GenePrediction:GLEAN_1071 Details

Name: GLEAN_1071
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:388754..390941 (+ strand)
Length: 2188
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:388754..389840 (+ strand)
Length: 1087
Type: CDS
Source: GLEAN
Position: GCSC_173:389921..390190 (+ strand)
Length: 270
Type: CDS
Source: GLEAN
Position: GCSC_173:390262..390941 (+ strand)
Length: 680
>GLEAN_1071 class=GenePrediction position=GCSC_173:388754..390941 (+ strand)
ATGGAAGCTAAACTAAGTGGTAGGAAGCGCAAATGGCTTCGCGAGAAGCTGCACAAAGGAAGGGGCAAGAATGGCTACGA
CCGAGACGTTTCTTCCAGCCGGAATGCTTCTAAGGTTTCGGTGATAGTCGACGTCCAAAGCGCCCCAGAAGCCTCTTCGA
AACAAGACACCGAGCCTCCCTCGACGCTGTTCAAGACCACGGATGAACATATGGACCAACCGACTGTCACTGATATTTCC
AGCGAGCTATGGACACGGGCATACGACAGATTGAAGTCAGGCGAGGAAACCGCTACGCTGGTCGAGGCATACGAAGGCGT
GCTGTTTGGGATTATCCGAAATGACACGGATCTTGATGACAGTGAAGAAGGCAAGGAGAAAGACAGCGTGAGCATCAGCA
CCACAACACCGAACGACGCAGAAAAGATCAACAATCCGCTCCAAACTAGCGGCGGCTCCGGCCGCATCGATATTATGGAA
CAAGCCACCAGAGTCGCGCTTGCACGTGCGAAGAAGCACAAGTCTGTTCACGAAGCGGTCAAGGACACAGCTGAATTTAT
TAAAGAAATTGAGAGCACGGTGTCGAGTATGCTCACGGCCTACCCGCCGGCTGCCATGGCATGGTCTGGCATCTGTATGA
TCCTGCCTATCCTTGCCAGTCCCTCAGTGCAGCGGCTGGAGATGTGTGTCGGGCTCGAACACGTTATGGACAAGCTGGAG
TGGTATATGGCACTTGCGCGAGTGGCGTTCCGCAGCAACTGGAATGCAGACCCAGCCTCAGCCCAGATGCTGGAGCTGAC
CAAAAACAAGGTCGTAGAGCTGTACGCAGCCCTACTGGAGTACGAGATGCAGTGCGTGTGCGAGTGTTTCAAAACGAGCC
GCTTCGTCAGGAGCATGCGCGTGTTGCTCACCATCGACGACTGGAAGGAGCGAATTCAGACGGTCAAAGACAAAGAAACC
GAAATCAAAGACCAGCTGAAGCAGCACAAAATGGTCCAGAACACCGACACACTCGACCACATCAGCAAAGACACGTCCAA
GTACGATGCGTGGCTGAATAGTGTTCCAGACCGCATCGAGGGCACGTGTGAGTGGTTTGTACACCATATCCACTTCCGCC
ATTGGCTCGAATCCTGCCAGAGCAGTTTGCTTCTGGTTGAACTGCAGACGCCGGCTGTGGCAAGTCGGTCCTTTCGCGCT
ACCTCGTGAAGACGGTGTTGCCTGACCGCTTACTTGAGAGCGGCGACAATGCCGTGATCGCATACTTTTTCTTCAGCGAA
GGCGCAGAGACCAGTCTTGCGCGCGCTTTGTGCGCCATCGTCCACCAGCTGCTCTGCAGCTGCGAAAAACTTGTTGATCT
AGTGGAGGGAGACATCTCGAAAGCTGGCGAGGCTCTGATTGGAAACTGGTCCCGGCTCTGGGACATTTTCCAGAAGTGTG
TGGCCTCAGAAACAGCTAACCGGACGTGATCTGTGTCATTGACGCACTCGATGAATGCGAACCGTCAGATGTACGAACCT
TGATCGGCAACTTTCAGACATTGGTGGAGTCCCTTTCGACGAACAAGAAGGGCTCCCTGAAAGTCGTCATGACTACCCGC
GGCTACCCTGGAATTGTCGAAAGGTTTCGGTTTCGGCAGGATTCTAGTAGCATCCGGCTCGCAGGCGAGAACAGCGAGGA
GATTGCTCAGATCCAAGACGAGATTGCCATCGTCATAAATCACAAGCTAGACAAGCTGGCCGAAGCAAAAAATCTAAAAA
CAGAGCGGGTAAATAAGCTGCGCAGCCTTCTTGCCAATCAAGGCGGCAATCAGAGGACGTACCTTTGGGTGCACCTCATC
TTTGCCGTTTTGGAAAATAACAACCGCAACGTGGAAACTGAGTGGGCACGGCGAATCAACACTCTTCCCGACACTGTCAA
TGAAGCCTACGAGAAGCTGCTTGGTGCCATTCCGGATGACGATCGCGCCAGAGTCAGAAATCTTTTACATCTCATGTTTG
TTGCGTATATACCGCTTACTCTCGTCGATGCCGCAGTCCTTATGAATGCTCGGGAAACATATGAAGCGTCTACGGATAAT
CCTGAGCAAGAAATCGGCGTGCTTGAGGTCGAATCTGCGGACAGCTTCTGCGGATGGGTCTTGTCGACATGCCACTGCTT
CGTCACAGTGTACGGGAATACGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62