GenePrediction:GLEAN_1077 Details

Name: GLEAN_1077
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:423478..426211 (+ strand)
Length: 2734
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:423478..424169 (+ strand)
Length: 692
Type: CDS
Source: GLEAN
Position: GCSC_173:424238..425792 (+ strand)
Length: 1555
Type: CDS
Source: GLEAN
Position: GCSC_173:425999..426211 (+ strand)
Length: 213
>GLEAN_1077 class=GenePrediction position=GCSC_173:423478..426211 (+ strand)
ATGGCCTCTACCCGGTCGAGCGCCGACGAAGGCGAGATTGTCGAAGGGCACCGCGCCGAACAATCCAAGGCAAAGACACA
TGCTGCTCCGGCGGCTTCTGCTCTGCACCGTGATGGGAACCGCCCCAGTGTTGACCGTCGCGACAGAAACCATCGAGGGC
GATCACCACGCTCGCCCGAGAGACCGGGCGCCGGAGCCGGTGTCCCGTATCGCAACCTGTCTCCGCGAGGTCTGAAGCGA
CAGCGAGACGATCGGAATCGTGATCGCGACCGCTGGGACAATAGACGTGGCGGCCGGCGGTATGAAGACGAATCAGTGCG
TGACCGTCGCGACCGTGAACTTCGATATGACGACACGGGCAACAGAGGAAAGAGACAGCGCACCCGCAGCCGCTCTCCGC
CTCCGCCAGCCGACCGTGGAAACAATGGCCGGGGCTGGAACGACCGCAGTCGACAAGACCGTGGACGTGACGGCGGACGT
GACGGCGGCCGCGACCGAGACTGGGGCGACCGTTCTGGTCGGCGCCCGTACGATGTGCACCAGGCTGAGTCTGTCCCGGG
CCAGGGTCCCCAGCAGCGCAGTGCCCGTTCAGCCGCAGCTGCGGCGGGACTTGCAGGAAATGGAGTTGCTAAATCTGTCA
AAGGGGTCTCATTCCACCTGAGCGGCGAGTCCGGTCCTGTCCGTCCTGGAAAGTAAGAGCTGAGAGGACAGACGACTGGG
TTGACTGTCGATTCTCCATGCTGACTCGAGTTCGCATTAGGGAATTGCCCGTGCCGCAAGATTGGGCAGAACCGGAGCCC
ATTGACGAGGAAGCCGAGATCCGGCGCCGTCGACAGCGCCGAGAGGAAATCCTGAAAAAGTCTCGCGCCTCCACCCCTCT
GCAAGCGGTATCCATCCAGGCTGACAAGGCGGCCGCACCCACGGCCGTCGAGTCTAACACGCAGGTGAAAAGTCCGGAGA
CGGGCAATAACACGCCTCGTTCAGGTGAGACGCCCAAGCAGTCTGTCGCCGTCGAGGACGCCTTTGCTGACAGTGCCATA
GTCGATTCTTCCCTGACAAGGGGCGAGGCTGCGGAGTCGGAGGGGCTGCTTGACCTTGCCGACGACCGCGCATTTATGGA
TGCGCTCGGGAAGCACGCCATCGGCGACGGTCCCGACGTCGAGGACGGGCCGTCCGCGGCCGACTACGACCCGACGGTCG
ACATGGAGATCGACGAGCGACGGGACGAACTTCGCCACGGACTCACAGCGGCGGTCGAGATGGACCTGAGCAGCGAAGCT
GCAGACGTGACCGCACCAGACACCGGCAACAACGATGGTGGAGACGACAGCGACGAGGACGACATGTTTGCGGAAGACTT
TGTGGAGAAGAAGTATGTGGCACCCACGACGACAGCAAACGGGACGGCAGATACGGCAGCAGCCAAGGACGCAGCCGCTG
CAGCAGCGCCAGCCAACGGCGGAGGCATCCTGGAGGGCGACGACCAGCAGGGCTACTACAAGATCCGACCGGGCGAGGTG
CTGGACGGACGATACCAGGTGCTGACGGCGCTAGGTAAGGGCATGTTCTCGGGAGTGGGGCGAGCGCGAGACATTGCGAG
CGCAGACGGCAAGCGAGAGGTAGCGATCAAGATCATGCGCAACAACGATGCGCTGCGCAAAGGCGGCTACACGGAGATTG
CCATCCTGGAGAAGCTCAACGAGGCAGACGCGAACGACAAGAAGCACATTGTGCGGTTTGAGCGGGCGTTTGACTACCGC
GGACACCTGTGCATGGCGTTTGAGAACCTGTCGATGAACCTGCGCGAGGTGCTGAAGAAGTTTGGCAACAACGTGGTAAT
CAACCTGACCGGCGTGCGCGTGTTTGCTTACCAGATCTTCGTGGCGCTGGCACACATGCGGCGTTGCAGCATCATCCACG
CGGACCTGAAGCCGGACAACATCCTCGTTAACGAGACGCGCACGGCGCTTAAGATCTGCGACTTGGGCACGGCCATCGAC
CGGTCCGACGCCGTCACGGCACACAACGAGATCACGCCCTATCTCGTCAGTCGTTTCTACCGCGCACCCGAGATCATCCT
CGGCATGCCCTACGACCATGCCATTGACATGTGGTCCATCGGCTGCACCCTCTACGAGCTCTACACCGGAAAGATCCTCT
TCGCCGGCGAGAGCAACAACCAGATGTTGCGCGCCATCATGGAGATCCGCGGCAAGATCAGCGCAAAGCTGTACCGTCGC
GGCGACCTCTGGCCCATGCACTTTGACGACATGGGCGGCTTTCTCAGCCAGGAGCACGACAAGTTCCAGGCCAAGGTACG
TCTTTGCCATTCCGTCTTTTTGTCGTGCTCGATTCCTCGTCTTTTCCTGCTTCTCTCCCCCTGGCTGTCCGAATCTCAGC
TTGGGGTCTCTGTGGCTGAAGGTGGGATGTTTTTTCGATCGCCATTGTTAATCTGTTGGCGCCTTCATGCGCTTCCTGCA
AAGTACCAACGCGCTGATACCCTCTGTTTTACCACTTGCAGACAACAGTCAAAACGCTCACGGTGATCAAACCGACACGT
GATCTTCGCACTCGCCTCTTGGCCGCTTCGGCTGGCATGGACGACGCCGAGACCAAGGAACTGAATCAGTTCCACGACCT
GTTGGACCGCTGCCTCAGCCTGAACCCGGACAAGCGGATCCTGCCTGGCGATGCGCTCAAGCACCCATTCTTCACCCAGC
GGTCAGCTCGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62