTCTTGCCATTCTCGTTTATTTCCTCA
TCCCCGAGACCAAGAAGGTGCCCTTGGAAGAGATCGACGTTCTTTTTGGCGGTGCCAATCACGTTGACAAGGGTGCCGAC
ATGCTCGGTGTCCCCGAATCAAAGAGAAGTGCTAGGCATAATGATAATAGGGGTGGTGCGAGCAAATCAGAATACCAGGA
GCGAAGTGTAGAACAGGCTGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62