GenePrediction:GLEAN_1073 Details

Name: GLEAN_1073
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:402406..403210 (+ strand)
Length: 805
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:402406..402515 (+ strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_173:402592..403210 (+ strand)
Length: 619
>GLEAN_1073 class=GenePrediction position=GCSC_173:402406..403210 (+ strand)
ATGGCGACTGTAGCGAAAAAGGACAGATACTCGGTTATCCTGCCAACGTTCAACGAGCGGCAGAACCTGCCGATCATCAC
CTGGCTGCTGAACCGGATGTTCACCGAGAGGTAGGTGGGGAGAGGGGCGAATGGGGCGGAGACAGGAACAAGGACAATAC
GCCGTACGCGCTGCTAACCCGCACAGCAAGCTGGACTGGGAGCTCATCATCGTCGACGACGGCTCGCCCGACGGCACGGA
GGAGGTGGCCAAGCAGCTGGTCAAGGCGTATGCGCCGCATATCATCCTCCAGACGCGCACCGGCAAGCTCGGGCTCGGCA
CAGCGTACGTGCACGGGCTGCAGTTTGCGACCGGCAACTTTATCATCATCATGGACGCGGACTTTTCGCACCACCCCAAG
TTCATCCCGCAGATGATTGCCAAGCAAAAGGCGGGCGACTACGACATCGTCACCGGCACGCGCTACGCCCCCGGCGGCGG
CGTCTACGGCTGGGACCTCAAGCGCAAGCTCACCAGCAAGGGCGCCAACATCTTTGCCGACACGGTGCTCCGGCCGGGCG
TCTCCGACCTGACCGGCTCTTTTCGGCTGTACAAGCGGGCCGTGCTGGAGAAGCTGTTTGAGAGCACCGACGTGCGCGGC
TTCAGCATGCAGATGGCCCTCGCCGTCACCGCAAAGGCCCTCGGCTACACCATCGCTGAGGTGCCCATCACCTTTGTCGA
TCGCGTCTACGGAAACTCCAAGATGGGCGTCGGCGAGATCGCCGAGTACGTTCTCGGCGTCGGCAGCCTCTGGCTCAAGG
TGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62