GenePrediction:GLEAN_1078 Details

Name: GLEAN_1078
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:435014..436911 (+ strand)
Length: 1898
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:435014..435731 (+ strand)
Length: 718
Type: CDS
Source: GLEAN
Position: GCSC_173:435788..436911 (+ strand)
Length: 1124
>GLEAN_1078 class=GenePrediction position=GCSC_173:435014..436911 (+ strand)
ATGCAGCATGTTCTGGTACCGAACGGAATCCCGACTCCTCCAGCGTCGCCGCTGTCCTGGGACCAGCAGAAGTATCTCTC
GCCGCACCAGCAGCAGCAGCAGCACTTCTTCCAGCCACCACACCCGCACCACATCCAGCAGCGCTATGTCCCGGTAACGC
CAGAGGAGCGGATTGGTTTGCGCTTGGAGGAGTCGCTCCAGCTGACCGGCATCATCGGGACCGGAGCCTATGGTGTGGTG
TACCAGGCCGTCGACCTGAAGACTAGCACCCGGTATGCCGTAAAGGCCCTGAGCAAGCTCAACCCGGATGGAAGCCCACT
GGACGCTCGCCAGCTCGAGTACCAGGACCGGGAAATCAGTCTCCACTATGCCGCTTCGGCTCACCCCAATGTGGTCTCCA
TGCTTAAGATCATCGACGTCTACCCGGATTGCCTTTATGTTGTGCTGGAGTACTGCCCTGAGGGCGATCTGTTCTACAAC
ATTACGGAATGCGGACACTTTGTGGGCAAAGACGAGCTGGCACGTCGGGTCTTCCTGCAGATTCTGGATGCCGTCGACCA
CCTGCACCAGCTGGGAATCTACCACCGGGATCTGAAGCCGGAGAACATCCTGGTCGCAAACGGTGGAGAGACGCTAAAGC
TGGCGGACTTCGGGTTGGCCACCTCTGCCGAACAGTCGGAAGACTACGGCTGTGGCTCGACCTTTTACATGTCGCCTGGT
TCGTGCATCCATCCCTGTTGCCGTCCTCTACGCCAGGTTACTAACTGATAGCAGAATGTCTGGGCCAGTCCAGTGCCGTC
CGGCCATACTACTACTGTGCTCCTAACGATGTGTGGAGCTTGGGTGTGATCTTGGTCAACCTGACATGTGGACGCAACCC
ATGGAAGCAAGCTTCGCACGAGGACTCTACCTACCGGGCCTACACACGTAACTCGGGCTTCCTCAAGACCATCCTTCCCC
TGACGGACGAACTGGATGCCATCCTGGCTCGGATCTTTACCCCGAACCCGGACCAGAGGATCACGCTGCCCCAGTTGAGA
CAGCTCATCCTGGCCTGCCCCCGTCTGACTGCGCAGCCGCAGCAGCAGGTGGCAGCGCCAGCTGTCGTGCAGTCGGTGCT
CACGCCGCCCGCTTCGGATGACCACTCGAATGCGGCGGCCGCTGCTGTCGAGGAGACTATGGTGCCAACGGTGGAGACGC
CCGCGGATTTTGACAACTTTGCCACCCTGTCCCCTGCTTCCTCTGTCCTGTCATCGGCCTCGTCTGTGCGGACGTGCACG
TCTAGCATCTCCTCGGTTATGGACTCTCTCTTGGACGACGACGAAACTGGCGACGTGTTCTTGTGCCAGGACGTCCCGGA
GATCATGACCCCACCACCCGTGTCTTCTGTGCACCCCCTCCCCTGTCACCCCGCTCACAACGACATGCTGGCTGTCTACG
AGCCCGAGGATGCTTCTATGATCGGTGGCCCTTACCTCCAGCAGCAGCAACAACAACATCAGCAGCAGCAGCAGCAGCTT
CACCTACAGCCGACAGCCTACCACGTCCATCAAACTATGCACATGCCACAGGACTACGTTACGTTTCACCATCCGATCGC
GGTCCCACATCCGGACCAGCCTCTCACACTTCAACAACCCTTACCGATGCCTCCTGTGCTACTGCACCAACAGCATCCCG
TTCTCACCCATCCCTCCCCATCCACGCCGCTCCTGCAACAGCAGCAGCAGCAGCAGCAGATCATGCAGCAACCGATAACA
TGCGGTTCAGCTTCAAAGTTTCTGCTCTGGGATTGGGTCATTGGCAGGAATGGCCAGTCTGCGCAGCAGTTTCGGTCGTT
CCACCCAATGTCTATCCTTCCTATCCCCCATTCCGTCTTCTTACCGGGCTGCCATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62