GenePrediction:GLEAN_1076 Details

Name: GLEAN_1076
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:416865..420224 (+ strand)
Length: 3360
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:416865..416966 (+ strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_173:417147..417575 (+ strand)
Length: 429
Type: CDS
Source: GLEAN
Position: GCSC_173:417627..420224 (+ strand)
Length: 2598
>GLEAN_1076 class=GenePrediction position=GCSC_173:416865..420224 (+ strand)
ATGGATCTGCCCACAAAACTACTTCATTTTGTCTTCGCAAGAGATGGGACAAATGGCGCACAGGAGCTTCTCATTCTCCT
CCAGAATCCTTTTGCTGGACAGGTCCGCATCTCTTTCTTACTTTTGCTACTGTTCCTAGTCTCTGGCGTTTGCTAACCTA
AATCAGCTCCAAGTTGGATCTAATACTGGGCGTCTGTTGGCTCATCCTTTGGCGTCACTGCTGGCATTGCCCTCCTATTC
TCCCTCATCCGCCCATACCATACTGTCGTCTATGCTCCGAAGCTAAAACATGCCGACGAGCAACACGCTCCGCCCCAGGT
GGGCAAAGGCTTTTTTGCCTGGATCGGTCCTCTATGGAAAACCAACGAGCAGGATCTTGTCCGGCTGGTCGGCTTGGACG
CCACCATCTTTATGCGGTTCACTGCCATGTGCCGCAACATTTTCACCGTTATCGCCATTCTCGGCTGCTCTATCCTAATT
CCCGTTAATTATACGAAGAGTGTGCGTTTTCCGAACGACGTCTGGCTCAACATGATGGGCCCGTTGAATGTCTACGGCGA
CCCACAGTGGATGAACGTGGTCATGATCTGGACCATGAACATGATTGTGGCTTTCTTCCTCTGGTGGAATTACAGACAGA
TTCTCAAGCTCAGGCGGCAGTACTTCGACAGCCCAGAGTACCAGATGAGTCTGCATTCTCGCACCCTGATGGTATGTCTT
CTTCCTTCCTTCCCTGAGCGTTGAAGTTTACTGACTGTGCAGCTGTATGATATTCCCAAAAAATTCAGCTCCGACGAGGG
TATCGCGCGCATTATAGACAAAGTCGCCCCCAGCTCGTCTTTCTCCCGCACCGCCGTTGCGCGCAATGTCAAGATTCTGC
CGCAGCTGATCAAAGAGCATGAAAAGACAGTACGCAAGCTGGAAGAGGTGTTGGCCAAGTACCTGAAGGACCCTCAGAAT
CTGCCTGCTGCCCGGCCCTTGTGCTTCCCGTCAAAGAAAGATCGGTCGTATGCGACGTATCCCCGGGGCCAGAAAGTTGA
CGCCATTGAATACCTCACACAGCGTATTCGCGAGCTCGAGCTGGAGGTGAAAGATGTGCGCCAGAGTGTCGACAAACGGA
ACACAATGTCCTACGGCTTTGCCTCTTACTCAGAAATCAGCGAGGCGCACGCAATTGCGTATGCTGCACGCAACAAGAAG
CCGCATGGAACCATCATCAAGCTTGCCACACGCCCGAACGACATTATTTGGGACAACATGCCTCTAACTGCTGCTACTCG
AGGCCGTCGCCGGTTCCTAAATAATGTCTGGATTGGTCTGCTGACCATGTTTTGGATCGCTCCCAACGCCATGATTGCCA
TCTTTCTCGTTAGCCTGAGCAATCTCGGCCTGGTCTGGCCGGCCTTTCAGACACAGTTGGAGACGAATAGCGTTTTTTGG
