GenePrediction:GLEAN_1074 Details

Name: GLEAN_1074
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:410358..412003 (+ strand)
Length: 1646
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:410358..411592 (+ strand)
Length: 1235
Type: CDS
Source: GLEAN
Position: GCSC_173:411760..412003 (+ strand)
Length: 244
>GLEAN_1074 class=GenePrediction position=GCSC_173:410358..412003 (+ strand)
ATGCTTCCGACAAAATCGTATAGCTCCCTCAAGGGAATGCTGCCTCGGATACATCATCCGCTGCCGCTGAACGAGAAGAG
CACAAAGAAGCTGTTGGACACGCTGACGACGTCGTTTCGCAAGCATCTCGACCGGGAGCACGGCTGGCTCGAGGAGGAAG
ATGCTGCGCCGAGGCGGGCGCTGAGACGGGGCGCTCCGACAGAGTCAATGCCGGCGGCGGCGCCTTTGTTTTCGTTGACC
GCACAGCCGGCAACGCACCGGCCAACGGACCACCACCTGCGGGCGATCCTGGCGAACCCGCTCTTCAGCTACGACCAAAC
GGTGCGGAGCGAGGTACGGCAGGGGACGGAGCGGGACCCAATGGACATCTTCGACTGGGCGGTAGCGCGGGGGCTGATGA
CGCCGAAGCGGGCGGCCGGCTGCTTGCTGGCGAAGAGGCGGGAGGCGGTGCTGTCGTCAAGCGTGTCGGCCAAGGCGTCG
ATGGCGGCGTCAGGAGCGGGGCTCAAGGTGCTGCAGTGGCTGCGGGCGGCCGGACTGGAGCGGGACCTGTCGTTTGTGGC
GGACGTGCAGCTGACGGGCGTGCTGGTGCAGTTCCTGGCGGCCGAGGACCAGCTGGACGAGGTGGTGTGGACCTGGATCG
AGCGGCTACGGGGAGACGGTGCGGCGGCCTCGGCAGCCTCGGCCTCCTTTCTGCTGGACCGCCTGGTCAAGGCCAAGGCC
GGCGGAGCGGTCACGCTGGACGAGGCGTACCGCACGATGGCGCGGGGGGCAGAGGTGTTCCGGCACGGCACCCAATTCTC
CAAGGCCAGCGCCAACGCCATCTTCTGGACGTGGTGCTACCTCTCGTGGAAGTCCACGTTCAAGGCGTGGAACCTCTCGA
GTCCGTCCCCCCAGCTGTACGAGGCCTTTGTGGCCATCATGGACGACGACGACCGGCCGAGCATCCGGCTAGAACGCGCC
CACCTGGACCTCCGCCACCCGACACACCCGAGTCCCGCGCCAGCTGTGGCGCTGCTCGCCGACGACGACCTCCTGCACAG
CATACAGACCAGCACGGCCACGTCGGAGCCGCCACCGCCCGGTCGCGTGCCCGCCTATCCGGGCCGCATCGTATCCATGG
GCCTCGACACGGTGCGGCACCTCGCGTTTGTCGGCGAGCCGGCTGAGGCACAGCGGATCCTCGACCGGCTGCGGCAGCAG
TTTGGCGGTCACCTGGACCAGATGTCGCTGCACACGTGAGAGACGTGAGAGTGCCGTGGTCGCCCGGTGCGCAAACACGA
AACGAACTCGGATGTAAAGATATGGTAGAACCAGCTCAGAACTGCTACAGAACTGCTACAGAATAATACCCACGGGCACC
CGCTACGCAATCGCACCCAACCTCACACACCCCTGCTCATAGGTCTGCCGATTCTCTTCAGACTCATGCTGAACGGACGG
AGGAGGCGGACGCGAGGACGACGGCGCATGACGTCGGGTGCCACCGGTTTCTCAAATCCGAGAGCCGGCAGGGCCGGCTT
GTAGATGTTGATCGAGACGACGTGCAAAGCACTGATGGCACAATCGCCTCAGCCACGTTGGACGCCAGCAGACGCAGCTT
AAATATTTGCAAGTTATCGGTCATGCGGCGCACCTTGCTGAGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62