CAGATTGTTCAGGGTGTGGCGTCACCAGCCGTGACCTCTGCCGTTTACCTACTGCTGCCTATCGTGTTCCGACGCCTGGC
CATCCGATCTGGCAACCAGACGAAGACTGGTCGCGAGCGCCACGTCTTGGCGAAACTGTACTCGTTCTTTGTCTTCAACA
ACCTCATCATCTTTTCGCTCTTCAGCGCCATCTGGACGTTTATCTCGGCCGTGGTGGACAAGACCAATAGCGGAGAAGAC
GGCTGGAAGGCGATTGTGTCTTCTCAACCCGGCAACACCTTCCTTAGCAGTCTCTGCAACATCTCTCCTTTCTGGATCAC
TTGGCTGCTGCAGCGGCAGATGGGTGTCGCGATCGACCTTGCTCAGCTGTGGAAGCTCTTGTGGAGCTTCATCAAGCGCA
AGTTTTCTAGCCCGACCCCCCGCGAACTGATTGAGCTTACGGCACCGCCTACCTTTGACTATGCCAGTTACTACAACTAC
CTGCTGTACTACTCAACCGTGGCTCTCTGTTTCGGCTGCATTCAGCCTCTCGTCTTGCCGGCTGCCGCAATCTACTTCAC
TGTCGATGTGGTGCTGCGCAAGTATATGATTCTTTACGTTTTTGTCACCAAGACGGAATCCGGCGGACAATTTTGGCGTG
TCCTGTTTAACCGATTCATCTTCGCTATCATTCTGGCCAACCTTGTCGCGTTCCTAATAGTGTTTGTTCGCGGCAATGCC
AACCATTACCAGTCCTACGCCATTGCTCCGCTGCCTTTCCTTCAGCTGATATTCAAGCTTTACTGTTCTCGCACCTACGA
CGACAAGATACGCTATTACACGACACGGAACGTCCTCGCAAACCCGGAAGCCGGCTTGGACATTGCGAGCAAGGAGATTA
TGCGCAGCGACCGACTGAGCACCCGTTTTGGTCACCCGGTTCTGTACAAACCGCTTATTACGCCAATGGTGCATGCCAAA
GCCCAGAACATACTAGCCAGCGTGTATTCCGGTCGTCTGACGGCAGGCCGGGATGCTGGCAGTGGCGATTCGGCATCGGT
GTCGGGCTATTCGGATACATATGTACTTGACCGGATGAACTCGAAGCAACCCGGCAAGACTGCGATCGGAGGCGGTGTGG
CTATGCCCGGGTTCGAAGTGGTGCCCGAGTCAAAGCTGGACTTTGGTTACTACAAGAACCGGGACGAATTTGGCGACGAT
CACGGCGGTGGTGACATTTTTGGCGTGTCTGGAGATCTTGTCCGACCAGGCACACCCGGGAGCATTATGACCAGTGTAGA
CTCCAGGCCAGGCACTCCTCTGGGTGGCATGACAGGACAGCGGCAGTTTTCGGCAGCCAATGCGATGCCCGGCGGGCCAG
AAGTAGGGACGGTCTACGCACCCGGGTACAACAAGCCTGGCGCACCGCATTTCGTGGCAAGCGCTGTGCGGACACAGTCT
CCAGCACCCTATGGAAGTGCGCAATGGTCCACATCGCCCAGTGCTAGCTCGATGCGCTTGGGCCCTGCGCTGGAGGTAAC
GCGCATGCGCTCACCTTTATACGGGGCGGGGTCTGGTGGAAATGACAGCTCGAGTGACCTGATGGGCAATGCAGCACCCA
TGGCGGTTGCAGCTCCCGTGGCGATGTCGTACGGGCCGCGAAGCGGCTCAGCACAACCGGGGGCGCCGAACAGGGCAGCC
AGCGGCGCGGCGAACTCGAACTCGAGCGACTGGAACGTGGAACGTGCAATGGGCTCTACGCGTGGGCCGAGCGGGTACAC
CCGAGGGCTGCAGGGCTACGGCAACCTGCCGCAAGAGGACCAGGACGCAGACGGAGGAGAGCCGACACAGTACGACTACT
TCCGAGGACGAGCCGCACAACGAAATGGCGGCGACGGATATAACGGCATGGACAGCGTTGGTAGAAGGCCGCTGAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62